Literature DB >> 29100403

Lactobacillus reuteri ZJ617 maintains intestinal integrity via regulating tight junction, autophagy and apoptosis in mice challenged with lipopolysaccharide.

Yanjun Cui1,2, Li Liu1, Xiaoxiao Dou1, Chong Wang1, Wenming Zhang1, Kan Gao1, Jianxin Liu2, Haifeng Wang1,2.   

Abstract

Live probiotics are effective in reducing gut permeability and inflammation. We have previously reported that Lactobacillus reuteri ZJ617 (ZJ617) with high adhesive and Lactobacillus rhamnosus GG (LGG) can ameliorate intestine inflammation induced by lipopolysaccharide (LPS). The present study was aimed at elucidating the roles of ZJ617 and LGG in alleviating the LPS-induced barrier dysfunction of ileum in mice. Six C57BL/6 mice per group were orally inoculated with ZJ617 or LGG for one week (1× 108 CFU/mouse) and intraperitoneally injected with LPS (10 mg/kg body weight) for 24 h. The results demonstrated that pretreatment with ZJ617 and LGG attenuated LPS-induced increase in intestinal permeability. The probiotics supplementation suppressed LPS-induced oxidative stress. Both ZJ617 and LGG strongly reversed the decline of occludin and claudin-3 expression induced by LPS challenge. ZJ617 relieved LPS-induced apoptosis by decreasing caspase-3 activity. Noticeably, ratio of microtubule-associated light chain 3 (LC3)-II/LC3-I and LC3 activity were elevated by LPS stimulation, whereas such increases were obviously attenuated by both of the probiotics treatment. Moreover, phosphorylated mammalian target of rapamycin (p-mTOR) was significantly inhibited by LPS, whereas complementation of ZJ617 and LGG markedly increased the expression of p-mTOR. Collectively, our results indicated that ZJ617 could protect LPS-induced intestinal barrier dysfunction via enhancing antioxidant activities and tight junction and attenuating apoptosis and autophagy via mTOR signaling pathway. These findings could serve as systematic mechanisms through which probiotics promote and maintain gut homeostasis.

Entities:  

Keywords:  apoptosis; autophagy; intestinal barrier; lactobacilli; mice

Year:  2017        PMID: 29100403      PMCID: PMC5652795          DOI: 10.18632/oncotarget.20536

Source DB:  PubMed          Journal:  Oncotarget        ISSN: 1949-2553


INTRODUCTION

The intestinal barrier is important as a selective barrier against endogenous and exogenous noxious antigens and pathogens [1]. Impairment of this barrier can result in the increased intestinal permeability, subsequent translocation of bacteria or/and endotoxin from gut, and even systemic inflammatory response, which is the major pathogenesis for most of intestinal diseases [2]. Multiple factors, including inflammation and oxidative stress, can compromise intestinal epithelial integrity and function [3-5]. Therefore, suppression of intestinal inflammation and oxidative stress may contribute to protecting from the intestinal disruption. Lactobacillus as probiotic bacteria are normal habitants of the gastrointestinal tracts in humans and animals and exert health benefits on the host including gut homeostasis and disease prevention and/or treatment. For instance, Lactobacillus reuteri I5007 could attenuate diquat-induced oxidative stress and maintain the gut epithelial barrier by modulating tight junction protein expression in piglets [6, 7]. The probiotic Lactobacillus coryniformis and L. gasseri SBT2055 reduced intestinal inflammation and permeability in mice, L. acidophilus ameliorated dextran sodium sulphate induced colitis in mice [8]. L. reuteri promotes anti-inflammatory activities in mice with typhlocolitis [9]. These studies suggest that Lactobacillus contribute to attenuating intestine barrier function injury, which is associated with gut inflammation and oxidative stress. The underlying mechanisms by which the probiotics exert positive effects on gut integrity remain to be elucidated. Several reports have shed light on the mechanisms for a variety of Lactobacillus species. Many studies have shown that Lactobacillus reuteri I5007 and Lactobacillus rhamnosus GG (LGG) can maintain epithelial barrier permeability via modulation of TJ proteins expression [7, 10]. Of interest is the finding that L. acidophilus can directly alter epithelial barrier function by influencing the structure of TJ, which is achieved via a MAPK pathway [11]. Beyond tight junction changes, epithelial apoptosis can also contribute to barrier dysfunction [12, 13]. Thus, another study found that bacterial proteins (p75 and p40) isolated from L. rhamnosus cultures effectively block the induction of apoptosis in mouse colon epithelial cells, helping to enhance epithelial barrier function [14]. Beyond Lactobacillus species, a latest finding has demonstrated that Bifidobacterium bifidum, a group of probiotic bacterial strains, effectively alleviates LPS-induced autophagy and significantly ameliorates and restores physical barrier integrity that is diminished by LPS treatment in rat intestinal epithelial cells [15]. To our knowledge, reports on how the Lactobacillus species regulate the autophagy are rare. Adhesive ability of probiotics to intestinal surfaces is believed to be of critical importance to confer benefit to the host. Two high adhesive strains of Lactobacillus exerted anti-inflammatory effects on Salmonella-infected intestinal epithelial cells (IEC) [16]. L. fermentum I5007, a high adhesion strain isolated from the gastrointestinal tract of piglet, showed beneficial effects on the gut epithelial barrier in neonatal piglets [17]. Our group isolated a novel Lactobacillus reuteri strain with high adhesive ability (adhesion indexes of 12.35 ± 0.09 CFU/cell), named ZJ617 [16], of which surface protein GAPDH serves as a key adhesion component [18]. This strain showed great tolerance to heat, acid, bile salt, Zn2+ and Cu2+, as well as antagonism to pathogenic agents [16]. Subsequently, our studies demonstrated that this strain could ameliorate inflammation and modulate the intestinal immune response and metabolism in LPS-induced mice [19]. Collectively, our present researches indicate that Lactobacillus reuteri ZJ617 can be used as a novel probiotic candidate. LGG is a widely studied probiotic that has well-documented adhesive properties. Therefore, LGG as a model of probiotic bacterium was compared with ZJ617 in light of their effects on gut integrity in this study. In the current experiments, we elaborated whether the probiotic ZJ617 could attenuate LPS-induced intestinal barrier dysfunction through its anti-inflammation, antioxidant and regulating effect on the tight junction, apoptosis and autophagy.

RESULTS

Oral administration of LAB attenuated the LPS-induced oxidative stress in the serum

Oxidative stress in the serum was assessed by measuring the activity of SOD (Figure 1A) and the level of MDA (Figure 1B). In our mice model the SOD activity in serum significantly decreased after the challenge with LPS (P < 0.05, Figure 1A). However, administration of the ZJ617 and LGG strain restored SOD levels (Figure 1A). LPS treatment caused an increase in the MDA levels, while LGG and ZJ617 supplementation decreased the levels of MDA that reached the normal values (Figure 1B).
Figure 1

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on LPS-induced oxidative damage

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Blood samples were obtained 24 h after injection to evaluate serum superoxide dismutase (SOD) activity (A) and malondialdehyde (MDA) levels (B). The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05).

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on LPS-induced oxidative damage

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Blood samples were obtained 24 h after injection to evaluate serum superoxide dismutase (SOD) activity (A) and malondialdehyde (MDA) levels (B). The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05).

LAB treatment decreases LPS-induced intestinal permeability in mice

To investigate the probiotic effect of ZJ617 on intestinal permeability of mice challenged with LPS, serum D-xylose concentrations (Figure 2A) and DAO activity (Figure 2B) were measured as markers of intestine integrity. We observed that challenge with LPS significantly increased serum D-xylose (P < 0.05, Figure 2A) and DAO (P < 0.05, Figure 2B) and treatment with LGG and ZJ617 significantly reduced them.
Figure 2

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on LPS-induced intestinal integrity

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Blood samples were obtained 24 h after injection of LPS to evaluate serum D-xylose levels (A) and diamine oxidase activities (DAO) (B). The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05).

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on LPS-induced intestinal integrity

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Blood samples were obtained 24 h after injection of LPS to evaluate serum D-xylose levels (A) and diamine oxidase activities (DAO) (B). The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05).

LAB supplementation attenuates LPS-induced tight junction protein expression in the ileum

Occludin and claudin-3, tight junction proteins, play a vital role in gut permeability. Western blotting analysis reveled that a significant decrease in the both proteins abundance after LPS stimulation; LGG and ZJ617 treatment attenuated this reduction (P < 0.05, Figure 3). Consistent with the results of western-blot analysis, IHC analysis indicated that LPS stimulation caused a reduction in abundance of both occludin and claudin-3, and LGG and ZJ617 treatment normalized tight junction protein expression (P < 0.05, Figure 4).
Figure 3

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal tight junctions in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. Immunoblotting of and quantitative analysis of ileal occludin and claudin 3. The protein bands were quantified by densitometry analysis, normalized to GAPDH. The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05).

Figure 4

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal tight junctions in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. Immunohistochemistry of and quantitative analysis of ileal occludin and claudin 3. Brown staining indicates occludin and claudin 3 positive cells. The ratio of positive-stained cells/all cells is expressed as the mean ± SD (n= 6). Different alphabet indicates significance (P < 0.05).

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal tight junctions in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. Immunoblotting of and quantitative analysis of ileal occludin and claudin 3. The protein bands were quantified by densitometry analysis, normalized to GAPDH. The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05). Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. Immunohistochemistry of and quantitative analysis of ileal occludin and claudin 3. Brown staining indicates occludin and claudin 3 positive cells. The ratio of positive-stained cells/all cells is expressed as the mean ± SD (n= 6). Different alphabet indicates significance (P < 0.05).

LAB treatment ameliorates LPS-induced apoptosis in the ileum

To evaluate the effects of probiotic LAB on apoptosis of mice challenged with LPS, we investigated an apoptosis marker caspase-3. LPS treatment contributed to up-regulation of caspase-3, while ZJ617 rather than LGG decreased its expression to the normal level (Figure 5A). In line with the results of western-blot analysis, IHC analysis indicated that LPS stimulation increased caspase-3 activity, and such increase was attenuated by LGG and ZJ617 treatment (P < 0.05, Figure 5B).
Figure 5

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal apoptosis in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. (A) Immunoblotting of and quantitative analysis of ileal caspase 3. The protein bands were quantified by densitometry analysis, normalized to GAPDH. The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05). (B) Immunohistochemistry of and quantitative analysis of ileal caspase 3. Brown staining indicates caspase 3 positive cells. The ratio of positive-stained cells/all cells is expressed as the mean ± SD (n= 6). Different alphabet indicates significance (P < 0.05).

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal apoptosis in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. (A) Immunoblotting of and quantitative analysis of ileal caspase 3. The protein bands were quantified by densitometry analysis, normalized to GAPDH. The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05). (B) Immunohistochemistry of and quantitative analysis of ileal caspase 3. Brown staining indicates caspase 3 positive cells. The ratio of positive-stained cells/all cells is expressed as the mean ± SD (n= 6). Different alphabet indicates significance (P < 0.05).

LAB treatment protects the intestine from LPS-induced autophagy in the ileum

To determine the effects of probiotic LAB on autophagy of mice challenged with LPS, we investigated autophagy markers beclin-1 and LC3-II and an autophagy initial regulator mTOR in the ileum (Figures 6-8). Challenge with LPS significantly (P < 0.05) increased the beclin-1 and LC3-II mRNA expression by qRT-PCR; ZJ617 and LGG supplementation inhibited such increase (P < 0.05, Figure 6). These findings were confirmed by western blot and IHC analysis for LC3, noting that administration of the ZJ617 and LGG strain significantly ameliorated LPS-induced overexpression of LC3-II (P < 0.05, Figure 7). LPS-induced downregulation of p-mTOR was observed by western blot, while ZJ617 and LGG increased its expression (P < 0.05, Figure 8).
Figure 6

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal autophagy in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. mRNA levels of microtubule-associated light chain 3 (LC 3) (A) and beclin-1 (B) were examined by qRT-PCR. The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05).

Figure 8

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal autophagy in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. Immunoblotting of and quantitative analysis of ileal mammalian target of rapamycin (mTOR). (A) Immunoblotting of and quantitative analysis of ileal mTOR. The protein bands were quantified by densitometry analysis, normalized to GAPDH. The values are expressed as means ± SD (n = 6). (B) Immunohistochemistry of and quantitative analysis of ileal mTOR. Brown staining indicates mTOR positive cells. The ratio of positive-stained cells/all cells is expressed as the mean ± SD (n= 6). Different alphabet indicates significance (P < 0.05).

Figure 7

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal autophagy in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. (A) Immunoblotting of and quantitative analysis of ileal microtubule-associated light chain 3 (LC3). The protein bands were quantified by densitometry analysis, normalized to GAPDH. The values are expressed as means ± SD (n = 6). (B) Immunohistochemistry of and quantitative analysis of ileal LC3. Brown staining indicates LC3 positive cells. The ratio of positive-stained cells/all cells is expressed as the mean ± SD (n= 6). Different alphabet indicates significance (P < 0.05).

Effect of Lactobacillus rhamnosus GG (LGG) and Lactobacillus reuteri ZJ617 (ZJ617) on intestinal autophagy in mice challenged with LPS

Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. mRNA levels of microtubule-associated light chain 3 (LC 3) (A) and beclin-1 (B) were examined by qRT-PCR. The values are expressed as means ± SD (n = 6). Different alphabet indicates significance (P < 0.05). Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. (A) Immunoblotting of and quantitative analysis of ileal microtubule-associated light chain 3 (LC3). The protein bands were quantified by densitometry analysis, normalized to GAPDH. The values are expressed as means ± SD (n = 6). (B) Immunohistochemistry of and quantitative analysis of ileal LC3. Brown staining indicates LC3 positive cells. The ratio of positive-stained cells/all cells is expressed as the mean ± SD (n= 6). Different alphabet indicates significance (P < 0.05). Mice were orally inoculated with lactobacilli for 7 days before the challenge with an intraperitoneal injection of 10 mg/kg LPS. Ileal tissues from six mice in each group were obtained 24 h after injection. Immunoblotting of and quantitative analysis of ileal mammalian target of rapamycin (mTOR). (A) Immunoblotting of and quantitative analysis of ileal mTOR. The protein bands were quantified by densitometry analysis, normalized to GAPDH. The values are expressed as means ± SD (n = 6). (B) Immunohistochemistry of and quantitative analysis of ileal mTOR. Brown staining indicates mTOR positive cells. The ratio of positive-stained cells/all cells is expressed as the mean ± SD (n= 6). Different alphabet indicates significance (P < 0.05).

DISCUSSION

Our previous experiment [19] demonstrated that LGG, a reference strain, and ZJ617, with high adhesive ability, significantly reduced inflammatory damage during endotoxic shock induced by LPS administration in mice. Many studies have shown that oxidative stress and inflammation can interact in many conditions. For example, reactive oxygen species (ROS) scavengers can not only increase activities of antioxidant enzymes (superoxide dismutase, catalase, and glutathione peroxidase), but also improve the levels of IL-10 and decrease TNF-α and other pro-inflammatory cytokines [20]. On the other hand, a growing number of studies have demonstrated that several probiotics LAB acting as anti-inflammation are able to scavenge ROS by improving SOD activities and GSH levels [21, 22]. In support of these reports, our findings suggest that ZJ617 and LGG could strongly reverse the damage associated with the LPS-induced redox imbalance. Intestinal epithelial barrier is primarily composed of epithelial cells and the tight junctions (TJ) between them [23]. Disruption of tight junctions can increase the gut permeability. Occludin and claudins are two main types of transcellular proteins in TJ proteins. Our previous and present studies show that challenge with LPS increases the formation of cytokines and ROS in mice, both of which can disrupt the TJ and compromise the barrier function of the intestinal epithelium [11, 24]. Many studies have shown that pretreatment with probiotic bacteria can inhibit the decrease in resistance and TJ alteration caused by stress or proinflammatory cytokines [25, 26]. Compared with LPS group, pretreatment with LGG and ZJ617 significantly reduced intestine permeability, and increased expression of occludin and claudin 3. These data support the notion that ZJ617 and LGG pretreatments contribute to a decrease in oxidative stress and inflammation, which in turn, lead to improved tight junction protein expression and thus to restoration of barrier function. On the other hand, epithelial barrier permeability is attributed to regulation of TJ structure which is achieved via myosin light chain II (MLC) phosphorylation [27]. MLC kinase (MLCK), MAP kinases ERK1/2 and p38 can all phosphorylate MLC causing increased permeability [28]. Our previous studies demonstrated that ZJ617 and LGG could significantly suppress LPS-induced phosphorylation of p38 MAPK, ERK1/2, which may lead to decrease in MLC phosphorylation. Taken together, these results indicate that ZJ617 and LGG protect the intestinal epithelial tight junctions and the barrier function from LPS-induced insult by restoration of TJ protein expression and maintenance of TJ structure via MAP kinase-dependent mechanism. Epithelial turnover, including cell proliferation and apoptosis, play a critical role in maintenance of intestinal integrity [29, 30]. Epithelial cell apoptosis increase has been considered to be the main mechanism underling the intestinal mucosal injury. Increased permeability of the epithelial barrier can be caused by apoptosis via caspase-3 activation [31]. In the current study, ZJ617 supplementation reduced apoptosis induced by LPS challenge. In support of our results, previous reports demonstrated that the probiotic bacterium Lactobacillus rhamnosus prevented cytokine-induced apoptosis in epithelial cell lines [14]. These results suggest that ZJ617 supplementation may protect intestinal integrity by inhibiting epithelial cell apoptosis, although the mechanism of the Lactobacillus regulation of cell apoptosis has not been fully elucidated. A previous study has reported that LGG prevents cytokine-induced apoptosis in both human and mouse intestinal epithelial cells through inhibiting p38 MAPK activation [32]. Autophagy is regarded as an essential cell survival mechanism involved in the intestinal barrier function. However, excessive autophagy can bring about pathological conditions and finally to autophagic cell death [33]. LPS has acted as stimulator of autophagic signaling in cultured intestinal epithelial cells and RAW 264.7 cells [15, 34]. A recent study has shown that probiotic bifidobacterium bifidum treatment could effectively inhibit LPS-induced autophagy by preventing autophagolysosomal fusion in rat IEC18 cells [15]. The LC3 is now widely used to monitor autophagy and acts as a good early marker for the formation of autophagosomes. mTOR signaling is a well-known pathway for autophagy induction. Interestingly, we found that p-mTOR expression was reduced but LC3-II expression was elevated by LPS challenge; however, such effect was notably attenuated by LGG and ZJ617. These results are consistent with previous studies showing that mTOR is the major negative regulator of autophagy [35, 36]. Similarly, LGG suppresses human rotavirus-induced autophagy in the gnotobiotic piglet intestine [37]. Our results suggest that treatment with probiotics may suppress increased autophagy via mTOR-dependent pathway and thus protect against intestinal epithelial barrier disruption induced by LPS.

CONCLUSION

Lactobacillus reuteri ZJ617 with high adhesive ability could improve intestinal integrity during endotoxic shock. Its protective effects on the intestine are probably related to alleviating oxidative stress, improving tight junction protein expression, inhibiting apoptosis and autophaugy via mTOR-dependent pathway. The beneficial role of Lactobacillus reuteri ZJ617 may have strong potential for alleviating some inflammation taking place in intestine.

MATERIALS AND METHODS

Bacterial strains and culture

Lactobacillus rhamnosus GG (LGG) was a gift from Prof. Jinru Chen at the University of Georgia. Lactobacillus reuteri ZJ617 with high adhesive abilities were previously isolated from piglet intestine by our experiment colleagues [16]. LGG and ZJ617 were anaerobically grown at 37°C in MRS (de Man, Rogosa and Sharpe medium, Britania, Buenos Aires, Argentina) for 18h. The microorganisms viability was determined by colony forming units (CFU) that were counted by dilution and streaking on MRS agar plates (Difco) at 37°C overnight. Bacteria were harvested at the logarithmic growth phase by centrifugation at 4 °C (5 min, 4000 g), washed twice with phosphate-buffered saline (PBS) and finally suspended in this medium at a concentration of 1 × 108 CFU/ml.

Experiment treatment and sample collection

C57BL/6 mice (20 ± 2 g, 6-8 weeks old) were purchased from Model Animal Research Center of Nanjing University (Nanjing, China). Animal care was performed in accordance with guidelines of the Zhejiang Ethics Committee and received prior approval from the Animal Care and Use Committee in Zhejiang A & F University. Mice were kept at a constant temperature of 26 ± 2 °C with 12 h light–dark cycles and provided with ad libitum feed intake and water. The mice were randomly assigned to four groups (n= 6): two of them, designed as control and LPS groups, received PBS. The others, named as LGG + LPS and ZJ617 + LPS respectively, orally inoculated with LGG or ZJ617 suspended in sterile PBS at the concentration of 1×108 CFU/ml daily prepared respectively. At 7 days after starting the oral administration of the strain, LPS stimulation was conducted in mouse from LPS, LGG + LPS and ZJ617 + LPS groups with an intraperitoneal (i.p.) injection of 10mg/kg LPS respectively. The control groups received an i.p. injection of sterile PBS. The used does of LPS did not induce mice death in the following 24 h determined by our previous study [19]. Blood samples and ileum tissues (5 cm proximal from the ileal-cecal junction) were collected 24 h after the LPS challenge.

Biochemical assays

Blood samples were collected by cardiac puncture. Serum samples were obtained by centrifuging the blood at 3000 g for 15 minutes at 4°C. Inflammatory cytokine TNF-α, D-xylose and malondialdehyde (MDA) concentrations in serum were assayed by ELISA kit (Nanjing Jiancheng Bioengineering Institution, Nanjing, China) according to manufacturer's instruction. Activities of superoxidase dismutase (SOD) and diamine oxidase (DAO) in serum were determined by a kinetic based assay using commercially available kits (Nanjing Jiancheng Bioengineering Institution, Nanjing, China).

Real-time quantitative RT-PCR assay

The mRNA levels were determined by real-time quantitative RT-PCR (qRT-PCR). In brief, total RNA was prepared from each tissue sample (50 mg) using TRIzol reagent according to the manufacturer's protocol according to the manufacturer's instructions (Invitrogen Life Technologies, USA). cDNA synthesis was conducted using the HiFi-MMLV cDNA first strand synthesis kit (CWbio Co., Ltd, Cat#CW0744, China). The gene-specific primer pairs are listed in Table 1. qRT-PCR was performed using an ABI 7500 real-time PCR thermocycler instrument (ABI, Norwalk, CT). qRT-PCR was conducted in a 20-μl reaction system containing 1 μl cDNA, 0.5 μl forward primers (10 μM), 0.5 μl reverse primers (10 μM), 10 μl SYBR Green Supermix, and 8.0 μl water. The fold change was calculated using the 2−ΔΔCt method [38].
Table 1

Primer sequences for the PCR amplification of specific genes

GeneNCBI accession NO.Primer sequenceSense 5’– 3’Primer size (bp)Product size (bp)
Antisense 5 ’– 3 ’
LC 3NM_026160.4CCGAGAAGACCTTCAAGCAG20288
ACACTTCGGAGATGGGAGTG20
Beclin-1XM_006533784.3TGATCCAGGAGCTGGAAGAT20299
CAAGCGACCCAGTCTGAAAT20
GAPDHXM_017321385.1CCCCATAATAACAGGAGGGGC21134
GCTTCACCTCCCCATACACAC21

Western blot

Ileum tissues were lysed using lysis buffer (Sigma-Aldrich) in liquid nitrogen according to the manufacturer's instructions. The concentration of protein in samples was determined by Bradford's method [39]. Total protein (30μg/sample) was separated by electrophoresis (Bio-Rad, Richmond, CA, USA) on 10% SDS-PAGE, and transferred to a PVDF membrane (Millipore, Billerica, MA, USA). The blotted membrane was blocked for 2 h at room temperature in 1 × TBST [0.05% Tween 20, 100 mM Tris–HCl and 150 mM NaCl (pH 7.5)] containing 5% fat-free dry milk, and then incubated under gentle agitation all the night at room temperature in the presence of the primary antibodies: occludin, 1:5000 dilution of purified rabbit polyclonal anti-occludin antibody (Abcam, AB31721, Cambridge, UK); claudin-3, 1: 5000 dilution of purified rabbit polyclonal anti- claudin-3 antibody (Abcam, AB15102, Cambridge, UK); caspase-3, 1:5000 dilution of purified rabbit polyclonal anti- caspase-3 antibody (Abcam, AB13847, Cambridge, UK); glyceraldehyde-3-phophate dehydrogenase (GAPDH), 1:1000 dilution of purified rabbit monoclonal anti-GAPDH antibody (CST, D16H11, Danvers, USA); LC3, 1:1000 dilution of purified rabbit monoclonal anti-LC3 protein antibody (CST, D3U4C, Danvers, USA); mTOR, 1:1000 dilution of purified rabbit monoclonal anti-mTOR protein antibody (CST, 7C10, Danvers, USA); p-mTOR, 1:1000 dilution of purified rabbit monoclonal anti- p-mTOR protein antibody (CST, D3F9, Danvers, USA), which were able to bind to their specific protein. The blots were extensively washed with TBST buffer for 10 min × 3 times and incubated under gentle agitation with the secondary antibodies for immunodetection. The antigenantibody interaction was carried out for 1 h, and the crossreacting proteins were detected using ECL (Perkin Elmer Life Sciences, Boston, MA, USA). The protein bands were visualized with a chemiluminescence substrate using a gel-imaging system (Tanon Science and Technology, Shanghai, China) with Image Analysis Software (National Institutes of Health, Bethesda, MD, USA). In all instances, density values of bands were corrected by subtraction of the background values. GAPDH was used as the internal reference protein. Bands were standardized to the density of GAPDH and normalized fold expression represented as a ratio of each protein to GAPDH.

Immunohistochemistry

Ileum tissues were fixed in formalin, embedded in paraffin, and cut into 4 μm sections according to previous methods [40]. Deparaffinized and rehydrated sections were blocked with 10 % normal goat serum for 1 h. Sections were incubated with the rabbit anti- occludin (1:5000), anti-claudin3 (1:5000), anti-caspase-3 (1:5000), anti-LC3 (1:1000) and anti-mTOR (1:1000) overnight at 4 °C, then with HRP-conjugated secondary antibody for 1 h. The Diaminobenzidine-HRP detection system was added, sections were then counterstained with hematoxylin, dehydrated and cover-slipped. Assessment of positivity of IHC staining [41] were conducted under a microscope (ECLIPSE Ti, Nikon Corp., Tokyo, Japan).

Statistical analysis

Thee values of experimental data were presented as means ± standard deviation (SD) of the replicates. The statistical significance was analyzed using one-way analysis of variance (ANOVA), followed by Duncan's multiple range test using the SAS program (SAS Institute, INC, USA). Differences between groups are considered significant at P values < 0.05.
  40 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  Cell death by autophagy: facts and apparent artefacts.

Authors:  D Denton; S Nicolson; S Kumar
Journal:  Cell Death Differ       Date:  2011-11-04       Impact factor: 15.828

Review 3.  Restoration of barrier function in injured intestinal mucosa.

Authors:  Anthony T Blikslager; Adam J Moeser; Jody L Gookin; Samuel L Jones; Jack Odle
Journal:  Physiol Rev       Date:  2007-04       Impact factor: 37.312

4.  Oral administration of Lactobacillus fermentum I5007 favors intestinal development and alters the intestinal microbiota in formula-fed piglets.

Authors:  Hong Liu; Jiang Zhang; Shihai Zhang; Fengjuan Yang; Phil A Thacker; Guolong Zhang; Shiyan Qiao; Xi Ma
Journal:  J Agric Food Chem       Date:  2014-01-15       Impact factor: 5.279

5.  L-cysteine protects intestinal integrity, attenuates intestinal inflammation and oxidant stress, and modulates NF-κB and Nrf2 pathways in weaned piglets after LPS challenge.

Authors:  Ze he Song; Guo Tong; Kan Xiao; Le fei Jiao; Ya lu Ke; Cai hong Hu
Journal:  Innate Immun       Date:  2016-02-25       Impact factor: 2.680

6.  Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs.

Authors:  C H Hu; K Xiao; Z S Luan; J Song
Journal:  J Anim Sci       Date:  2012-12-10       Impact factor: 3.159

7.  The Role of Probiotics in Lipopolysaccharide-Induced Autophagy in Intestinal Epithelial Cells.

Authors:  Chaoqun Han; Zhen Ding; Huiying Shi; Wei Qian; Xiaohua Hou; Rong Lin
Journal:  Cell Physiol Biochem       Date:  2016-06-17

Review 8.  Autophagy in neurodegenerative disease: friend, foe or turncoat?

Authors:  Ralph A Nixon
Journal:  Trends Neurosci       Date:  2006-07-20       Impact factor: 13.837

9.  Probiotics ameliorate the hydrogen peroxide-induced epithelial barrier disruption by a PKC- and MAP kinase-dependent mechanism.

Authors:  A Seth; Fang Yan; D Brent Polk; R K Rao
Journal:  Am J Physiol Gastrointest Liver Physiol       Date:  2008-02-21       Impact factor: 4.052

10.  A neonatal gnotobiotic pig model of human enterovirus 71 infection and associated immune responses.

Authors:  Xingdong Yang; Guohua Li; Ke Wen; Tammy Bui; Fangning Liu; Jacob Kocher; Bernard S Jortner; Marlice Vonck; Kevin Pelzer; Jie Deng; Runan Zhu; Yuyun Li; Yuan Qian; Lijuan Yuan
Journal:  Emerg Microbes Infect       Date:  2014-05-21       Impact factor: 7.163

View more
  14 in total

Review 1.  Probiotics, Nutrition, and the Small Intestine.

Authors:  Taylor C Judkins; Douglas L Archer; Dean C Kramer; Rebecca J Solch
Journal:  Curr Gastroenterol Rep       Date:  2020-01-13

2.  Pediococcus pentosaceus ZJUAF-4 relieves oxidative stress and restores the gut microbiota in diquat-induced intestinal injury.

Authors:  Lihong Hao; Yuanzhi Cheng; Weifa Su; Cheng Wang; Zeqing Lu; Mingliang Jin; Fengqin Wang; Yizhen Wang
Journal:  Appl Microbiol Biotechnol       Date:  2021-01-21       Impact factor: 4.813

Review 3.  The Probiotic Properties of Lactic Acid Bacteria and Their Applications in Animal Husbandry.

Authors:  Zhaoxi Deng; Kangwei Hou; Jiangchao Zhao; Haifeng Wang
Journal:  Curr Microbiol       Date:  2021-12-14       Impact factor: 2.188

Review 4.  Exploring the Role of Gut Microbiome in Colon Cancer.

Authors:  Indranil Chattopadhyay; Ruby Dhar; Karthikeyan Pethusamy; Ashikh Seethy; Tryambak Srivastava; Ramkishor Sah; Jyoti Sharma; Subhradip Karmakar
Journal:  Appl Biochem Biotechnol       Date:  2021-01-25       Impact factor: 2.926

5.  Bacillus amyloliquefaciens Ameliorates H2O2-Induced Oxidative Damage by Regulating Transporters, Tight Junctions, and Apoptosis Gene Expression in Cell Line IPEC-1.

Authors:  Yanping Wu; Han Xu; Xuefang Cao; Rongrong Liu; Li Tang; Zhonghua Zeng; Weifen Li
Journal:  Probiotics Antimicrob Proteins       Date:  2020-06       Impact factor: 4.609

Review 6.  Potential Mechanisms of Probiotics Action in the Prevention and Treatment of Colorectal Cancer.

Authors:  Marta Molska; Julita Reguła
Journal:  Nutrients       Date:  2019-10-14       Impact factor: 5.717

7.  The Biotherapeutic Potential of Lactobacillus reuteri Characterized Using a Target-Specific Selection Process.

Authors:  Valeria Sagheddu; Francesca Uggeri; Luisella Belogi; Laura Remollino; Paola Brun; Giulia Bernabè; Giancarlo Moretti; Andrea Porzionato; Lorenzo Morelli; Ignazio Castagliuolo; Marina Elli
Journal:  Front Microbiol       Date:  2020-04-15       Impact factor: 5.640

Review 8.  Establishing Boundaries: The Relationship That Exists between Intestinal Epithelial Cells and Gut-Dwelling Bacteria.

Authors:  Amy A O'Callaghan; Sinéad C Corr
Journal:  Microorganisms       Date:  2019-12-09

Review 9.  Regulation of Gut Microbiota and Metabolic Endotoxemia with Dietary Factors.

Authors:  Nobuo Fuke; Naoto Nagata; Hiroyuki Suganuma; Tsuguhito Ota
Journal:  Nutrients       Date:  2019-09-23       Impact factor: 5.717

Review 10.  Modulation of the PI3K/Akt/mTOR signaling pathway by probiotics as a fruitful target for orchestrating the immune response.

Authors:  Amir Hossein Mohseni; Vincenzo Casolaro; Luis G Bermúdez-Humarán; Hossein Keyvani; Sedigheh Taghinezhad-S
Journal:  Gut Microbes       Date:  2021 Jan-Dec
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.