Literature DB >> 29067958

Magnetic Resonance Gd-RGD Imaging Study of Hepatocellular Carcinoma with High and Low Metastatic Potential before and after Human Bone Marrow-derived Mesenchymal Stem Cell Intervention.

Tian-Ran Li1, Ming-Hui Yu1, Xiao-Bin Huang2, Zhi-Jie Yang2, Guang-Ming Lu3, Yan-Jun Li3.   

Abstract

BACKGROUND: Biotherapy based on human bone marrow-derived mesenchymal stem cells (BMSCs) is currently the focus of research, especially in the field of autologous stem cell transplantation. A novel type of metastasis-associated magnetic resonance (MR) molecular imaging probe was constructed, and the changes in metastasis and proliferation of hepatocellular carcinoma (HCC) before and after BMSC intervention were observed through MR imaging (MRI).
METHODS: Metastasis-associated MR molecular imaging probe, integrin αvβ3ligand cRGD-PEG-DGL-DTPA-Gd (Gd-RGD), were constructed. After human BMSC intervention was performed for 6 weeks, tumor weight inhibition rates were calculated, and the RGD molecular probe was imaged through MRI with molecular imaging agent Gd-DTPA as control. The signal-to-noise ratio (SNR) and contrast-to-noise ratio (CNR) in the MRI experiment were used as semi-quantitative indicators. Polymerase chain reaction method was performed to detect proliferation- and metastasis-associated indicators, transforming growth factor β-1 (TGFβ1), osteopontin (OPN), and integrin subunit αvand β3.
RESULTS: The highest tumor weight inhibition rates were observed 3 weeks after the BMSC transplantation. The MR Gd-RGD in the HCC tissues after the BMSC intervention showed less enhancement than Gd-DTPA. The Gd-DTPA MRI of control group had higher SNR and CNR than Gd-RGD MRI in the experimental groups (P < 0.05). For high metastatic potential hepatocellular carcinoma (MHCC97-H), significant differences were observed in the SNRs and CNRs of Gd-RGD MRI before and after the BMSC intervention (P < 0.05). For low metastatic potential hepatocellular carcinoma (MHCC97-L), the CNRs of Gd-RGD MRI were statistically different before and after BMSC intervention (P < 0.05). With regard to MHCC97-H, OPN, β3, and TGFβ1 expression significantly decreased after BMSC intervention (P < 0.05). In MHCC97-L and OPN, β3, TGFβ1, and αv expression after BMSC intervention decreased, and the difference was statistically significant (P < 0.05).
CONCLUSIONS: The CNR index of MRI is a good indicator for distinguishing high- and low-metastatic potential HCC tissues. After BMSC transplantation of MRI through the two kinds of tracer, the SNR and CNR indexes can distinguish two kinds of high and low metastatic potential HCC tissues, and Gd-RGD imaging is more suitable in distinguishing the metastatic potential changes through BMSC intervention.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 29067958      PMCID: PMC5678260          DOI: 10.4103/0366-6999.217089

Source DB:  PubMed          Journal:  Chin Med J (Engl)        ISSN: 0366-6999            Impact factor:   2.628


INTRODUCTION

Biotherapy based on human bone marrow-derived mesenchymal stem cells (BMSCs) is currently the focus of research, especially in the field of autologous stem cell transplantation, which has potential applications in the treatment of multiple diseases, including hepatocellular carcinoma (HCC).[12] However, the possible long-term effects of using stem cells on tumors and the safety of this approach require further research. Our research group has focused on studying primary HCC including BMSCs on liver cancer before and after intervention of liver cancer tissue proliferation and metastatic behavioral changes.[34] The new HCC cell lines with high and low metastatic potential were constructed by the Liver Cancer Research Institute of Fudan University.[5] This cell line is the best model in studying the metastatic behavior of HCC.[6] In the paper, we adopted the HCC with high and low metastatic potential as the study object. In addition, the effectiveness of BMSC transplantation for tumor intervention can be observed in real time because of the progress in modern molecular imaging.[78] Molecular imaging probes, owing to their molecular structures, can bind to specific targets within living cells and thus facilitate the detection of the structures and properties of the targets and generation of signals that can be monitored in real time in situ and in vivo.[9] However, real-time monitoring of biological behaviors of the tumor in vivo, such as tumor proliferation and metastatic behaviors, before and after BMSC intervention, remains difficult. Integrin, an allotropic cell adhesion molecule, mediates the interaction between a cell and extracellular matrix (ECM), thereby facilitating tumor metastasis. Among known integrins, integrin αvβ3 is the most important because it is abundant in superficial cells and neovascular endothelial cells of multiple tumors and participates in tumor angiogenesis.[1011] An integrin αvβ3 receptor exerts its effect by specifically binding to the recognition sequence, arginine-glycine-aspartic acid (Arg-Gly-Asp, RGD), together with ECM protein.[12] This research aims to establish a novel type of metastasis-associated magnetic resonance (MR) molecular imaging probe, Gd-RGD, and observe the changes in HCC metastasis and proliferation behaviors before and after BMSC intervention through MR imaging (MRI).

METHODS

Ethical approval

The animal study was approved by the Institutional Animal Care and Use Committee of the Chinese PLA General Hospital, China. Animal disposition during the experimental process conformed to the standard of medical ethics.

Establishment of molecular imaging probe and analysis of cRGD-PEG-DGL-DTPA-Gd

The established method of preparing an MRI molecular probe of RGD ligand for metastasis-associated factor integrin αvβ3 is as follows:first, DGL-PEG was synthesized. DGL (123 amino groups on surface, molecular weight 22,000 Da, 3 passages, COLCOM, France) was dissolved in methanol to form a working solution, which was then placed under sealed preservation at 4°C and the NHS group on PEG was specifically reacted with the primary amine on the DGL surface, generating DGL-PEG. Second, DGL-PEG-cRGD was synthesized. The N-terminal of cRGD peptide was connected to a cysteine to form a polypeptide containing free sulfhydryl groups. cRGD and DGL-PEG peptides were mixed to obtain a cRGD:DGL-PEG molar ratio of 10:1. The resulting solution was stirred under room temperature for 24 h to produce DGL-PEG-cRGD. Third, cRGD-PEG-DGL-DTPA was synthesized. DGL-PEG-cRGD and p-SCN-Bn-DTPA at 1:90 ratio were weighed and combined under room temperature in 50 ml of PBS with pH of 9.0 for 48 h. The molecular weight cutoff was 5000 Da for 24 h and dried to obtain a white solid powder. Finally, cRGD-PEG-DGL-DTPA-Gd was synthesized. The DGL-DTPA was re-dissolved in 2 ml 0.1 mol/L sodium acetate buffer pH 6.0, and excess gadolinium chloride hexahydrate was added. The reaction mixture was subjected to a temperature of 4°C for 24 h to obtain DGL-DTPA-Gd, and the product was freeze-dried and collected in pure water after purification by an ultrafiltration device. The freeze-dried powder samples of the fresh compounds prepared above were dissolved in 0.5 ml of DMSO for nuclear magnetic resonance (NMR) analysis under a field strength of 600 MHz. The product samples were also dissolved in pure water after NMR analysis to determine GD content and calculate ligation efficiency through inductively coupled plasma-atomic emission spectrometry.

Calculation method of dosage of molecular probe

Experimental group In the configuration method marked with 33.5 mg, 23.5 mg of drug and 15 ml of normal saline were used, while in that marked with 32.3 mg, 26.3 mg drug and 15 ml of normal saline were used. Both groups were separately packaged for subsequent use. Control group Magnevist solution (Gd-DTPA) was clinically used at 20 ml from the dilution of 9.38 g for 1000 times. Only 40 ml of aliquot was collected after dilution and separately packaged for standby use. Final use concentration of animal models Gd-DTPA and Gd-RGD concentrations were 1/10 and 1/1000 of the clinical concentration, respectively, while all contrast agent dosages were 0.4 ml. Scanning was implemented after 30 min delay.

Gd-RGD magnetic resonance imaging parameters and magnetic resonance imaging analysis method

MR GE Discovery HD750 (3.0 T), MR 3.0 T phased array radio frequency coils in mice from Shanghai ChenGuang Medical Technology Co., Ltd.; coil model: CG—MUC40-H300-AG (Bore Diameter: 5 cm). Scanning sequence was as follows: T2WI, T1WI, and T1WI + CE. Inspection equipment and scanning parameters were as follows: GE HD750 MR, Coil: HD 8Ch High Res Brain Array by in vivo, FOV 6.0 cm, slice thickness 3.0, slice spacing 0.5, NEX 1, pulse sequence: gradient echo, BEAVO, FSE-XL, SPGR, TR = 4600 ms, TE = 108.7 ms, layer thickness = 3.0, interlayer spacing = 1.0, matrix = 448 × 256, and FOV = 18 cm × l3.5 cm. SNR and contrast-to-noise ratio (CNR) were used as semi-quantitative indexes. SNR = SI tissue/standard deviation (SD) background CNR = (SI lesion − SI tissue)/SD background. Where SI tissue was a mean value of signal strength in one region of the liver tissue, and SD background was the SD of the blank background signal. Region of interests (ROIs) were drawn on the tumor, liver, and background region, and all ROI sizes had similar value in the triplicate measurements.

Preparation of hepatocellular carcinoma animal models

A total of 60 6-week-old healthy Balb/c SPF-level nude mice (30 males and 30 females) with weights ranging from 14 g to 17 g were provided by the Experimental Animal Center in China Biological Products Assay Institute. The experimental animal quality certification number was SCXK (J) 2009-0017, while the animal quality certification number was 0205939. The weight of each mouse was about 20 g during purchase. Drinking water was sterilized Grade-2 ultrapure water, and the quality of drinking water conformed to the PRC national standard, Sanitary Standard for Domestic Drinking Water (GB5749-2006). The usage license number of the experimental animal room was SYXK (Z) 2015-0008, and the feeding environment was as follows: nude mice were fed in an isolation cage supplemented by clean laminar-flowing cabinet in an animal feeding room with IVC-II (intelligent type) independent air supply. The temperature range was 20–25°C, and the range of relative humidity was 40–70%. The mice ate sterilized nude mice fodder at SPF level, which were products from the experimental animal research institution in CAMS. Human high and low metastatic potential HCCs (MHCC97-H and MHCC97-L) tumorous nodes, which were cultured in vivo through subcutaneous vaccination in mice bodies with favorable growth, were prepared into oncocyte patches through sterile operation and inoculated in the subcutaneous armpits of the mice with puncture needles. The nude mice were randomly divided into two groups with thirty in each group. One group was inoculated with MHCC97-H cells, while the other with MHCC97-L cells. The animals were weighted and labeled. Each group was randomly subdivided into the control group and experimental group again with 15 nude mice in each subgroup [Figure 1].
Figure 1

Animal model experimental grouping.

Animal model experimental grouping.

Bone marrow-derived mesenchymal stem cell intervention method

Tail intravenous injection of BMSCs (5 × 105/each mouse) was introduced 15 days after tumor inoculation in the experimental group. Tail intravenous injection of BMSC culture fluid was introduced to the mice in the control group (0.2 ml/each mouse). During the experiment, subcutaneous tumor volume was measured with a caliper each week, and three mice in each group were executed after 14, 21, 28, 35, and 42 days [Figure 2]. Tumor blocks were completely dissected out from the dead mice in each group. The weights of the tumor and mouse were measured, and the tumor weight inhibition rates were calculated. The detection indexes of tumor change before and after BMSC intervention of HCC tissues were calculated as follows:
Figure 2

BMSC intervene experimental grouping. BMSC: Bone marrow-derived mesenchymal stem cell.

BMSC intervene experimental grouping. BMSC: Bone marrow-derived mesenchymal stem cell. Tumor weight inhibition rate (%) = By week 6, only three animal models were left in each group. These animal models were used in MRI experiments before sacrificing.

Magnetic resonance imaging experiment grouping

Combining BMSC intervention experiment, we used stratified cross grouping. Molecular probe group: clinically used Gd-DTPA was the control group, while Gd-RGD served as the experimental group. Tumor model groups: blank tumor model was the control group and BMSCs were the experimental group. Each group of three tumor-bearing animal models was subjected to MRI. Every animal model used two probes at 12 h intervals for the MRI experiment.

Polymerase chain reaction detection

Primer sequence design: primer sequences of transforming growth factor β-1 (TGFβ1), osteopontin (OPN), and integrin subunits αv and β3 were provided from the GenBank database and synthesized by Cyagen (Guangzhou) Biotechnology Company [Table 1].
Table 1

List of primer sequences used for RT-PCR amplification of OPN, αv, β3, and TGFβ1

Primer namePrimer sequenceProduct fragment length (bp)
OPNUpstream: 5’ GCAGAAGGAGATCACAGCCCT 3’Downstream: 5’ GCTGATCCACATCTGCTGGAA 3’331
αvUpstream: 5’ CCTCAGACGCTGCGTGGAGC 3’Downstream: 5’ AGGGCTGAGCTTCGGAGCGA 3’314
β3Upstream: 5’-GTGCT-GACGCTAACTGACC-3’Downstream: 5’-CATGGTAGTGGAGGCAGAGT-3’285
TGFβ1Upstream: 5’ AGTGGTTGAGCCGTGGAG 3’Downstream: 5’ TGCAGTGTGTTATCCCTGCT 3’155

RT-PCR: Reverse transcription-polymerase chain reaction; OPN: Osteopontin; TGFβ1: Transforming growth factor β-1.

List of primer sequences used for RT-PCR amplification of OPN, αv, β3, and TGFβ1 RT-PCR: Reverse transcription-polymerase chain reaction; OPN: Osteopontin; TGFβ1: Transforming growth factor β-1. Experimental method After the MHCC97-H cells adhered to the walls in the lower chamber, BMSCs were inoculated (3 × 104 cell counts per pore) in the upper chamber of the 12-pore plate. After co-culturing for 48 h, the cells in the lower chamber were sent for polymerase chain reaction (PCR) detection. The following methods were then performed: RNA extraction and application, RevertAid™ M-MLV RT reaction system and Oligo (dT) synthesis of cDNA, and amplification of the corresponding cDNA through PCR. The PCR conditions were as follows: premodification under 95°C for 5 min, 30 cycles that consisted of modification under 94°C for 30 s, annealing under 58°C for 30 s, and extension under 72°C for 30 s, and a final condition of 72°C for 10 min. PCR products were separated under electrophoresis and scanned through gel electrophoresis processing system for semi-quantitative analysis.

Statistical analysis

Experimental data were expressed as mean ± standard deviation (SD), and mean analysis in GraphPad Prism statistical software (GraphPad Software, San Diego, CA, USA) was used in the statistical test. The homogeneity of variance of the data was initially implemented when the variance was homogeneous. One-way variance analysis (ANOVA) was used to compare populations, and the comparison between two means in multiple dosage groups and one control group was used for statistics. Rank-sum test was used for the statistics of nonnormal data or data with heterogeneity of variance, and α = 0.05 was used as test criterion.

RESULTS

Gd-RGD magnetic resonance imaging result analysis of high metastatic potential hepatocellular carcinoma tumor before and after bone marrow-derived mesenchymal stem cell intervention

Gd-RGD and Gd-DTPA were used for the experimental and control groups, respectively. T1-weight image (TIWI) imaging sequences were used for MRI enhancement. TIWI MRI scanning was initially implemented before conducting CE-TIWI imaging [Figures 3 and 4], and SNR and CNR were calculated as semi-quantitative indexes [Figures 5 and 6].
Figure 3

MRI of MHCC97-H tumor-bearing nude mice. (a) MRI scanning TI-weighted image. MHCC97-H tumor tissues were located at the mouse armpits. (b) Gd-DTPA-enhanced image. Enhanced pattern of the tumor tissue similar to that of the liver tissue. (c) Gd-RGD-enhanced image. Enhanced pattern of the tumor tissue is lower than that of the liver tissue. MRI: Magnetic resonance imaging; MHCC97-H: High-metastatic-potential hepatocellular carcinoma.

Figure 4

MRI of MHCC97-H tumor-bearing nude mice under BMSC intervention. (a) MRI scanning TI-weight image. MHCC97-H tumor tissues were located at the mouse armpits. (b) Gd-DTPA-enhanced image. Enhanced pattern of the tumor tissue is similar to that of liver tissue. (c) Gd-RGD-enhanced image. Enhanced pattern of the tumor tissue is lower than that of liver tissue. MRI: Magnetic resonance imaging; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; BMSC: Bone marrow-derived mesenchymal stem cell.

Figure 5

Comparative histograms of SNR and CNR in imaging through two tracers in MHCC97-H model. (a) SNR histogram. (b) CNR histogram. *P < 0.05. SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; MHCC97-H: High-metastatic-potential hepatocellular carcinoma.

Figure 6

Comparative histograms of SNR and CNR in imaging through two tracers in MHCC97-H model under BMSC intervention. (a) SNR histogram. (b) CNR histogram. *P < 0.05. SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; BMSC: Bone marrow-derived mesenchymal stem cell.

MRI of MHCC97-H tumor-bearing nude mice. (a) MRI scanning TI-weighted image. MHCC97-H tumor tissues were located at the mouse armpits. (b) Gd-DTPA-enhanced image. Enhanced pattern of the tumor tissue similar to that of the liver tissue. (c) Gd-RGD-enhanced image. Enhanced pattern of the tumor tissue is lower than that of the liver tissue. MRI: Magnetic resonance imaging; MHCC97-H: High-metastatic-potential hepatocellular carcinoma. MRI of MHCC97-H tumor-bearing nude mice under BMSC intervention. (a) MRI scanning TI-weight image. MHCC97-H tumor tissues were located at the mouse armpits. (b) Gd-DTPA-enhanced image. Enhanced pattern of the tumor tissue is similar to that of liver tissue. (c) Gd-RGD-enhanced image. Enhanced pattern of the tumor tissue is lower than that of liver tissue. MRI: Magnetic resonance imaging; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; BMSC: Bone marrow-derived mesenchymal stem cell. Comparative histograms of SNR and CNR in imaging through two tracers in MHCC97-H model. (a) SNR histogram. (b) CNR histogram. *P < 0.05. SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; MHCC97-H: High-metastatic-potential hepatocellular carcinoma. Comparative histograms of SNR and CNR in imaging through two tracers in MHCC97-H model under BMSC intervention. (a) SNR histogram. (b) CNR histogram. *P < 0.05. SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; BMSC: Bone marrow-derived mesenchymal stem cell. Tumor tissues were subjected to Gd-DTPA or Gd-RGD imaging. The Gd-RGD in HCC tissues before and after BMSC intervention was less enhanced than Gd-DTPA. Similarly, Gd-RGD in liver tissues was also less enhanced than Gd-DTPA in the absence of BMSC intervention. SNR and CNR were calculated as quantitative indexes, and the results indicated that both SNR and CNR under Gd-DTPA imaging in the control group before and after BMSC intervention were higher than those under Gd-RGD imaging in the experimental group (P < 0.05).

Gd-RGD magnetic resonance imaging result analysis of low metastatic potential hepatocellular carcinoma tumor model before and after bone marrow-derived mesenchymal stem cell intervention

Gd-RGD and Gd-DTPA were used for the experimental group and the control group, respectively. MHCC97-L cells were inoculated at nude mouse armpits, and TIWI imaging sequences were used for MRI enhancement. TIWI MR scanning was initially implemented before conducting CE-TIWI imaging [Figures 7 and 8], and SNR and CNR were calculated [Figures 9 and 10].
Figure 7

MRI of MHCC97-L tumor-bearing nude mice. (a) MRI scanning TI-weight image. MHCC97-H tumor tissues were located at the mouse armpits. (b) Gd-DTPA-enhanced image. Enhanced pattern of the tumor tissue is similar to that of liver tissue. (c) Gd-RGD-enhanced image. Enhanced pattern of the tumor tissue is lower than that of liver tissue. MRI: Magnetic resonance imaging; MHCC97-L: Low-metastatic-potential hepatocellular carcinoma; MHCC97-H: High-metastatic-potential hepatocellular carcinoma.

Figure 8

MRI of MHCC97-L tumor-bearing nude mice after BMSC intervention. (a) MRI scanning TI-weighted image. MHCC97-H tumor tissues were located at the mouse armpits. (b) Gd-DTPA-enhanced image. Enhanced pattern of tumor tissue is similar to that of liver tissue. (c) Gd-RGD-enhanced image. Enhanced pattern of tumor tissue enhanced pattern is lower than that of liver tissue. MRI: Magnetic resonance imaging; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; BMSC: Bone marrow-derived mesenchymal stem cell.

Figure 9

Comparative histograms of SNR and CNR in imaging through two tracers in MHCC97-L HCC model. (a) SNR histogram. (b) CNR histogram. *P < 0.05. SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; MHCC97-L: Low-metastatic-potential hepatocellular carcinoma; HCC: Hepatocellular carcinoma.

Figure 10

Comparative histograms of SNR and CNR in imaging through two tracers in MHCC97-L HCC model under BMSC intervention. (a) SNR histogram. (b) CNR histogram. *P < 0.05. SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; MHCC97-L: Low-metastatic-potential hepatocellular carcinoma; HCC: Hepatocellular carcinoma; BMSC: Bone marrow-derived mesenchymal stem cell.

MRI of MHCC97-L tumor-bearing nude mice. (a) MRI scanning TI-weight image. MHCC97-H tumor tissues were located at the mouse armpits. (b) Gd-DTPA-enhanced image. Enhanced pattern of the tumor tissue is similar to that of liver tissue. (c) Gd-RGD-enhanced image. Enhanced pattern of the tumor tissue is lower than that of liver tissue. MRI: Magnetic resonance imaging; MHCC97-L: Low-metastatic-potential hepatocellular carcinoma; MHCC97-H: High-metastatic-potential hepatocellular carcinoma. MRI of MHCC97-L tumor-bearing nude mice after BMSC intervention. (a) MRI scanning TI-weighted image. MHCC97-H tumor tissues were located at the mouse armpits. (b) Gd-DTPA-enhanced image. Enhanced pattern of tumor tissue is similar to that of liver tissue. (c) Gd-RGD-enhanced image. Enhanced pattern of tumor tissue enhanced pattern is lower than that of liver tissue. MRI: Magnetic resonance imaging; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; BMSC: Bone marrow-derived mesenchymal stem cell. Comparative histograms of SNR and CNR in imaging through two tracers in MHCC97-L HCC model. (a) SNR histogram. (b) CNR histogram. *P < 0.05. SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; MHCC97-L: Low-metastatic-potential hepatocellular carcinoma; HCC: Hepatocellular carcinoma. Comparative histograms of SNR and CNR in imaging through two tracers in MHCC97-L HCC model under BMSC intervention. (a) SNR histogram. (b) CNR histogram. *P < 0.05. SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; MHCC97-L: Low-metastatic-potential hepatocellular carcinoma; HCC: Hepatocellular carcinoma; BMSC: Bone marrow-derived mesenchymal stem cell. MHCC97-L tumor tissues were observed in the armpits of mice and placed under Gd-DTPA and Gd-RGD imaging. Gd-RGD was less enhanced than Gd-DTPA both before and after the BMSC intervention on HCC tissues. Similarly, the Gd-RGD in liver tissues was also less enhanced than Gd-DTPA. SNR and CNR were calculated as quantitative indexes, and the results showed that both SNR and CNR under Gd-DTPA imaging in the control group before and after BSMCs intervention were higher than those under Gd-RGD imaging in the experimental group (P < 0.05).

Comparative analysis of magnetic resonance imaging images before and after bone marrow-derived mesenchymal stem cell intervention of hepatocellular carcinoma tissues

SNR and CNR were adopted as semi-quantitative indexes to analyze the tumor imaging effects of the two tracers before and after BMSC intervention [Table 2].
Table 2

Comparison of SNR and CNR in Gd-RGD imaging before and after BMSC intervention of high- and low-metastatic-potential HCC tissues

ItemsMHCC97-HMHCC97-LtPBMSC + MHCC97-HBMSC + MHCC97-LtP
SNR
 Gd-RGD22.60 ± 2.8720.63 ± 7.641.157>0.057.85 ± 3.2421.59 ± 7.915.126<0.05
 Gd-DTPA30.71 ± 6.2139.81 ± 9.211.361<0.0528.91 ± 10.2445.40 ± 12.384.938<0.05
CNR
 Gd-RGD5.32 ± 2.1421.59 ± 3.245.491<0.050.40 ± 0.313.94 ± 1.894.322<0.05
 Gd-DTPA7.02 ± 2.1414.78 ± 5.974.307<0.0514.78 ± 5.9718.33 ± 9.412.491<0.05

SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; BMSC: Bone marrow-derived mesenchymal stem cell; RGD: Arginine-glycine-aspartic acid; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; MHCC97-L: Low-metastatic-potential hepatocellular carcinoma; HCC: Hepatocellular carcinoma.

Comparison of SNR and CNR in Gd-RGD imaging before and after BMSC intervention of high- and low-metastatic-potential HCC tissues SNR: Signal-to-noise ratio; CNR: Contrast-to-noise ratio; BMSC: Bone marrow-derived mesenchymal stem cell; RGD: Arginine-glycine-aspartic acid; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; MHCC97-L: Low-metastatic-potential hepatocellular carcinoma; HCC: Hepatocellular carcinoma. After BMSC intervention for 6 weeks, Gd-RGD and Gd-DTPA imaging were implemented. SNR analysis showed no statistical difference between the SNRs of MHCC97-H and MHCC97-L through Gd-RGD imaging (P > 0.05). By contrast, SNR difference between MHCC97-H and MHCC97-L groups after BMSC intervention showed statistical significance (P < 0.05). The SNR results of Gd-DTPA imaging were identical to those of Gd-RGD imaging. CNR analysis of Gd-RGD imaging showed that the MHCC97-L group had significantly higher CNR indexes than the MHCC97-H group (P < 0.05). The CNR results of BMSC + MHCC97-L andBMSC + MHCC97-H groups were also significantly different (P < 0.05) after BMSC intervention. CNR results of Gd-DTPA imaging were identical with those of Gd-RGD imaging. Comparison of both SNRs under Gd-RGD imaging before and after BMSC intervention of MHCC97-H showed statistical difference (P < 0.05), whereas comparison of SNR under Gd-DTPA imaging before and after BMSC intervention showed no statistical difference (P > 0.05) despite the statistical difference in CNR (P < 0.05). The SNR under Gd-RGD imaging of MHCC97-L before the BMSC intervention was not statistically different from that after the intervention (P > 0.05) despite the statistical difference in CNR (P < 0.05). Comparison of both SNR and CNR under Gd-DTPA imaging before and after BMSC intervention showed no statistical difference (P > 0.05).

Changes of tumor weights before and after bone marrow-derived mesenchymal stem cell intervention

Tumor weights of MHCC97-H and MHCC97-L were observed beginning from the 2nd week after BMSC intervention. After BMSC intervention, the weights of the tumor tissues decreased, indicating the inhibitory effect of BMSCs on the proliferation of tumor tissues. The tumor weight inhibition rates of MHCC97-H were 22.71%, 42.86%, 34.48%, 31.60%, and 29.17% on the 2nd, 3rd, 4th, 5th, and 6th weeks, respectively. Meanwhile, the tumor weight inhibition rates of MHCC97-L were 26.62%, 52.00%, 38.20%, 31.98%, and 30.23%, on the 2nd, 3rd, 4th, 5th, and 6th weeks, respectively. The tumor inhibition rate reached its maximum value during the 3rd week, and MHCC97-L tumor had a higher inhibition rate of MMSCs than that of MHCC97-H tumor.

Polymerase chain reaction results

Tables 3 and 4 compare the expression levels of metastasis-associated genes, OPN, αv, β3, and TGFβ1 before and after BMSC intervention.
Table 3

Comparison of OPN, αv, β3, and TGFβ1 gene expression before and after MHCC97-H cells were intervened by BMSCs (mean ± SD, ΔΔCt value)

ItemsMHCC97-H + BMSCsMHCC97-HtP
OPN17.62 ± 0.3418.69 ± 1.041.768<0.05
β322.09 ± 1.3724.11 ± 1.261.893<0.05
αv20.81 ± 0.2120.52 ± 0.270.691>0.05
TGFβ124.24 ± 0.6822.65 ± 0.732.197<0.05

OPN: Osteopontin; TGFβ1: Transforming growth factor β-1; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; BMSCs: Bone marrow-derived mesenchymal stem cells.

Table 4

Comparison of OPN, αv, β3, and TGFβ1 gene expression before and after MHCC97-L cells were intervened by BMSCs (mean ± SD, ΔΔCt value)

ItemsMHCC97-H + BMSCsMHCC97-HtP
OPN13.65 ± 0.7817.34 ± 1.212.568<0.05
β318.84 ± 1.4720.14 ± 0.561.982<0.05
αv14.56 ± 2.1319.15 ± 1.983.135<0.05
TGFβ118.63 ± 0.9515.21 ± 1.352.849<0.05

OPN: Osteopontin; TGFβ1: Transforming growth factor β-1; BMSCs: Bone marrow-derived mesenchymal stem cells; MHCC97-H: High-metastatic-potential hepatocellular carcinoma.

Comparison of OPN, αv, β3, and TGFβ1 gene expression before and after MHCC97-H cells were intervened by BMSCs (mean ± SD, ΔΔCt value) OPN: Osteopontin; TGFβ1: Transforming growth factor β-1; MHCC97-H: High-metastatic-potential hepatocellular carcinoma; BMSCs: Bone marrow-derived mesenchymal stem cells. Comparison of OPN, αv, β3, and TGFβ1 gene expression before and after MHCC97-L cells were intervened by BMSCs (mean ± SD, ΔΔCt value) OPN: Osteopontin; TGFβ1: Transforming growth factor β-1; BMSCs: Bone marrow-derived mesenchymal stem cells; MHCC97-H: High-metastatic-potential hepatocellular carcinoma. After the BMSC intervention, the expression levels of OPN, β3, and TGFβ1 obviously decreased in the MHCC97-H cells (P < 0.05), but αv expression did not significantly change (P > 0.05). Co-culturing of MHCC97-L with BMSC significantly decreased the expression levels of OPN, β3, TGFβ1, and αv (P<0.05). Thus, metastasis-associated gene expressions in MHCC97-H cells were higher than that in MHCC97-L before and after BMSC intervention.

DISCUSSION

Human bone marrow stem cells mainly include two major types, namely, hematopoietic and mesenchymal stem cells, and the relationship of BMSCs with tumor has become a focus of research. In 1999, Petersen et al.[13] verified that oval mouse hepatic cells and hepatocytes can be obtained through bone marrow cell differentiation. Sato et al.[14] divided human bone marrow cells into BMSCs, CD34 cells, and non-BMSC/CD34-cells, and found BMSCs as the main source of hepatocytes in the HCC necrotic region. After transplanting bone marrow cells into allyl ethanol, they also found that BMSCs are mainly involved in the cellular expression of hepatic-specific markers in the absence of cellular fusion, causing mouse liver injury. In vitro and in vivo experiments showed that BMSCs can be distinguished into hepatocytes or hepatocyte-like cells.[1516] The effects of BMSCs on tumor growth are divided into the tumor growth suppression, such as in lung carcinoma and HCC; tumor growth facilitation, such as in multiple myeloma and breast carcinoma; and no effect on tumor growth, such as in colorectal carcinoma. The BMSC passages adopted in the experiment were within 10 passages with favorable cell growth, and through identification of surface antigen and induced differentiation experiment, conforming to international standards on BMSCs.[17] HCC cell line with high and low metastatic potential is an independent intellectual property right in our country. The cell line was constructed by the Liver Cancer Research Institute of Fudan University. The metastatic behavior of HCC is a key factor that influences prognosis. Thus, observing the influence of BMSC on HCC tissues with high and low metastatic potentials by molecular imaging was the key content in this experimental research. Target imaging can be achieved through the establishment of a molecular probe as a key part in molecular imaging. Integrin, which is an allotropic cell adhesion molecule, mediates the interaction between cells and ECM, thereby facilitating tumor metastasis. Integrin is a dimer formed from α and β subunits, and the integrin receptor αvβ3 is highly abundant on the cell surfaces of multiple tumors and highly expressed in the neovascular endothelial cytomembranes of tumor tissues, despite its absence in mature vascular endothelial cells and most normal organ system receptors.[18] By identifying the specific binding of the RGD sequence together with the ECM protein receptor, the integrin receptor mediates the adhesion and migration of tumor cells. It also mediates tumor growth, local infiltration, and metastasis. Vascularization can be evaluated through the development of tumor integrin receptor, RGD.[19] In this study, MRI was carried out by establishing a novel type of molecular imaging probe, Gd-RGD. Given its noninvasive and nonradiation features, MRI has extremely high soft-tissue resolution and spatial resolution and has advantages in the molecular imaging aspect of hepatic diseases. The HCC tissue imaging features of HCCs with high and low metastatic potentials under BMSC intervention were observed. We focused on determining whether Gd-RGD can differentiate HCC tissues with high and low metastatic potentials and whether the tracer can display the changes in tumor metastatic behaviors of HCC tissues under BSMC intervention to provide a basis for carrying out in vivo real-time imaging of tumor biological behaviors. The MRI molecular probe in this research, cRGD-PEG-DGL, was constructed through a coupling reaction, and MRI requirements were met through substantial analysis of Gd+ required by MRI in the compound. MHCC97-H and MHCC97-L animal models were constructed and placed under BMSC intervention from the 2nd week to the 6th weeks. MR-RGD imaging was implemented, along with Gd-DTPA as a molecular imaging probe control. The imaging results of the two molecular probes showed that, for MHCC97-H and MHCC97-L, MR-RGD was less enhanced than MR-DTPA both before and after BMSC intervention. The reason might be that Gd-DTPA belonged to an extracellular space contrast agent, and it was associated with the richness of the tumor blood supply, whereas Gd-RGD belonged to the tumor-targeted contrast agent and was associated with integrin αVβ3 expression in tumor tissues. Moreover, blood supply in tumor tissues was greater than the expression of integrin receptor αVβ3 in the tumor tissues. Similarly, semi-quantitative analysis results showed that SNR and CNR of MR-RGD imaging were significantly lower than those of MR-DTPA, indicating that MR-RGD was less enhanced than MR-DTPA. MR-RGD imaging SNR indicators cannot distinguish between two high and low metastatic potentials in liver cancer with respect to their abilities to differentiate MHCC97-H from MHCC97-L. However, CNR can be used to distinguish MHCC97-H and MHCC97-L, and the CNR of the MHCC97-L tissues was obviously higher than that of MHCC97-H. Therefore, CNR can serve as an index of MR-RGD probe in distinguishing high and low transfer potential. Furthermore, the difference between the two semi-quantitative MR indexes might be associated with the removal of tissue background interference during CNR index calculation, which was superior to SNR calculation.[20] In the detection results of the metastasis-associated indexes such as OPN, αv, and β3, only β3 showed difference between HCCs with high metastatic potential and those with low metastatic potential, indicating that β3 in the two integrin subunits were the key factors contributing to the difference between the two kinds of HCCs under different metastatic potentials. OPN contained an RGD sequence, which specifically bound to the integrin receptor αVβ3 on the cell surface; these sequences facilitate the expression of membrane-type CD44v6 in hepatoma cell lines by binding to its receptor integrin αvβ3, and CD44v6 boosts HCC metastasis by binding hyaluronic acid.[2122] In contrast to the results before BMSC intervention, both SNR and CNR indexes after BMSC intervention can be used to differentiate HCC tissues with high metastatic potential from those with low metastatic potential. The level of difference in SNR and CNR indexes before and after BMSC intervention under Gd-RGD imaging was obviously higher than those under Gd-DTPA imaging, and the SNR and CNR of the MHCC97-L tissues were obviously higher than those of MHCC97-H tissues. Therefore, Gd-RGD imaging is suitable for differentiating between MHCC97-H and MHCC97-L after BMSC intervention. The expression of integrin αvβ3 in HCC cells after BMSC intervention changed, and PCR analysis of metastasis-associated indexes indicated that expressions of metastasis-associated indexes such as OPN, αv, and β3 in HCC cells after BMSC intervention slightly decreased in both MHCC97-H and MHCC97-L tissues. This difference allows Gd-RGD to distinguish MHCC97-H and MHCC97-L after BMSC intervention. Establishment of MRI through an RGD molecular probe was already studied and reported. Given that Gd+ is only detectable at the millimole level, a scholar[23] bound the RGD of an integrin αVβ3 target with superparamagnetic iron oxide (SPIO) nanoparticles to establish a new type of molecular imaging probe (RGD-SPIO). They found that T2*-weighted MRI can noninvasively identify tumor vessel distribution with different expression levels of integrin αVβ3. Another study[24] established a double-mode probe based on ferric oxide nanoparticles, such as RGD-CLIO-Cy5.5. This probe combined the advantages of MRI and fluorescence imaging (high resolution and high sensitivity, respectively). The targeted integrin αVβ3 molecular probe was developed and used in clinical research, potentially providing more experimental basis for the definite effect of integrin αVβ3 in angiogenic and tumorigenic development. The development may also provide theoretical foundations for the interaction between integrin αVβ3 expression, and other neovascularization-associated potential drug targets. This study is the foundational research before clinical application of stem cell technology, which can provide scientific basis for biological treatment based on BMSC transplantation. The clinical significance of this study is to be able to use multimodality molecular imaging techniques to observe the changes of biological behavior of tumor in body and real time and provide basis for clinical intervention. The experimental results of tumor tissue weight change in HCC tissues before and after BMSC intervention in this research indicated that tumor weight change rate of high metastatic potential HCC was higher than that of low metastatic potential HCC, certifying that high metastatic potential HCC tissues were more sensitive to BMSC intervention. Differences were observed among the expression levels of tumor proliferation-associated factor TGFβ1 before and after BMSC intervention of HCCs with high and low metastatic potential, and this result agreed with the changes in the weights of the HCCs after the intervention. In conclusion, the CNR indexes of the Gd-RGD tracers in MRI can be used for differentiating HCC tissues with high metastatic potential from those with low metastatic potential, and the SNR and CNR indexes of the Gd-RGD tracers in MRI after BMSC intervention are useful for distinguishing high- and low-metastatic-potential HCC tissues. Therefore, Gd-RGD imaging is suitable for differentiating the changes between high and low metastatic potentials in HCC tissues after BMSC intervention.

Financial support and sponsorship

This research was supported by grants from the National Natural Science Foundation (No. 81271607), and the National Postdoctoral Science Foundation of China (Grant No. 2015M572810).

Conflicts of interest

There are no conflicts of interest.
  23 in total

1.  Molecular imaging for assessment of mesenchymal stem cells mediated breast cancer therapy.

Authors:  Liang Leng; Yuebing Wang; Ningning He; Di Wang; Qianjie Zhao; Guowei Feng; Weijun Su; Yang Xu; Zhongchao Han; Deling Kong; Zhen Cheng; Rong Xiang; Zongjin Li
Journal:  Biomaterials       Date:  2014-03-29       Impact factor: 12.479

2.  Establishment of cell clones with different metastatic potential from the metastatic hepatocellular carcinoma cell line MHCC97.

Authors:  Y Li; Z Y Tang; S L Ye; Y K Liu; J Chen; Q Xue; J Chen; D M Gao; W H Bao
Journal:  World J Gastroenterol       Date:  2001-10       Impact factor: 5.742

3.  Human mesenchymal stem cells xenografted directly to rat liver are differentiated into human hepatocytes without fusion.

Authors:  Yasushi Sato; Hironobu Araki; Junji Kato; Kiminori Nakamura; Yutaka Kawano; Masayoshi Kobune; Tsutomu Sato; Koji Miyanishi; Tetsuji Takayama; Minoru Takahashi; Rishu Takimoto; Satoshi Iyama; Takuya Matsunaga; Seiji Ohtani; Akihiro Matsuura; Hirofumi Hamada; Yoshiro Niitsu
Journal:  Blood       Date:  2005-04-07       Impact factor: 22.113

4.  Mesenchymal stem cell in vitro labeling by hybrid fluorescent magnetic polymeric particles for application in cell tracking.

Authors:  Aungkura Supokawej; Natakarn Nimsanor; Tanwarat Sanvoranart; Chariya Kaewsaneha; Suradej Hongeng; Pramuan Tangboriboonrat; Kulachart Jangpatarapongsa
Journal:  Med Mol Morphol       Date:  2015-04-17       Impact factor: 2.309

5.  Osteopontin induces autophagy to promote chemo-resistance in human hepatocellular carcinoma cells.

Authors:  Guoke Liu; Xiaoyu Fan; Min Tang; Rui Chen; Hao Wang; Rongjie Jia; Xuyu Zhou; Wei Jing; Huajing Wang; Yang Yang; Fan Yin; Huafeng Wei; Bohua Li; Jian Zhao
Journal:  Cancer Lett       Date:  2016-10-01       Impact factor: 8.679

6.  Selective targeting of genetically engineered mesenchymal stem cells to tumor stroma microenvironments using tissue-specific suicide gene expression suppresses growth of hepatocellular carcinoma.

Authors:  Hanno Niess; Qi Bao; Claudius Conrad; Christoph Zischek; Mike Notohamiprodjo; Felix Schwab; Bettina Schwarz; Ralf Huss; Karl-Walter Jauch; Peter J Nelson; Christiane J Bruns
Journal:  Ann Surg       Date:  2011-11       Impact factor: 12.969

7.  Sequential exposure to cytokines reflecting embryogenesis: the key for in vitro differentiation of adult bone marrow stem cells into functional hepatocyte-like cells.

Authors:  Sarah Snykers; Tamara Vanhaecke; Peggy Papeleu; Aernout Luttun; Yuehua Jiang; Yvan Vander Heyden; Catherine Verfaillie; Vera Rogiers
Journal:  Toxicol Sci       Date:  2006-07-13       Impact factor: 4.849

8.  Hepatocyte-like cells from human mesenchymal stem cells engrafted in regenerating rat liver tracked with in vivo magnetic resonance imaging.

Authors:  Dongho Choi; Jung Hoon Kim; Misun Lim; Kang Won Song; Seung Sam Paik; Sook Ja Kim; Hee Jeong Cheong; Jin Seok Jeon; Hee Sook Park; Yun Seob Song; Hyunsoo Khang; Jong-Ho Won
Journal:  Tissue Eng Part C Methods       Date:  2008-03       Impact factor: 3.056

9.  Integrin αvβ3-targeted dynamic contrast-enhanced magnetic resonance imaging using a gadolinium-loaded polyethylene gycol-dendrimer-cyclic RGD conjugate to evaluate tumor angiogenesis and to assess early antiangiogenic treatment response in a mouse xenograft tumor model.

Authors:  Wei-Tsung Chen; Tiffany Ting Fang Shih; Ran-Chou Chen; Shin-Yang Tu; Wen-Yuen Hsieh; Pang-Chyr Yang
Journal:  Mol Imaging       Date:  2012 Jul-Aug       Impact factor: 4.488

10.  Effects of transforming growth factor β-1 infected human bone marrow mesenchymal stem cells on high- and low-metastatic potential hepatocellular carcinoma.

Authors:  Tianran Li; Shaohong Zhao; Bin Song; Zhengmao Wei; Guangming Lu; Jun Zhou; Tianlong Huo
Journal:  Eur J Med Res       Date:  2015-05-24       Impact factor: 2.175

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.