Literature DB >> 29085479

Correlation between osteosarcoma and the expression of WWOX and p53.

Pingtao Liu1, Mingyue Wang2, Li Li1, Tao Jin3.   

Abstract

The objective of this study was to analyze the effect of the expression of WWOX and p53 on the growth of MG-63 osteosarcoma cells and to explore the correlation between osteosarcoma and the expression of WWOX and p53. WWOX and p53-overexpressing MG-63 osteosarcoma cell lines were established by transfection and named the MW and MP cell lines, respectively. Untransfected MG-63 cells (blank control) were used as control. Quantitative polymerase chain reaction (qPCR) and western blot analysis were used to detect the expression of WWOX and wild-type p53 mRNA and protein, respectively. The effects of WWOX and p53 (wild-type) on the activity of MG-63 cells were determined by MTT assay and flow cytometry. The expression of mutant p53 protein in 65 cases of osteosarcoma was detected by immunohistochemistry to analyze the correlation between p53 and the development of osteosarcoma. qPCR showed that WWOX and p53 mRNA was overexpressed in MW and MP cells, respectively. Western blot analysis showed that the levels of WWOX and p53 protein in MW and MP cells were higher than in the blank control group. MTT assay showed that the cell proliferation ability of MW and MP cells was significantly lower than in the blank control group. Flow cytometry showed that 78.49% of MW and 66.76% of MP cells were arrested in the G0/G1 phase. Immunohistochemistry showed that mutant p53 was highly expressed in osteosarcoma, with a positive expression rate of 47.7%. The expression rate was positively correlated with the pathological grade of cancer. In conclusion, WWOX can affect the cell cycle of MG-63 osteosarcoma cells to inhibit cell proliferation, which provides new insights into gene therapy for osteosarcoma. The two types of the p53 gene have different functions in the development of osteosarcoma. Wild-type p53 acts as a tumor suppressor, while mutant p53, which is overexpressed in malignant osteosarcoma, has a carcinogenic effect associated with the degree of osteosarcoma.

Entities:  

Keywords:  WWOX gene; osteosarcoma; p53 gene

Year:  2017        PMID: 29085479      PMCID: PMC5649648          DOI: 10.3892/ol.2017.6747

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Osteosarcoma, one of the primary malignant tumors of bone, is the most common bone cancer and accounts for 20% of primary malignant tumors (1). Osteosarcoma occurs mainly in youth, with a higher incidence in males (2). At present, the treatment of osteosarcoma primarily includes surgery, radiotherapy and chemotherapy and the 5-year survival rate of osteosarcoma ranges from 20 to 75% (3). However, there are many chemotherapy-insensitive osteosarcoma patients with a high risk of tumor metastasis and recurrence. Therefore, it is highly important to identify a more effective and stable method for the diagnosis and treatment of osteosarcoma. The activation of proto-oncogenes and the inactivation of tumor suppressor genes can affect the cell cycle and apoptosis, which in turn lead to tumorigenesis (4). Therefore, studying osteosarcoma-related tumor suppressor genes at the molecular level to improve the diagnosis and treatment of osteosarcoma has high clinical value. Tumor suppressor genes can inhibit tumor cell proliferation, oncogenesis, invasion, metastasis, apoptosis and even death and have become a research focus in the field of osteosarcoma gene therapy. The WWOX and p53 genes are classical tumor suppressor genes. WWOX, which is located on chromosome 16q23, spans the entire chromosomal fragile site, FRA16D (5). WWOX contains nine exons. The first four exons of WWOX encode the WW domain and exons 5–8 encode the oxidoreductase domain (6). WWOX can inhibit tumor cell activity and this inhibitory effect has been reported in a variety of tumors, such as glioma (7), lung cancer (8) and thyroid cancer (9). The p53 gene, which is located on the short arm of human chromosome 17, encodes a protein that can promote DNA repair, transient and sustained cell growth arrest, apoptosis and senescence (10). There are two types of the p53 gene, wild-type and mutant. Wild-type p53, which has anticancer effects, can cause apoptosis to eliminate tumor cells (11). The common mutation site of mutant p53 is position 143 (from A to G) and mutant p53 can cause tumorigenesis (12). The function of the WWOX gene in osteosarcoma has not been well studied and comparison studies of the wild-type and mutant p53 genes are also rare. In the present study, we examined the effects of stable expression of the WWOX and p53 genes in transfected cell lines. The effects of the WWOX and p53 (wild-type) genes on the proliferation and cell cycle of osteosarcoma cells were assessed by MTT assay and flow cytometry to investigate the relationship between osteosarcoma and the expression of the WWOX and p53 (wild-type) genes. Additionally, the expression of the mutant p53 gene in osteosarcoma tissue was detected by immunohistochemistry to investigate the relationship between the mutant p53 gene and the degree of malignancy of osteosarcoma.

Materials and methods

Reagents

The human osteosarcoma cell line, MG-63, was purchased from the Institute of Basic Medical Sciences of the Chinese Academy of Medical Sciences (Beijing, China); plasmids were constructed at the early stage of this project by the team members; Lipofectamine® 2000 was from Invitrogen; Thermo Fisher Scientific, Inc. (Waltham, MA, USA); MTT and RIPA lysis buffer both from Beijing PPLYGEN Technology Co., Ltd. (cat. no. C1053; Beijing, China); TRIzol kit was from Invitrogen; Thermo Fisher Scientific, Inc. (cat. no. 15596026); TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix kit both from TransGen Biotech Co., Ltd. (cat. no. AT311-02; Beijing, China); FastStart Universal SYBR-Green Master (Rox) kit was from Roche Diagnostics (cat. no 04913914001; Indianapolis, IN, USA); BCA kit was from Thermo Labsystems (cat. no 23225; Santa Rosa, CA, USA); Cell cycle assay kit for flow cytometry was from Baomanbio Co., Ltd. (cat. no. GMS10021.1; Shanghai, China). Mouse monoclonal wild-type p53 antibody (dilution, 1:500; cat. no. 178924), mouse monoclonal mutant p53 antibody (dilution, 1:500; cat. no. 178379) and HRP-labeled goat anti-mouse secondary antibody (dilution, 1:2,000; cat. no. 197302) were from Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd. (Beijing, China).

Construction of WWOX and p53-overexpressing MG-63 cell lines through transfection

The recombinant eukaryotic overexpression plasmids of WWOX and p53 were, respectively transfected into MG-63 osteosarcoma cells by liposome transfection to establish cell lines that stably expressed WWOX and p53. These cell lines were named the MW and MP cell line, respectively.

Cell culture

MG-63 cells were cultured in MEM medium supplemented with 10% fetal bovine serum (FBS). G418 was added to DMEM medium containing 10% FBS to a final concentration of 1,000 µg/ml for culture of transfected MW and MP cells. The cells were cultured at 37°C with 5% CO2. When cells were 80–90% confluent, they were subcultured according to the required dilution ratio.

Quantitative polymerase chain reaction (qPCR)

MW, MP and MG-63 cells under healthy growth conditions were collected at the logarithm growth period. Total cellular RNA was extracted using TRIzol reagent and RNA was reverse transcribed into cDNA according to the instructions of the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix kit. The primer sequences of WWOX, p53 (wild-type) and the endogenousv GAPDH gene were designed with reference to a large number of studies (Table I). All primers were synthesized by a third party. qPCR was carried out using the FastStart Universal SYBR-Green PCR Master (Rox) kit and the relative expression of each gene was calculated using the 2−ΔΔCq method.
Table I.

Primer sequences.

GenesForward (5′-3′)Reverse (5′-3′)
WWOXTCCTCAGAGTCCCATCGATTTCGGCAGCAGTTGTTGAAGTA
p53TACTCCCCTGCCCTCAACAAGCGCTATCTGAGCAGCGCTCAT
GAPDHCATGCCATCACTGCCACCCATTGACAAAGTGGTCGTTGAG

Western blot analysis

MW, MP and MG-63 cells under healthy growth conditions were collected at the logarithm growth period. Cells were lysed with lysis buffer and total protein was extracted. Total protein concentration was determined using a BCA kit. Protein samples were subjected to (SDS-PAGE), after which protein was transferred to PVDF membranes using a semi-dry method. The membranes were blocked with 5% skimmed milk, followed by incubation with primary mouse monoclonal wild-type p53 antibody (dilution, 1:500; cat. no. 178924) overnight at 4°C, after washing. Membranes were then incubated with HRP-labeled goat anti-mouse secondary antibody (dilution, 1:2,000; cat. no. 197302) for 1 h at room temperature. After washing, a gel imaging system was used to detect protein signals. β-actin was used as the endogenous control and ImageJ software was used to quantify protein expression.

MTT assay

MW, MP and MG-63 cells under healthy growth conditions were collected at the logarithm growth period and digested with trypsin to prepare cell suspensions. Cells in suspension were seeded in 96-well plates and MTT reagent was added 1–6 days later. After adding the MTT reagent, cells were cultured at 37°C with 5% CO2 for an additional 4 h, followed by the addition of DMSO to stop the reaction. The 96-well plates were placed in a microplate reader and the absorbance value of each well was measured at 490 nm to calculate the survival rate and construct the growth curve.

Flow cytometry

MW, MP and MG-63 cells were digested with trypsin, followed by centrifugation to remove the medium and obtain cell pellets. The cell cycle assay kit for flow cytometry and the flow cytometer were used for the cell cycle analysis.

Immunohistochemistry

The expression of mutant p53 in osteosarcoma was detected by immunohistochemistry. A total of 65 paraffin-embedded osteosarcoma tissue samples were selected in Jingmen No. 2 People's hospital. The samples were diagnosed by pathological diagnosis and were classified into different differentiation levels: High, 17 cases; moderate, 25 cases; and low differentiation, 23 cases. Paraffin-embedded osteosarcoma tissue samples were sectioned at a thickness of 5 µm. Immunohistochemical staining was performed using the SP method (13) to detect the expression of mutant p53 protein in osteosarcoma tissues with different pathological grades. PBS was used as the negative control of the primary antibody. A double-blind method was used to observe the signals. Five high-power microscopic fields were randomly selected for observation. Brown particles within the nucleus represented positive signals. Specific criteria for the determination of mutant p53 expression are shown in Table II.
Table II.

Criteria for the determination of mutant p53 expression.

The proportion of positive cells (%)Classification
<5
5–25+
26–50++
>50+++

Statistical analysis

Data are presented as percentage and one-way ANOVA was performed using SPSS 13.0 statistical software (SPSS, Inc., Chicago, IL, USA) for comparisons between groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of WWOX and p53 (wild-type) mRNA in the three groups of cells

qPCR analysis showed that the expression of WWOX mRNA was increased in MW cells compared with the blank control group and the expression of p53 (wild-type) mRNA was increased in MP cells compared with the blank control group (Fig. 1).
Figure 1.

The expression of WWOX and wild-type p53 mRNA. qPCR analysis showed that the expression of (A) WWOX mRNA was increased in MW cells compared with the blank control group and the expression of (B) wild-type p53 mRNA was increased in MP cells compared with the blank control group. *Compared with the control group, P<0.05.

Expression of WWOX and p53 (wild-type) protein in the three groups of cells

Western blot analysis showed that the expression of WWOX and p53 (wild-type) protein in the transfected cells was higher than those in the control group and the increased protein expression was consistent with the increased mRNA expression (Fig. 2).
Figure 2.

(A and B) Expression of WWOX and wild-type p53 protein in MW and MP cells, respectively. (C) Western blot analysis showed that the expression of WWOX protein in the MW cell line was significantly higher than in the control group and the expression of wild-type p53 protein in the MP cell line was significantly higher than in the control group. Representative western blot analysis. Comparison of the relative protein levels between the control group and experimental groups. Compared with the control group, *P<0.05.

The effect of WWOX and p53 (wild-type) on the proliferation of MG-63 cells as determined by MTT assay

The cell survival rates of MW and MP cells at 1–6 days after the beginning of incubation are shown in Table III and the growth curve is shown in Fig. 3. The survival rates of MW and MP cells were significantly lower than those of the blank control group at each time point (P<0.05). As shown in Table III and Fig. 3, the two genes showed significant inhibitory effects on MG-63 osteosarcoma cells at 3 days after the beginning of incubation.
Table III.

Survival rates of MW and MP cells (%).

Days of incubation123456
Blank control group100100100100100100
MW92[a]82[a]54[a]63[a]74[a]81[a]
MP90[a]84[a]59[a]69[a]72[a]74[a]

Compared with the blank control at each time point, P<0.05.

Figure 3.

Growth curves of MW and MP cells. The results of MTT assay showed that the WWOX gene inhibited the proliferation of MG-63 osteosarcoma cells; (A) the wild-type p53 gene inhibited the proliferation of MG-63 osteosarcoma cells; (B) after 3 days of incubation, significant inhibitory effects of these genes on MG-63 osteosarcoma cells was observed. Compared with the blank control at each time point, P<0.05.

Changes of the cell cycle after WWOX and p53 (wild-type) gene transfection

Flow cytometric analysis showed that MW and MP cells were blocked in the G0/G1 phase, suggesting that overexpression of the WWOX and p53 (wild-type) genes causes cell cycle arrest of MG-63 osteosarcoma cells at the G0/G1 phase (Table IV).
Table IV.

The cell cycle of MW and MP cells (mean ± standard deviation).

GroupsG0/G1 (%)S (%)G2/M (%)
Control24.07±1.23545.49±0.98725.45±0.912
MW78.49±2.39212.01±1.209  8.30±0.462
MP66.76±0.23519.96±0.68911.34±0.764

Immunohistochemical analysis of the expression of mutant p53 in osteosarcoma tissue

The mutant p53 protein is located in the nucleus and the brown particles observed after immunohistochemical staining represented positive signals. Microscopic observation showed that the positive expression rate of mutant p53 protein in 65 cases of osteosarcoma was 47.7% and the positive expression rate was related to pathological grade. According to the criteria for determination, the expression status of the mutant p53 protein in each pathological grade of osteosarcoma is summarized in Table V and the positive expression rates of the mutant p53 protein in each pathological grade are shown in Fig. 4. The highest positive expression rate of mutant p53 was found in low differentiation osteosarcoma tissue and the positive expression rate of mutant p53 protein decreased with increased degree of tumor malignancy.
Table V.

The expression status of p53 (mutant) protein in each pathological grade of osteosarcoma.

Pathological gradeCasePositive (cases)Negative (cases)Positive rate (%)
High differention17  51229.4
Moderate differention25101540.0
Low differention2316  769.6
Total positive expression rate47.7
Figure 4.

The positive expression rate of p53 according to osteosarcoma pathological grade.

Discussion

The diagnosis and treatment of osteosarcoma at the genetic level is an area of intense research. Studies have shown that tumor suppressor genes can inhibit tumorigenesis and tumor growth (14). Therefore, in the present study, we investigated the functions of two classic tumor suppressor genes, p53 and WWOX, at the molecular level to explore the correlation between the two genes and osteosarcoma. WWOX is a tumor suppressor gene with a length of approximately 1.1 Mb. Studies have shown that the WWOX gene plays an important role in preventing tumorigenesis and tumor growth. WWOX can function as a transcription factor to regulate tumor metastasis and growth by regulating the expression of various genes (15) and reduced expression of the WWOX gene can cause tumorigenesis and promote the growth of osteosarcoma (16). P53 is another well-known tumor suppressor gene. The main role of p53 is to induce apoptosis and affect the cell cycle (17). The p53 gene exists as two types - wild and mutant and the two types have different functions (18). Because of the short half-life, the p53 (wild-type) protein cannot be easily detected by immunohistochemistry (19,20). However, mutant p53 can be detected by immunohistochemistry because of a long half-life. In this study, p53 (wild-type) and mutant p53 were studied. The two transfected MG-63 osteosarcoma cell lines, which stably expressed the WWOX and p53 (wild-type) genes, were constructed and named the MW and MP cell lines, respectively. Measurement of the levels of mRNA and protein in the two groups showed that WWOX and p53 were stably expressed in the cell lines and the two groups of transfected cells were therefore suitable for use in subsequent experiments. Based on the successful establishment of the MW and MP cell lines, we simultaneously studied the effects of the WWOX and p53 (wild-type) genes on MG-63 osteosarcoma cells via in vitro experiments. The growth rates of MG-63 cells transfected with the WWOX or p53 (wild-type) gene overexpression plasmids were reduced and flow cytometric analysis showed that overexpression of the WWOX and p53 (wild-type) genes can arrest MG-63 cells in the G0/G1 phase of the cell cycle. These results indicate that the WWOX and p53 (wild-type) genes can inhibit the proliferation of osteosarcoma cells by affecting the cell cycle. Immunohistochemical analysis showed that the wild-type and mutant p53 genes have completely opposite functions. Mutant p53 was highly expressed in osteosarcoma and its expression was positively related to the pathological grade of osteosarcoma. In conclusion, detection of the expression of the WWOX and p53 genes has great clinical value in the diagnosis, prevention and treatment of osteosarcoma. The WWOX gene can effectively prevent the growth of osteosarcoma, which is beneficial for the diagnosis and treatment of the disease. The p53 gene exists as two different types, where the wild-type p53 gene has the same function as WWOX in osteosarcoma, and the mutant p53 gene has important clinical value in the determination of the degree of malignancy of osteosarcoma.
  20 in total

1.  WW domain-containing oxidoreductase: a candidate tumor suppressor.

Authors:  Nan-Shan Chang; Li-Jin Hsu; Yee-Shin Lin; Feng-Jie Lai; Hamm-Ming Sheu
Journal:  Trends Mol Med       Date:  2006-12-04       Impact factor: 11.951

Review 2.  Multiple roles of the tumor suppressor p53.

Authors:  Jill Bargonetti; James J Manfredi
Journal:  Curr Opin Oncol       Date:  2002-01       Impact factor: 3.645

Review 3.  DNA damage, p53, apoptosis and vascular disease.

Authors:  John Mercer; Melli Mahmoudi; Martin Bennett
Journal:  Mutat Res       Date:  2007-03-01       Impact factor: 2.433

4.  The polymorphisms and haplotypes of WWOX gene are associated with the risk of lung cancer in southern and eastern Chinese populations.

Authors:  Dongsheng Huang; Fuman Qiu; Lei Yang; Yinyan Li; Mei Cheng; Hui Wang; Guanpei Ma; Yunnan Wang; Min Hu; Weidong Ji; Yifeng Zhou; Jiachun Lu
Journal:  Mol Carcinog       Date:  2012-06-12       Impact factor: 4.784

5.  Evidences that the polymorphism Pro-282-Ala within the tumor suppressor gene WWOX is a new risk factor for differentiated thyroid carcinoma.

Authors:  Lisa Cancemi; Cristina Romei; Sara Bertocchi; Giulia Tarrini; Irene Spitaleri; Monica Cipollini; Debora Landi; Sonia Garritano; Giovanni Pellegrini; Alfonso Cristaudo; Aldo Pinchera; Roberto Barale; Rossella Elisei; Stefano Landi; Federica Gemignani
Journal:  Int J Cancer       Date:  2011-04-25       Impact factor: 7.396

6.  Association study of a functional copy number variation in the WWOX gene with risk of gliomas among Chinese people.

Authors:  Ke Yu; Jin Fan; Xin Ding; CongYang Li; Jun Wang; Yang Xiang; Qing Song Wang
Journal:  Int J Cancer       Date:  2014-04-21       Impact factor: 7.396

7.  Osteosarcoma incidence and survival rates from 1973 to 2004: data from the Surveillance, Epidemiology, and End Results Program.

Authors:  Lisa Mirabello; Rebecca J Troisi; Sharon A Savage
Journal:  Cancer       Date:  2009-04-01       Impact factor: 6.860

8.  ErbB2 inhibition by lapatinib promotes degradation of mutant p53 protein in cancer cells.

Authors:  Dun Li; Natalia D Marchenko
Journal:  Oncotarget       Date:  2017-01-24

9.  Tumor Suppressor WWOX inhibits osteosarcoma metastasis by modulating RUNX2 function.

Authors:  Sara Del Mare; Rami I Aqeilan
Journal:  Sci Rep       Date:  2015-08-10       Impact factor: 4.379

10.  Coexistence of HER2, Ki67, and p53 in Osteosarcoma: A Strong Prognostic Factor.

Authors:  Keykhosro Mardanpour; Mahtab Rahbar; Sourena Mardanpour
Journal:  N Am J Med Sci       Date:  2016-05
View more
  4 in total

1.  Circular RNAs hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 are predicted to promote CADM1 expression by functioning as miRNAs sponge in human osteosarcoma.

Authors:  Gaoyang Chen; Qingyu Wang; Qiwei Yang; Zhaoyan Li; Zhenwu Du; Ming Ren; Haiyue Zhao; Yang Song; Guizhen Zhang
Journal:  PLoS One       Date:  2018-08-28       Impact factor: 3.240

2.  Immunoexpression of Ki67, p53 and cyclin D1 in osteosarcomas.

Authors:  Ştefan Adrian Niculescu; Dan Cristian Grecu; Cristiana Eugenia Simionescu; Elena Carmen Niculescu; Mioara Desdemona Stepan; Alex Emilian Stepan
Journal:  Rom J Morphol Embryol       Date:  2021 Jul-Sep       Impact factor: 0.833

Review 3.  Modeling WWOX Loss of Function in vivo: What Have We Learned?

Authors:  Mayur Tanna; Rami I Aqeilan
Journal:  Front Oncol       Date:  2018-10-10       Impact factor: 6.244

4.  Enhanced Internalization of Nanoparticles Following Ionizing Radiation Leads to Mitotic Catastrophe in MG-63 Human Osteosarcoma Cells.

Authors:  Roxana Cristina Popescu; Mihai Straticiuc; Cosmin Mustăciosu; Mihaela Temelie; Roxana Trușcă; Bogdan Ștefan Vasile; Adina Boldeiu; Dragoş Mirea; Radu Florin Andrei; Constantin Cenușă; Laurenţiu Mogoantă; George Dan Mogoșanu; Ecaterina Andronescu; Mihai Radu; Marlon R Veldwijk; Diana Iulia Savu
Journal:  Int J Mol Sci       Date:  2020-09-30       Impact factor: 5.923

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.