Literature DB >> 29062200

Cloning and sequence analysis of hyaluronoglucosaminidase (nagH) gene of Clostridium chauvoei.

Saroj K Dangi1, Pavan Kumar Yadav1, Aakanksha Tiwari1, Viswas Konasagara Nagaleekar1.   

Abstract

AIM: Blackleg disease is caused by Clostridium chauvoei in ruminants. Although virulence factors such as C. chauvoei toxin A, sialidase, and flagellin are well characterized, hyaluronidases of C. chauvoei are not characterized. The present study was aimed at cloning and sequence analysis of hyaluronoglucosaminidase (nagH) gene of C. chauvoei.
MATERIALS AND METHODS: C. chauvoei strain ATCC 10092 was grown in ATCC 2107 media and confirmed by polymerase chain reaction (PCR) using the primers specific for 16-23S rDNA spacer region. nagH gene of C. chauvoei was amplified and cloned into pRham-SUMO vector and transformed into Escherichia cloni 10G cells. The construct was then transformed into E. cloni cells. Colony PCR was carried out to screen the colonies followed by sequencing of nagH gene in the construct.
RESULTS: PCR amplification yielded nagH gene of 1143 bp product, which was cloned in prokaryotic expression system. Colony PCR, as well as sequencing of nagH gene, confirmed the presence of insert. Sequence was then subjected to BLAST analysis of NCBI, which confirmed that the sequence was indeed of nagH gene of C. chauvoei. Phylogenetic analysis of the sequence showed that it is closely related to Clostridium perfringens and Clostridium paraputrificum.
CONCLUSIONS: The gene for virulence factor nagH was cloned into a prokaryotic expression vector and confirmed by sequencing.

Entities:  

Keywords:  Clostridium chauvoei; black quarter; hyaluronoglucosaminidase

Year:  2017        PMID: 29062200      PMCID: PMC5639109          DOI: 10.14202/vetworld.2017.1104-1107

Source DB:  PubMed          Journal:  Vet World        ISSN: 0972-8988


Introduction

Black quarter or blackleg is a highly fatal and acute disease of mainly cattle and sheep, caused by Clostridium chauvoei, a Gram-positive, histotoxic, motile, and sporulating anaerobic bacteria. Cattle of 6-24 months age are commonly affected. C. chauvoei is one of the most pathogenic Clostridium species [1] causing tremendous economic losses to cattle herders [2]. There were 68 outbreaks, 547 attacks and 218 deaths in India, due to BQ from January 2016 to October 2016 alone in cattle, buffaloes, sheep, and goats [3]. Although it is presumed that C. chauvoei produces several toxins, molecular mechanism of pathogenicity, and the role of virulence factors in the pathogenesis of the disease is still unclear. C. chauvoei is presumed to produce five toxins, namely, alpha (oxygen-stable hemolysin), delta (oxygen-labile hemolysin), beta (DNase), gamma (hyaluronidase), and a neuraminidase [4,5]. Although virulence factors such as sialidase, flagellin, and C. chauvoei toxin A (cctA) are better characterized [1,5-7] other virulence factors, including hyaluronidase, remain to be characterized. Hyaluronidases are important virulence factors that help in spread of bacteria and toxins. Bacterial hyaluronidases of pathogenic Gram-positive bacteria can break down hyaluronate. Hyaluronidases enable the spread of the pathogens from the initial site of infection to the target organs [8]. The genome of C. chauvoei has been shown to harbor genes for two different hyaluronidases, hyaluronoglucosaminidase (nagH) and β-N-acetylglucosaminidase (nagJ) [1]. At present, little is known about hyaluronidases of C. chauvoei. As a prerequisite to characterization of its role in virulence, this in the present study, we amplified, cloned, and characterized the nagH gene.

Materials and Methods

Ethical approval

Since no animal experimentation involved in this work, ethical permission is not required.

Bacteria and vectors

The bacteria C. chauvoei strain ATCC 10092 (ATCC, USA); E. cloni 10G cells and pRham-N-His-SUMO-Kan Vector (Sigma, USA) were used in this study. The bacterial strain was cultured in ATCC 2107 media (peptone - 10.0 g, beef extract - 10.0 g, yeast extract - 3.0 g, dextrose - 5.0 g, NaCl - 5.0 g, soluble starch - 1.0 g, L-cysteine HCl - 0.5 g, sodium acetate - 3.0 g, resazurin (0.025%) - 4 ml, and DI water to make 1000 ml) at 37°C for 48 h under anaerobic conditions.

Genomic DNA isolation

C. chauvoei genomic DNA was extracted using GeneJET Genomic DNA purification kit (Thermo Scientific, USA) as per manufacturer’s instructions. Briefly, C. chauvoei cells were centrifuged, and the obtained pellet was resuspended in 180 µl of the bacterial lysis buffer followed by incubation at 37°C. Lysis solution (200 µl) and proteinase K (20 µl) were added and the sample was incubated at 56°C. RNase A solution (20 µl) was added and incubated for 10 min. Ethanol (400 µl) was added, and lysate was added to the column, centrifuged, and flow-through was discarded. Then, wash Buffer I (500 µl) was added, centrifuged, and flow-through was discarded. Wash Buffer II (500 µl) was added to the column, centrifuged, and flow-through was discarded. Genomic DNA was eluted using elution buffer (100 µl) and stored at −20°C.

Polymerase chain reaction (PCR) for confirmation of C. chauvoei

PCR amplification of 16S-23S rDNA was performed as described by elsewhere [9]. C. chauvoei was identified using IGSCS and 23UPCH primers specific for 16-23s rRNA spacer region.

PCR amplification of hyaluronidase (nagH) gene of C. chauvoei

PCR was carried out in the volume of 25 µl standard PCR reaction mixture containing primers (For - CGCGAACAGATTGGAGGTGGTGCAGCATCAAATCCAAAT; Rev-GTGGCGGCCGCTCTATTA ACTTCTAGGAGGTCCCCCAAA) and genomic DNA template. PCR conditions used consist of initial denaturation temperature of 94°C (5 min) followed by 34 cycles of denaturation of 94°C (1 min), annealing temperature of 58°C (1 min) and extension of 72°C (1 min). Final extension was carried out at 72°C (10 min). PCR amplicons were analyzed by agarose gel electrophoresis.

Gel extraction of PCR product

The gel containing the DNA fragment was excised using a clean scalpel and placed into a pre-weighed 1.5 ml tube and weighed. The weight of the gel slice was recorded. The gel extraction of DNA fragments was carried out using Gene JET gel extraction kit (Thermo Scientific, USA) following the manufacturer’s instructions.

Cloning of hyaluronidase (nagH) gene

The amplified nagH gene was purified using MinElute gel extraction kit (Qiagen, USA) as per manufacturer’s protocol and cloned into pRham-N-His SUMO-Kan expression vector (Lucigen Corporation, USA) as per manufacturer’s protocol. Briefly, E. cloni 10G competent cells were thawed and transferred into a pre-cooled 15 ml centrifuge tube. 25 ng of pRham-N-His SUMO-Kan Vector DNA was added with 100 ng of the purified PCR product and mixed. The mixture of cells and DNA was incubated on ice for 30 min, heat shocked the cells at 42°C for 45 s, followed by addition of 960 µl of recovery medium and incubation at 37°C in a shaking incubator for 2 h and plated on the luria broth agar containing kanamycin (30 µg/ml). The recombinant clones were confirmed by colony PCR using the nagH specific primers and also by sequencing. Sequence was subjected to analysis using NCBI’s BLAST program. Phylogenetic tree was constructed by the neighbor-joining method with a bootstrap value of 1000 using the MEGA6 software version 6.0 [10].

Results

C. chauvoei culture was confirmed using 16S-23S rRNA spacer region specific PCR [9], which yielded a specific amplicon of 522 bp (Figure-1). Amplification of nagHgene of C. chauvoei yielded amplification at 1143 bp (Figure-2) as expected. PCR amplified nagH gene was purified, and the yield of the DNA was about 80% of the PCR product.
Figure-1

Confirmation of C. chauvoei by polymerase chain reaction (PCR) based on 16S-23S rDNA spacer gene: Lane M: 100 bp DNA ladder, Lane 1: PCR product (16S-23S rDNA spacer gene primers), Lane 2: Negative control.

Figure-2

Polymerase chain reaction amplification of nagH gene of Clostridium chauvoei: Lane M: 100 bp DNA Ladder, Lane 1: Negative control, Lane 2: nagH gene.

Confirmation of C. chauvoei by polymerase chain reaction (PCR) based on 16S-23S rDNA spacer gene: Lane M: 100 bp DNA ladder, Lane 1: PCR product (16S-23S rDNA spacer gene primers), Lane 2: Negative control. Polymerase chain reaction amplification of nagH gene of Clostridium chauvoei: Lane M: 100 bp DNA Ladder, Lane 1: Negative control, Lane 2: nagH gene. The PCR products were cloned in pRham N-His SUMO Vector and confirmed by colony PCR using nagH specific primers, which yielded 1143 bp size amplicons (Figure-3). Sequence analysis confirmed that the clones were positive for nagH gene confirming the presence of insert in the construct. The nagH gene sequence was submitted to nucleotide sequence database of NCBI, which was assigned with accession number, KY064176.1. Phylogenetic analysis revealed that nagH gene of C. chauvoei ATCC 10092 was closely related to that of C. chauvoei JF4335 strain, as well as Clostridium perfringens, Clostridium cellulovorans, and Clostridium paraputrificum strains (Figure-4) thus indicating that the nagH gene of C. chauvoei could be having structural/functional similarity to that of other Clostridium species.
Figure-3

Confirmation of the recombinant clones by colony polymerase chain reaction: Lane M: 100 bp DNA Ladder, Lanes 1 and 2: nagH amplicon of 1143 bp size, Lane 3: Negative control.

Figure-4

Phylogenetic analysis of nagH gene of Clostridium chauvoei.

Confirmation of the recombinant clones by colony polymerase chain reaction: Lane M: 100 bp DNA Ladder, Lanes 1 and 2: nagH amplicon of 1143 bp size, Lane 3: Negative control. Phylogenetic analysis of nagH gene of Clostridium chauvoei.

Discussion

Black quarter, also known as blackleg, caused by C. chauvoei is a disease with high-mortality affecting cattle, sheep, and other animals. C. chauvoei secretes exotoxins which are protein in nature and responsible for the pathogenesis of black quarter such as α toxin (oxygen stable hemolysin), β toxin (DNase), γ toxin (hyaluronidase), δ toxin (oxygen labile hemolysin), neuraminidase (sialidase), and cctA [11]. Few genes of C. chauvoei such as cctA [6], sialidase NanA [5], NAD-dependent beta hydroxybutyryl CoA dehydrogenase [12] have been cloned, sequenced, and expressed. However, only little is known about other virulence factors, molecular mechanisms of pathogenicity and the role of various toxins in the pathogenesis of the disease. C. chauvoei produce an enzyme hyaluronidase, which degrades the connective tissue substance called hyaluronate in the host. As revealed in another study, the genome of C. chauvoei harbors two different genes for hyaluronidase, namely, nagH and nagJ [1]. Hyaluronidase is shown to be involved in degrading the intracellular matrix and tissue connections so that C. chauvoei and its toxins can spread in the infected host. Hence, we selected this gene for characterization in C. chauvoei. Sequence analysis of the hyaluronidase genes indicated that nagH gene of C. chauvoei ATCC 10092 was closely related to that of C. chauvoei JF4335 strain, as well as C. perfringens and C. paraputrificum strains. C. perfringens, genome sequence, has five hyaluronidase genes [13] as compared to two hyaluronidase genes in case of C. chauvoei. All of nagH genes reported so far, have revealed N-terminal signal sequences, indicating the secretory nature of these enzymes [14]. C. paraputrificum has been shown to harbor nag84A gene, which encodes for hyaluronidase, though it did not have hyaluronidase activity [15].

Conclusion

In this study, nagH gene was amplified and cloned into prokaryotic expression vector, and recombinant clones were confirmed by colony PCR followed by sequencing. However, more research is needed to express the nagH gene and to characterize its role in virulence of C. chauvoei.

Authors’ Contributions

SKD carried out the laboratory work, and VKN designed the work. SKD and VKN drafted and revised the manuscript. PKY and AT assisted in the experiments.
  12 in total

Review 1.  Hyaluronidases of Gram-positive bacteria.

Authors:  W L Hynes; S L Walton
Journal:  FEMS Microbiol Lett       Date:  2000-02-15       Impact factor: 2.742

2.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

Review 3.  Patho-genetics of Clostridium chauvoei.

Authors:  Joachim Frey; Laurent Falquet
Journal:  Res Microbiol       Date:  2014-11-04       Impact factor: 3.992

4.  Cytotoxin CctA, a major virulence factor of Clostridium chauvoei conferring protective immunity against myonecrosis.

Authors:  Joachim Frey; Anders Johansson; Sibylle Bürki; Edy M Vilei; Keith Redhead
Journal:  Vaccine       Date:  2012-06-27       Impact factor: 3.641

5.  Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater.

Authors:  Tohru Shimizu; Kaori Ohtani; Hideki Hirakawa; Kenshiro Ohshima; Atsushi Yamashita; Tadayoshi Shiba; Naotake Ogasawara; Masahira Hattori; Satoru Kuhara; Hideo Hayashi
Journal:  Proc Natl Acad Sci U S A       Date:  2002-01-15       Impact factor: 11.205

6.  Rapid identification and differentiation of pathogenic clostridia in gas gangrene by polymerase chain reaction based on the 16S-23S rDNA spacer region.

Authors:  Y Sasaki; K Yamamoto; A Kojima; M Norimatsu; Y Tamura
Journal:  Res Vet Sci       Date:  2000-12       Impact factor: 2.534

7.  A new type of beta-N-Acetylglucosaminidase from hydrogen-producing Clostridium paraputrificum M-21.

Authors:  Huazhong Li; Kenji Morimoto; Tetsuya Kimura; Kazuo Sakka; Kunio Ohmiya
Journal:  J Biosci Bioeng       Date:  2003       Impact factor: 2.894

8.  Reversible expression of motility and flagella in Clostridium chauvoei and their relationship to virulence.

Authors:  Y Tamura; M Kijima-Tanaka; A Aoki; Y Ogikubo; T Takahashi
Journal:  Microbiology       Date:  1995-03       Impact factor: 2.777

9.  Genetic and functional characterization of the NanA sialidase from Clostridium chauvoei.

Authors:  Edy M Vilei; Anders Johansson; Yvonne Schlatter; Keith Redhead; Joachim Frey
Journal:  Vet Res       Date:  2011-01-11       Impact factor: 3.683

10.  Epidemiology and financial loss estimation of blackleg on smallholder cattle herders in Kembata Tambaro zone, Southern Ethiopia.

Authors:  Birhanu Ayele; Worku Tigre; Benti Deressa
Journal:  Springerplus       Date:  2016-10-21
View more
  1 in total

1.  Cloning and sequence analysis of a partial CDS of leptospiral ligA gene in pET-32a - Escherichia coli DH5α system.

Authors:  Manju Soman; Mangattuparambil Mini; Siju Joseph; Jobin Thomas; Nirmal Chacko; T G Sumithra; R Ambily; Binu K Mani; Rinsha Balan
Journal:  Vet World       Date:  2018-04-30
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.