Literature DB >> 29037166

TaFlo2-A1, an ortholog of rice Flo2, is associated with thousand grain weight in bread wheat (Triticum aestivum L.).

Muhammad Sajjad1,2, Xiaoling Ma1,3, Sultan Habibullah Khan4, Muhammad Shoaib1,3, Yanhong Song1,5, Wenlong Yang1, Aimin Zhang6,7, Dongcheng Liu8.   

Abstract

BACKGROUND: The Flo2 gene is a member of a conserved gene family in plants. This gene has been found to be related to thousand grain weight (TGW) in rice. Its orthologs in hexaploid wheat were cloned, and the haplotype variation in TaFlo2-A1 was tested for association with TGW.
RESULTS: The cloned sequences of TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1 contained 23, 23 and 24 exons, respectively. The deduced proteins of TaFlo2-A1 (1734 aa), TaFlo2-B1 (1698 aa) and TaFlo2-D1 (1682 aa) were highly similar (>94%) and exhibited >77% similarity with the rice FLO2 protein. Like the rice FLO2 protein, four tetratricopeptide repeat (TPR) motifs were observed in the deduced TaFLO2 protein. An 8-bp InDel (-10 to -17 bp) in the promoter region and five SNPs in first intron of TaFlo2-A1 together formed two haplotypes, TaFlo2-A1a and TaFlo2-A1b, in bread wheat. TaFlo2 was located on homeologous group 2 chromosomes. TaFlo2-A1 was inferred to be located on deletion bin '2AL1-0.85-1.00'. The TaFlo2-A1 haplotypes were characterized in the Chinese Micro Core Collection (MCC) and Pakistani wheat collection using the molecular marker TaFlo2-Indel8. TaFlo2-A1 was found to be associated with TGW but not with grain number per spike (GpS) in both the MCC and Pakistani wheat collections. The frequency of TaFlo2-A1b (positive haplotype) was low in commercial wheat cultivars; thus this haplotype can be selected to improve grain weight without negatively affecting GpS. The expression level of TaFlo2-A1 in developing grains at 5 DAF (days after flowering) was positively correlated with TGW in cultivars carrying the positive haplotype.
CONCLUSION: This study will likely lead to additional investigations to understand the regulatory mechanism of the Flo2 gene in hexaploid wheat. Furthermore, the newly developed molecular marker 'TaFlo2-InDel8' could be incorporated into the kit of wheat breeders for use in marker-assisted selection.

Entities:  

Keywords:  Floury endosperm; Gene cloning; Haplotype variation; TGW; Triticum aestivum

Mesh:

Year:  2017        PMID: 29037166      PMCID: PMC5644068          DOI: 10.1186/s12870-017-1114-3

Source DB:  PubMed          Journal:  BMC Plant Biol        ISSN: 1471-2229            Impact factor:   4.215


Background

Enhancing the grain yield potential of wheat is a key focus of wheat breeders. Grain yield is the product of various yield components. Wheat grain yield per unit area is the product of grain yield per spike (GYS) and the number of spikes per unit area. The latter depends on sowing density and is highly affected by environmental factors. The GYS is determined by grain number per spike (GpS) and thousand grain weight (TGW), which are variably correlated in different wheat collections/populations. A significant negative correlation between these two traits has been reported in bi-parental populations [1-3], but no significant correlation was observed between TGW and GpS in collections of Chinese landraces [4], French winter wheat cultivars [5] and CIMMYT-derived spring wheat collections [6]. On the other hand, a significant positive correlation between TGW and GpS was reported in modern Chinese cultivars [4]. TGW in wheat has been one of the target traits for selection during domestication and breeding [7, 8]. For example, in China, an increase in wheat yield potential from ~1 T ha−1 in 1992 to ~5.4 T ha−1 today is mainly due to the genetic increase in TGW from ~20 g to ~45 g, respectively [9]. However, genetic gain in TGW has not reached its limit and thus provides an opportunity to increase yield potential [9]. It is estimated that an increase in yield of 140–160 kg ha−1 can be obtained by just a 1-g increase in TGW [10]. However, genes and their roles in controlling TGW in wheat are still largely unknown. In wheat, TGW is a quantitative trait controlled by several genes/QTL distributed on all chromosomes [8, 11]. For example, Su et al. [12] discovered eight TGW-related QTL on chromosomes 2D, 4B, 5A, 7A and 7B, explaining up to 16.2% of the phenotypic variation. Similarly, four QTL for TGW on chromosomes 1D, 2A, 5D, and 6A explained 5.9 to 20.1% of phenotypic variation in different environments [13]. Nevertheless, from this plethora of QTLs, few loci/genes have been cloned by map-based cloning approaches mainly because of the large and complex hexaploid genome (~17 Gb) that consists of three homeologous genomes (A, B, D) and an abundance of repeat sequences (80%) [14]. Studies on comparative genomics have shown high synteny and collinearity among different grass genomes, such as those of wheat, barley, rice, millet, maize and sorghum. This pattern of genome organization in the members of the grass family provides a powerful approach for gene discovery in common wheat [15]. A large number of genes have been discovered in common wheat by synteny-based cloning, in which the gene sequences of model crops such as rice and barley have been used as references to identify orthologous genes in wheat. For example, the genes TaTGW6 [16, 17], TaCwi-A1 [18], TaSus2-2B [19], TaSus2-2A, TaSus1-7A [20], TaGW2-6A, 6B [9, 12, 21], TaCKX6-D1 [22], TaSAP1-A1 [23], TaGS1a [24], TaGS-D1 [25], and TaGASR-A1 [26] were discovered using rice-wheat synteny and using molecular markers in marker-assisted wheat breeding. Hence, the isolation and characterization of genes controlling grain size in common wheat will help breeders maximize yield potential by establishing gene-based breeding programs. The FLOURY ENDOSPERM2 (Flo2) gene is a member of a conserved gene family in plants. In rice, this gene has been shown to have a tetratricopeptide repeat (TPR) motif consisting of 3–16 tandem repeats of 34 aa residues that mediate protein–protein interactions in the nucleus [27, 28]. The OsFlo2 gene was cloned in the indica cultivar ‘Kasalath’; this gene was found to have 23 exons and 22 introns and coded for a protein consisting of 1720 amino acid residues that had three TPR motifs in the middle [27]. The expression of Flo2 was constitutive in both vegetative tissues and developing seeds, and the expression was relatively high level in developing seeds. The flo2 mutants exhibit a significant reduction in amylose content and grain weight and exhibit altered expression of various starch synthesis-related genes, indicating its key role in regulating rice grain weight and starch quality [27, 28]. In this article, we report the rice-wheat synteny-based isolation of Flo2 orthologs in hexaploid wheat, the association of TaFlo2-A1 sequence polymorphisms with TGW and the comparison of temporal expression profiles of TaFlo2-A1 haplotypes in flag leaves and developing caryopses.

Methods

Plant materials

For cloning the TaFlo2 gene in hexaploid wheat, Chinese Spring (CS) and two sets of cultivars with lower and higher TGW were used; the set of cultivars with higher TGW included Dixiuzao (49.5 g), Enmai4 (49.2 g), Liying 5(49.4 g) and Laizhou 953 (52.2 g), and the set with lower TGW included Jinyang 60 (23.5 g), Baihuamai (24.1 g), Sanyuehuang (25.2 g) and Zipi (25.5 g). The Chinese Spring nulli-tetrasomic lines were used to assign TaFlo2 genes to wheat homeologous chromosomes. The Chinese Micro Core Collection (MCC, 262 accessions) and Pakistani wheat collection (130 accessions) were used to confirm the association between TaFlo2-A1 haplotypes and TGW. To avoid the effect of population structure, normalized MCC subpopulations were used for association analysis [19, 29]. The Pakistani collection was selected based on previous reports [30, 31] considering the effect of population structure on association analyses.

Cloning and characterization of TaFlo2 sequences

The genomic sequence of the rice OsFlo2 gene (NC_008397) was used as a query for BLAST searches against the wheat sequences database in the URGI (https://urgi.versailles.inra.fr/). All wheat scaffold sequences with high similarity to the rice OsFlo2 sequence were assembled to construct a putative TaFlo2 gene using DNAMAN (http://www.lynnon.com). Based on the scaffold sequences, six conserved primer pairs were used to specifically amplify TaFlo2 coding and promoter sequences from the three wheat sub-genomes: A, B and D (Table 1). The TaFlo2 mRNA of 4902 bp was cloned in Chinese Spring using three primer pairs designed from the predicted mRNA sequence (Table 1). Genomic DNA was extracted from young seedlings of each line using the CTAB method [32]. A 20-μl reaction volume comprising 0.5 μl (5 μM) of each primer, 2× Taq mix (GenStar, Beijing, China) and 100 ng of DNA was used for PCR amplification that consisted of a cycle profile of 5 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 60 °C and 4 min at 72 °C; and a final extension of 10 min at 72 °C. The PCR products were detected by electrophoresis in 1% agarose gels with nucleic acid dye (Tiangen, Beijing, China), and gel images were captured using a UV spectrometer (BioRad, Hercules, CA, USA). The targeted PCR products were obtained from the agarose gels and purified using the TIANgel MIDI Purification Kit (Tiangen, Beijing, China). The purified PCR products were then ligated into the pGEM-T Easy cloning vector (TransGen Biotech, Beijing, China). The ligation product was transformed to 50 μl of Trans1-T1 competent cells by the heat shock method (Tiangen, Beijing, China). Positive clones from each transformation were selected based on positive PCR tests and were sequenced (Beijing Genomics Institute). The sequences were analyzed using DNAMAN software (http://www.lynnon.com).
Table 1

Primer sequences used in this study

Primer namePrimer sequence (5′-3′)Position on scaffold sequenceAnnealing temperature (°C)PCR product sizeFunction
Flo2-1FTGTGCTGGAATCACCCACTC793–812601061cloning TaFlo2 /polymorphism detection
Flo2-1RGCGCGGCGAAAACTAATCAT1853–1844
Flo2-2FGTGCCGTCCATAATCGTTGC1546–1565601781cloning TaFlo2 /polymorphism detection
Flo2-2RCATGTGCGGCAAAAGACACA3326–3307
Flo2-3FAACGGGCATGTGTCTTTTGC3299–3318603025cloning TaFlo2 /polymorphism detection
Flo2-3RCGACGCAGCTCTGAAAATCG6332–6313
Flo2-4FCGCTTAGCAGTGGATTTGCC5719–5738603948cloning TaFlo2
Flo2-4RATCCAACAAACAGGTGCCCA9667–9647
Flo2-5FTTGCGGAAGCCCATCATTCT8387–8406603836cloning TaFlo2
Flo2-5RTGACCTTCTGCGGATGCTTT1222–12,203
Flo2-6FCAGAACAGGGCCGGTACAAT11,368–11,387602600cloning TaFlo2
Flo2-6RCGCTCATCTGGATAGGGCAA13,967–13,948
TaFlo2-InDel8FACCCCTCCTCCGTTATCGTC1337–135660145/1538-bp InDel polymorphism in TaFlo2-A1
TaFlo2-InDel8RCCTCCTTCTTCTTGCGGTCG1470–1489
Flo2-A1FGTGCTCCGATCCGATGTGCAGTTAT5387–5411585872A specific
Flo2-A1RGTGCACAACCAAGTAAAAGG5973–5954
Flo2-B1FGTC ATC ACTAGAGGA ATTTTCC6851–6872589022B specific
Flo2-B1RCTCTCAGAACTGTGGAT7752–7736
Flo2-D1FCTGTATCTGTAATTTGTTCCG5378–5398583262D specific
Flo2-D1RCTTCCGAAAAATGTGGGG5704–5687
mFlo2-1FTAACGGTGGTGCACTTGTGT581868Cloning mRNA
mFlo2-1RTCAGCCGCAAGTTATGCTCA
mFlo2-2FTGCGGACGAGATGGAAAACA581809Cloning mRNA
mFlo2-2RAGCAGTCAGCCGATGGTATG
mFlo2-3FATGCGTACTCCCTAAGCGTG581889Cloning mRNA
mFlo2-3RCACGAAGTGCTGCTTGCTTT
eTaFlo2FCCATTCGGCTTTCGTGCAAA55134Expression analysis
eTaFlo2RTGTTTTCCATCTCGTCCGCA
ActinFAGCCATACTGTGCCAATC55134Internal control
ActinRGCAGTGGTGGTGAAGGAGTAA
Primer sequences used in this study

Characterization of TaFlo2-A1 haplotypes and development of haplotype-specific markers

The 262 MCC and 130 Pakistani varieties were genotyped with the primer pair TaFlo2-InDel8, and PCR product was run on 8% polyacrylamide gels. Based on TaFlo2-InDel8 scoring, the MCC and Pakistani accessions sorted into two groups according to their haplotypes (TaFlo2-A1a or TaFlo2-A1b) for the TaFlo2-A1 gene. For MCC, the average values of TGW of the two haplotype groups were calculated using replicated data collected from 3 years (2002, 2005, 2006) of plants in Beijing [19]. For Pakistani varieties, the average values of TGW of the two haplotype groups were calculated using replicated data from 2 years (2009, 2010) of field trials at the University of Agriculture, Faisalabad. The resulting values were then compared and statistically analyzed using SPSS 13.0 for Windows (IBM, New York, USA).

Quantitative RT-PCR analysis of TaFlo2-A1 haplotypes

The Yangmai 19, Chinese Spring, Pubing3228, Shannong23 and Zhengmai9405 varieties were sown at the experimental station of the Institute of Genetics & Developmental Biology, CAS in Beijing, China in October 2014; three rows of each variety were planted. The length of each row was 2 m, and the row-to-row distance was 20 cm. The plants were managed in accordance with standard agronomic practices; irrigation and fertilizer were supplied for optimal growth. Twelve- day-old flag leaves of five plants from each variety were harvested and stored at −80 °C. Unfertilized grains were collected from each variety 1–2 days before flowering (DBF). Fertilized grains were collected from each variety at 5, 10, 15, 20 and 25 days after flowering (DAF). The flag leaf and developing grain samples were processed for the preparation of total RNA as described previously [33]. Three biological replicates that were collected from different plants were analyzed separately for each variety for quantitative RT-PCR evaluation. For TaFlo2-A1 transcripts analysis, the primer set eTaFlo2, which is specific for TaFlo2-A1 (Table 1), was designed and used. Quantitative RT-PCR was then carried out as described by Feng et al. [34]. The wheat actin gene was used as an internal control. The relative expression level of TaFlo2-A1 in each flag leaf and in each sample of developing grains was calculated using the data of three technical replicates as described previously [35]. Statistical comparisons of TaFlo2-A1 expression levels (presented as the mean ± SD) among different samples were made by ANOVA using SPSS 13.0.

Bioinformatics comparison of nucleotide and protein sequences

Nucleotide and protein identities among the compared sequences were calculated using DNAMAN (http://www.lynnon.com). Amino acid sequence alignment was accomplished using ClustalW2 in EMBLEBI (www.ebi.ac.uk/Tools/msa/clustalw2). Potential signal peptide sequences in the deduced proteins of TaFLO2 and its homologs were predicted using Softberry software (http://www.softberry.com/berry.phtml). The predicted TaFLO2 protein was BLASTed both in the NCBI smart blast system (http://blast.st-va.ncbi.nlm.nih.gov/smartblast) to search for homologous proteins and in the NCBI CD system (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) to search for conserved domains.

Results

Cloning and characterization of TaFlo2 genes

To select potential candidate TaFlo2 genes, the rice Flo2 sequence (NC_008397) was used as a query against the wheat genome sequences database in the URGI (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Three bread wheat scaffolds (IWGSC_chr2AL_ab_k71_contigs_longerthan_200_6436403, IWGSC_chr2BL_ab_k71_contigs_longerthan_200_7959819, IWGSC_chr2DL_ab_k71_contigs_longerthan_200_9909583) with high similarity (E value = 0 and similarity >73%) were identified as potential orthologs to the rice Flo2 gene. The sequences of these scaffolds were downloaded and assembled with DNASTAR (http://www.dnastar.com/) to construct a putative TaFlo2 sequence. To search TaFlo2 homologs and predict their deduced protein sequence and structure, Softberry (http://www.softberry.com/berry.phtml) and NCBI (https://www.ncbi.nlm.nih.gov/) tools were used. The deduced proteins of TaFlo2-A1 (1734 aa), TaFlo2-B1 (1698 aa) and TaFlo2-D1 (1682 aa) were highly similar (>94% identity among themselves) and exhibited >77% similarity with the rice FLO2 protein. Like in the rice FLO2 protein [27], four tetratricopeptide repeat (TPR) motifs were observed in the deduced TaFLO2 protein at the positions of 947–988, 1032–1072, 944–1017 and 1028–1106 amino acid residues. Furthermore, three mitochondrial CLU domains were also observed at 737–878, 50–162 and 357–401 amino acid residues (Fig. 1a). The TaFLO2 protein showed high similarity with Aegilops tauschii, Brachypodium distachyon and long-grain rice proteins (Fig. 1b).
Fig. 1

a Putative structure of the OsFLO2 and TaFLO2 proteins. Clu_N (mitochondrial function, CLU-N-term), CL (clustered mitochondria domain), CLU-center (an uncharacterized central domain of CLU mitochondrial proteins), TPR (tetratricopeptide repeat). b Similarity between the TaFLO2 protein and proteins from related plant species

a Putative structure of the OsFLO2 and TaFLO2 proteins. Clu_N (mitochondrial function, CLU-N-term), CL (clustered mitochondria domain), CLU-center (an uncharacterized central domain of CLU mitochondrial proteins), TPR (tetratricopeptide repeat). b Similarity between the TaFLO2 protein and proteins from related plant species To clone the full-length genomic sequence of TaFlo2 in Chinese Spring, six conserved primer pairs were used (Table 1). The assembly of sequences with the six conserved primer pairs yielded three fragments, 14,009, 14,078 and 13,814 bp. Based on alignment with wheat scaffolds in the database and genome-specific primers, the fragments were designated TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1. The open reading frames of TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1 were 12,183 bp, 12,270 bp and 12,022 bp in length, respectively. The TaFlo2 mRNA of 4902 bp was cloned with three primer pairs (Table 1). Based on the prediction and alignment with cloned mRNA, the cloned genomic sequences from 2AL, 2BL and 2DL consisted of 23, 23 and 24 exons, respectively (Fig. 2a). Among the three homoeologs, the sequence and size of the first four exons were conserved, whereas the size and sequence of the other exons varied.
Fig. 2

Polymorphism, molecular marker and ORF structure of TaFlo2 homoeologs. a Exon and intron pattern in the ORFs of TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1. The length of each ORF (between the start and stop codons) is shown to the right of the graph. The number of nucleotides in each exon or intron is indicated. CDSf: First coding sequence, CDSi: Internal coding sequence, CDSl: Last coding sequence. b Alignment of the part of cloned TaFlo2 orthologs. Polymorphism both in the promoter and first intron is indicated by stars. c PCR product of molecular marker TaFlo2-InDel8 discriminated by PAGE in 60 MCC accessions

Polymorphism, molecular marker and ORF structure of TaFlo2 homoeologs. a Exon and intron pattern in the ORFs of TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1. The length of each ORF (between the start and stop codons) is shown to the right of the graph. The number of nucleotides in each exon or intron is indicated. CDSf: First coding sequence, CDSi: Internal coding sequence, CDSl: Last coding sequence. b Alignment of the part of cloned TaFlo2 orthologs. Polymorphism both in the promoter and first intron is indicated by stars. c PCR product of molecular marker TaFlo2-InDel8 discriminated by PAGE in 60 MCC accessions

Polymorphism detection in TaFlo2-A1

To detect polymorphisms in the putative TaFlo2 sequences between high and low TGW accessions, three conserved primers that covered scaffold segments from 793 to 6332 bp were used (Table 1). Polymorphism in TaFlo2-A1 sequences between high and low TGW accessions was observed between 1396 to 1791 bp, while no sequence variation was observed between high and low TGW accessions in TaFlo2-B1 and TaFlo2-D1 (Fig. 2b; Additional file 1: Figure S1). The conserved sequences of TaFlo2-B1 and TaFlo2-D1 in all the higher and lower TGW accessions implicated non-functional nature of these genes. An 8-bp InDel was identified in TaFlo2-A1 sequences from 1396 to 1403 bp which was −17 to −10 bp upstream of the first coding sequence (ATG) at position 1417–1419 bp (Fig. 2b). Five SNPs (G/C, A/G, C/T, C/G and −/T) were observed at 1514, 1538, 1545, 1727 and 1791 bp. From the start codon (ATG), the positions of these five SNPs (G/C, A/G, C/T, C/G and −/T) were in the first intron at 98, 122, 128, 311 and 375 bp, respectively (Fig. 2b). The 8-bp InDel and the five SNPs together formed the two haplotypes designated TaFlo2-A1a and TaFlo2-A1b (Fig. 2b). From the position 1792 to 6332 bp, no polymorphism was observed in the TaFlo2-A1 sequence.

Molecular marker development and characterization of TaFlo2-A1 haplotypes

To characterize the observed TaFlo2-A1 haplotypes in large wheat populations, a molecular marker based on the 8-bp InDel observed in the promoter region was designed and named TaFlo2-Indel8 (Table 1). The forward and reverse primers of TaFlo2-Indel8 are located at −80 bp and 72 bp from the start codon, respectively. The PCR products of TaFlo2-Indel8 in the accessions with or without the 8-bp InDel have lengths of 153 bp and 145 bp, respectively. The bands of 153 bp and 145 bp were easily discriminated by polyacrylamide gel electrophoresis and represented the haplotypes TaFlo2-A1a and TaFlo2-A1b, respectively (Fig. 2c).

Chromosomal location of TaFlo2 genes

To assign chromosomal locations to TaFlo2 genes, genome-specific primers and a set of Chinese Spring nulli-tetrasomic lines were used. The TaFlo2 genes TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1 were found to be located on chromosomes 2A, 2B and 2D (Fig. 3). The cloned sequences of TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1 showed >99% similarity with 2AL, 2BL and 2DL scaffolds (IWGSC_chr2AL_ab_k71_contigs_longerthan_200_6436403, IWGSC_chr2BL_ab_k71_contigs_longerthan_200_7959819, IWGSC_chr2DL_ab_k71_contigs_longerthan_200_9909583). Further analysis revealed that the TaFlo2-A1 gene was located on deletion bin ‘2AL1–0.85-1.00’.
Fig. 3

Assignment of TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1 to wheat chromosomes 2A, 2B and 2D, respectively, by PCR mapping with the genomic DNA of Chinese Spring (CS) and derivative nulli-tetrasomic lines (N2AT2B, N2BT2A and N2DT2A). The size (kb) of DNA markers is shown to the left of the image

Assignment of TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1 to wheat chromosomes 2A, 2B and 2D, respectively, by PCR mapping with the genomic DNA of Chinese Spring (CS) and derivative nulli-tetrasomic lines (N2AT2B, N2BT2A and N2DT2A). The size (kb) of DNA markers is shown to the left of the image

Association of TaFlo2-A1 with thousand grain weight

To associate TaFlo2-A1 with TGW, two natural populations, the Chinese Micro Core Collection (MCC) and the Pakistani collection, were used. In the MCC, the homozygous TaFlo2-A1a haplotype was found in 219 (83.5%) accessions, whereas the TaFlo2-A1b haplotype was found in 43 (16.5%) accessions. In the Pakistani wheat collection, the number of accessions carrying TaFlo2-A1a and TaFlo2-A1b were 85 (64.6%) and 45 (35.4%), respectively. Both in the MCC and Pakistani collections, the positive haplotype TaFlo2A-A1b had a lower frequency, which showed the scope of improving grain weight. The difference in TGW between the haplotypes TaFlo2-A1a and TaFlo2-A1b was statistically significant in both populations (P < 0.05, Table 2). In the MCC, the mean difference in TGW between the groups of accessions having TaFlo2-A1a and TaFlo2-A1b was significant (P ≤ 0.05) across the 3 years of data. The mean differences in TGW between the two haplotypes in 2002, 2005 and 2006 were 7.00 ± 1.12 g, 7.80 ± 1.11 g and 8.40 ± 0.94 g, respectively. Consistent with the results of the MCC, the mean difference in TGW between groups of accessions having TaFlo2-A1a and TaFlo2-A1b was also significant (P ≤ 0.05) across both years of data in the Pakistani wheat collection. The values of the mean difference between the two haplotypes (TaFlo2-A1a and TaFlo2-A1b) in the Pakistani wheat population were 4.50 ± 0.71 g and 5.20 ± 0.72 g for 2009 and 2010, respectively. The phenotypic variance for TGW explained by TaFlo2-A1 haplotypes was 6.19% in 2002, 7.76% in 2005 and 8.37% in 2006 in the MCC. In the Pakistani collection, the phenotypic variance for TGW explained by TaFlo2-A1 haplotypes was 4.42% in 2009 and 5.11% in 2010 (Table 2). Moreover, to determine whether TaFlo2-A1 also affects grain number per spike (GpS), an association analysis was performed for GpS in both populations. However, the differences in GpS between the haplotypes TaFlo2-A1a and TaFlo2-A1b were not significant in either population (P < 0.05, Table 2).
Table 2

Association of TGW and GpS with TaFlo2-A1 in the Chinese Micro Core Collection and Pakistani wheat collections

Natural populationsYear (number of accessions) TaFlo2-A1a Mean ± SEa (number of accessions) TaFlo2-A1b Mean ± SE (number of accessions)Mean difference ± SEPVE (%)b TGW
TGWGpSTGWGpSTGWGpS
Chinese Micro Core Collection2002 (137)33.6 ± 0.54(98)50.8 ± 1.2(98)40.6 ± 1.2(39)49.7 ± 1.5(39)7.0 ± 1.1**1.06 ± 2.1ns 6.19
2005 (169)30.7 ± 0.52(128)43.1 ± 0.8(128)38.5 ± 1.1(41)40.5 ± 1.1(41)7.8 ± 1.1**2.6 ± 1.5 ns 7.76
2006 (185)32.8 ± 0.43(141)51.4 ± 0.7(141)41.2 ± 0.9(44)48.6 ± 1.2(43)8.4 ± 0.9**2.7 ± 1.5 ns 8.37
Pakistani collection2009 (130)40.6 ± 0.43(85)46.6 ± 1.1(85)45.1 ± 0.55(45)44.4–1.8(45)4.5 + 0.71**2.2 ± 1.9 ns 4.42
2010 (130)40.5 ± 0.47(85)47.8 ± 1.2(85)45.7 ± 0.46(45)44.9 + 1.6(45)5.2 ± 0.72**2.9 ± 2.0 ns 5.11

**indicates significant differences, and ns indicates non-significant differences (P < 0.01; Student’s t-test) among groups carrying different haplotypes

aStandard error

bPercentage of phenotypic variance explained by association analysis

Association of TGW and GpS with TaFlo2-A1 in the Chinese Micro Core Collection and Pakistani wheat collections **indicates significant differences, and ns indicates non-significant differences (P < 0.01; Student’s t-test) among groups carrying different haplotypes aStandard error bPercentage of phenotypic variance explained by association analysis Collectively, our data demonstrated that TaFlo2-A1, like the OsFlo2 gene in rice, is associated with TGW in wheat. Furthermore, the lack of association of TaFlo2-A1 with GpS suggests that the high TGW of the examined genotypes is primarily due to the positive haplotype (TaFlo2-A1b) for high TGW instead of loci for low number of kernels per spike and/or low grain yield.

Expression of TaFlo2-A1 is positively related to TGW

To observe the contrasting effects of TaFlo2-A1a and TaFlo2-A1b on TGW at the gene expression level in flag leaves and developing grains, two polymorphic accessions were used. The expression level of TaFLO2 was positively correlated with TGW, which is consistent with previous results in rice [27]. The haplotype TaFlo2-A1a, which exhibits low expression levels, represented the group of accessions that have low average TGW, and the haplotype TaFlo2-A1b, which exhibits high expression levels, represented the group of accessions that have high average TGW in both Chinese and Pakistani wheat populations. Quantitative RT-PCR assays showed that for both types of haplotypes, the expression level was maximum in 12-day-old flag leaves followed by expression in developing grains sampled at 5 DAF. However, the expression of both types of haplotypes decreased rapidly in the fertilized caryopses collected at 10, 15, 20 and 25 DAF. The expression level of TaFlo2-A1b was higher than that of TaFlo2-A1a at all tested stages but significantly differed only in flag leaves and developing grains at 5 DAF (Fig. 4a). Furthermore, the expression level was positively correlated in Chinese Spring and three cultivars (Pubing3228, Shannong23, and Zhengmai9405) in developing grains sampled at 5 DAF. The expression level was lowest in Chinese Spring (TGW, 21.3 g) and highest in the cultivar Zhengmai9405 (TGW, 64.1 g) (Fig. 4b). All these cultivars contained the positive haplotype TaFlo2-A1b. Together, these results suggested that the relative expression level of TaFlo2-A1 was highest in flag leaves but started to decrease in developing grains. However, the expression in developing grains at 5 DAF was positively correlated with TGW in cultivars carrying the positive haplotype.
Fig. 4

a Expression of TaFlo2-A1 in flag leaves and developing grains. b Expression level of TaFlo2-A1b in cultivars with different TGW values at 5 DAF

a Expression of TaFlo2-A1 in flag leaves and developing grains. b Expression level of TaFlo2-A1b in cultivars with different TGW values at 5 DAF

Discussion

Rice-wheat synteny-based gene cloning in wheat

The rice OSFLO2 orthologs TaFLO2-A1, TaFLO2-B1 and TaFLO2-D1 were cloned, characterized and found to be located on homeologous chromosome group 2 in wheat. Sequence polymorphism observed in the promoter region of TaFlo2-A1 was associated with TGW. Thus, TaFLO2-A1 is a yield-related gene, and its manipulation could be useful for improving the grain yield potential of bread wheat. Many genes related to TGW and grain yield have been isolated and characterized in wheat using rice-wheat synteny [15]. The success of rice-wheat orthology-based gene cloning in wheat is due to high nucleotide and amino acid similarity between the corresponding orthologous genes. For example, with their respective rice orthologs, TaTGW6 has 71% nucleotide and 68% amino acid similarity [16, 17]; TaGW2 has 98% nucleotide and ~ 87% amino acid similarity [12]; TaCKX6-D1 has 66% amino acid similarity [22]; TaGS-D1 has 75.5% cDNA and 72.2% amino acid similarity [24]; and TaGASR-A1 has 88% amino acid sequence similarity [26]. These data provide a genetic framework for marker-assisted selection (MAS) to pyramid positive alleles for TGW and yield during cultivar development. However, there are still many important genes that have been characterized in rice that are not being used as template for cloning their orthologs in wheat, e.g., OsTB1 [36], GW5 [37], GS5 [38], GW8 [39], GW7/GL7 [40, 41], and OsAGSW1 [42]. Thus, comparative genomics approaches between rice and wheat will remain useful in discovering orthologs of rice genes in wheat and will continue to enhance our understanding of the genetics of yield potential in wheat.

The TaFLO2-A1 gene is related to TGW in wheat

Map-based cloning using QTL mapping approaches is an important strategy to isolate loci and genes controlling genetic polymorphism [43]. However, progress on map-based cloning in wheat has been relatively slow compared to that in rice, and very few QTLs have been subjected to fine mapping in order to isolate candidate genes, mainly due to the complexity and large genome size of wheat. In our study, TaFlo2-A1 was found to be associated with TGW and explained from 4.42% (in the Pakistani collection) to 8.37% (in the MCC) of phenotypic variation. The TGW-related QTL identified on 2AL includes ‘Xgwm339-Xbarc311’ in 139 RILs between two hard red spring wheat lines [44]; QTgw.ipk-2A (Xgwm372) in 111 BC2F3 lines derived from the cross ‘Flair × XX86’ [45]; QGwt.crc-2A (Xgwm558-Xgwm294) in a double-haploid population generated from the cross ‘RL4452 × AC Domain’ [46]; QTkw.sdau-2A (Xwmc181a-Xubc840c) in 131 RILs derived from ‘Chuan 35050’ × ‘Shannong 483’ [13]; QSZ.uaf-2A.1 (Xwmc455) in natural populations of 108 CIMMYT and Pakistani spring wheat accessions [47]; and QTkw.hwwgr-2AL (Xgwm312–IWA6090) in 127 RILs derived from ‘Ning7840’ × ‘Clark’ [42]. Furthermore, three QTL on 2AL that were stable across five trials were detected in the same MCC (262) used in present study [29]. These QTL on 2AL are located between Xgwm71.2/Xgwm558 and Xgwm294, with an interval of 22 cM according to the consensus map of Somers [48] or 16.1 cM according to the ITMI map (http://wheat.pw.usda.gov/ggpages/SSRclub/GeneticPhysical/). From this TGW-QTL-rich region, only one gene, TaCwi-A1, has been isolated thus far between the Xgwm 71.2 and Xbarc15 deletion bin ‘C-2AL1–0.85’, which is adjacent to the centromere [18]. By integrating the information from the ITMI (http://wheat.pw.usda.gov/ggpages/SSRclub/GeneticPhysical/) and ‘Yu 8679 × Jing 411’ SSR + SNP [49] maps, the location of TaFlo2-A1 was inferred on deletion bin ‘2AL1–0.85-1.00’. Hence, the TaFlo2-A1 is a TGW-related gene located on the distal deletion bin of chromosome 2AL, and the molecular marker ‘TaFlo2-InDel8’ is an addition to the kit of wheat breeders for marker-assisted selection.

Relationship between TGW and GpS

The relationship between the number of grains per spike (GpS) and the TGW was traditionally found as being negatively correlated [1-3]. However, the simultaneous selection of favored haplotypes for one plus neutral ones for the other or otherwise favored haplotypes for both traits has changed the correlations from negative to neutral or even positive [4]. Therefore, no significant correlation was observed between TGW and GpS in the collections of Chinese landraces [4], French winter wheat cultivars [5] or CIMMYT-derived spring cultivars and lines [6, 50], while significantly positive correlations were observed in Chinese modern cultivars [4]. In many genome-wide association studies (GWAS) for TGW and GpS, many loci were found to be associated with only one of the traits [4, 29, 50]. The favored haplotypes at these loci should increase the phenotypic value of the one trait without negatively affecting the phenotypic value of the others. Thus, selection of such QTL was likely a major factor in changing the relationship between TGW and GpS over time. Similarly, selection of the favored haplotype (TaFlo2-A1b) identified in this study would help to increase TGW without reducing the average GpS in wheat.

Effect and putative mechanism of TaFlo2-A1 in the determination of TGW

TaFlo2-A1, which is represented by two haplotypes in our study, was found to be significantly associated with TGW. Polymorphisms of an 8-bp InDel in the promoter and of five SNPs in the first intron were observed in TaFlo2-A1. The orthologs TaFlo2-B1 and TaFlo2-D1 lacked sequence variations associated with TGW (Fig. 2b). The association analysis of the Chinese Micro Core Collection (MCC) and Pakistani accessions indicated that TaFlo2-A1b was the superior haplotype for TGW. Nevertheless, some accessions that contained TaFlo2-A1a also had high TGW. This is mainly because the effect of TaFlo2-A1 is likely masked by other genes associated with grain size [20]. In wheat, TaFlo2-A1 consists of 23 exons that encode 1734 amino acids with four TPR motifs at the positions of 947 to 988, 1032 to 1072, 944 to 1017 and 1028 to 1106 amino acid residues. Furthermore, three mitochondrial CLU domains were also observed at 737–878, 50–162 and 357–401 amino acid residues (Fig. 1a). The rice OsFlo2 gene also consists of 23 exons and encodes 1720 amino acids with three TPR motifs at the positions of 933–966, 975–1008, and 1017–1050 amino acid residues [27]. However, no mitochondrial CLU was reported in rice FLO2 by She et al. [27]. To confirm the absence of mitochondrial CLU in rice FLO2, we BLASTed the rice FLO2 protein (accession: CAE03171) in an NCBI CD search. The results of the rice FLO2 protein (accession: CAE03171) query using the NCBI CD system showed the presence of two mitochondrial CLU domains at the intervals of 52–124 and 721–863 and four TPRs at the intervals of 932–973, 1017–1057, 929–1002 and 1013–1091 amino acid residues (Fig. 1a). Thus, the prediction of wheat and rice FLO2 protein structure using NCBI CD indicates high similarity between their structures. Flo2 is considered to be a member of a conserved gene family in plants [27]. TaFlo2-A1 is abundantly expressed in flag leaves and in developing grains at 5 DAF stage, and the expression level of the positive haplotype (TaFlo2-A1b) was higher than that of the negative haplotype (TaFlo2-A1a). The phenomenon of higher expression of the positive TaFlo2 haplotype is consistent with the results for rice OsFlo2, in which the overexpression of the positive haplotype significantly increases grain size [27]. In rice, the flo2 mutation in the promoter and in the open reading frame hinders the expression of genes involved in the synthesis of starch and protein [27, 28]. In rice cultivars that have different genetic backgrounds, some flo2 mutations negatively affect grain quality attributes such as amylose content, grain appearance and physiochemical properties despite maintaining or increasing grain size [27, 28]. Based on these similarities between OsFlo2 and TaFlo2-A1 at the sequence, structure and expression levels, the 8-bp InDel mutation in the TaFlo2-A1 promoter likely regulates grain size by affecting the expression of genes involved in the synthesis of starch and protein in wheat grains. Therefore, the increased expression of TaFlo2-A1 has a positive effect on grain yield but may have a negative effect on some grain quality attributes in wheat, which shall need further investigations. The newly developed molecular marker ‘TaFlo2-InDel8’ is an addition to the kit of wheat breeder for marker-assisted selection. This study likely lead to additional investigations to unveil the exact regulatory mechanism of the Flo2 gene in wheat.

Conclusions

The Flo2 orthologs in hexaploid wheat were cloned, and TaFlo2-A1 was found to be associated with TGW but not with grain number per spike (GpS) in both the MCC and Pakistani wheat collections. The frequency of TaFlo2-A1b (positive haplotype) was low in commercial wheat cultivars; thus this haplotype can be selected to improve grain weight. This study likely lead to additional investigations to understand the regulatory mechanism of the Flo2 gene in hexaploid wheat. The newly developed molecular marker ‘TaFlo2-InDel8’ could be incorporated into the kit of wheat breeders for use in marker-assisted selection.
  33 in total

1.  Global selection on sucrose synthase haplotypes during a century of wheat breeding.

Authors:  Jian Hou; Qiyan Jiang; Chenyang Hao; Yuquan Wang; Hongna Zhang; Xueyong Zhang
Journal:  Plant Physiol       Date:  2014-01-08       Impact factor: 8.340

2.  A novel factor FLOURY ENDOSPERM2 is involved in regulation of rice grain size and starch quality.

Authors:  Kao-Chih She; Hiroaki Kusano; Kazuyoshi Koizumi; Hiromoto Yamakawa; Makoto Hakata; Tomohiro Imamura; Masato Fukuda; Natsuka Naito; Yumi Tsurumaki; Mitsuhiro Yaeshima; Tomohiko Tsuge; Ken'ichiro Matsumoto; Mari Kudoh; Eiko Itoh; Shoshi Kikuchi; Naoki Kishimoto; Junshi Yazaki; Tsuyu Ando; Masahiro Yano; Takashi Aoyama; Tadamasa Sasaki; Hikaru Satoh; Hiroaki Shimada
Journal:  Plant Cell       Date:  2010-10-01       Impact factor: 11.277

3.  Three novel alleles of FLOURY ENDOSPERM2 (FLO2) confer dull grains with low amylose content in rice.

Authors:  Yong-Pei Wu; Chieh-Han Pu; Hung-Ying Lin; Hsin-Ya Huang; Ya-Chen Huang; Chwan-Yang Hong; Men-Chi Chang; Yann-Rong Lin
Journal:  Plant Sci       Date:  2014-12-31       Impact factor: 4.729

4.  The wheat (T. aestivum) sucrose synthase 2 gene (TaSus2) active in endosperm development is associated with yield traits.

Authors:  Qiyan Jiang; Jian Hou; Chenyang Hao; Lanfen Wang; Hongmei Ge; Yushen Dong; Xueyong Zhang
Journal:  Funct Integr Genomics       Date:  2010-09-04       Impact factor: 3.410

5.  Advanced backcross QTL analysis in progenies derived from a cross between a German elite winter wheat variety and a synthetic wheat (Triticum aestivum L.).

Authors:  X Q Huang; H Kempf; M W Ganal; M S Röder
Journal:  Theor Appl Genet       Date:  2004-09       Impact factor: 5.699

6.  Quantitative trait loci (QTL) analysis for rice grain width and fine mapping of an identified QTL allele gw-5 in a recombination hotspot region on chromosome 5.

Authors:  Xiangyuan Wan; Jianfeng Weng; Huqu Zhai; Jiankang Wang; Cailin Lei; Xiaolu Liu; Tao Guo; Ling Jiang; Ning Su; Jianmin Wan
Journal:  Genetics       Date:  2008-08-09       Impact factor: 4.562

7.  Identification of QTLs affecting traits of agronomic importance in a recombinant inbred population derived from a subspecific rice cross.

Authors:  J Xiao; J Li; L Yuan; S D Tanksley
Journal:  Theor Appl Genet       Date:  1996-02       Impact factor: 5.699

8.  Polymorphism of TaSAP1-A1 and its association with agronomic traits in wheat.

Authors:  Jianzhong Chang; Jianan Zhang; Xinguo Mao; Ang Li; Jizeng Jia; Ruilian Jing
Journal:  Planta       Date:  2013-03-06       Impact factor: 4.116

9.  IDENTIFICATION OF QTLs ON CHROMOSOME 1B FOR GRAIN QUALITY TRAITS IN BREAD WHEAT (TRITICUM AESTIVUM L.).

Authors:  M Shahzad; S H Khan; A S Khan; M Sajjad; A Rehman; A I Khan
Journal:  Tsitol Genet       Date:  2016 Mar-Apr

10.  Genetic insight into yield-associated traits of wheat grown in multiple rain-fed environments.

Authors:  Xianshan Wu; Xiaoping Chang; Ruilian Jing
Journal:  PLoS One       Date:  2012-02-17       Impact factor: 3.240

View more
  18 in total

1.  A superior allele of the wheat gene TaGL3.3-5B, selected in the breeding process, contributes to seed size and weight.

Authors:  Chaojie Wang; Lili Zhang; Yongdun Xie; Xiaofeng Guo; Yanfang Zhang; Yamin Zhang; Ahsan Irshad; Yuting Li; Huihui Qian; Doudou Jing; Guangyao Liu; Kaiming Wu; Na Yang; Guoli Yang; Yulong Song; Huijun Guo; Huiyan Zhao; Chengshe Wang; Luxiang Liu; Gaisheng Zhang; Shoucai Ma
Journal:  Theor Appl Genet       Date:  2022-04-04       Impact factor: 5.699

2.  Fine mapping and characterization of a major QTL for grain weight on wheat chromosome arm 5DL.

Authors:  Jie Song; Dengan Xu; Yan Dong; Faji Li; Yingjie Bian; Lingli Li; Xumei Luo; Shuaipeng Fei; Lei Li; Cong Zhao; Yong Zhang; Xianchun Xia; Zhongfu Ni; Zhonghu He; Shuanghe Cao
Journal:  Theor Appl Genet       Date:  2022-07-29       Impact factor: 5.574

3.  Genomic Regions From an Iranian Landrace Increase Kernel Size in Durum Wheat.

Authors:  Francesca Desiderio; Leila Zarei; Stefania Licciardello; Kianoosh Cheghamirza; Ezatollah Farshadfar; Nino Virzi; Fabiola Sciacca; Paolo Bagnaresi; Raffaella Battaglia; Davide Guerra; Massimo Palumbo; Luigi Cattivelli; Elisabetta Mazzucotelli
Journal:  Front Plant Sci       Date:  2019-04-18       Impact factor: 5.753

4.  Use of near-isogenic lines to precisely map and validate a major QTL for grain weight on chromosome 4AL in bread wheat (Triticum aestivum L.).

Authors:  Panfeng Guan; Na Di; Qing Mu; Xueyi Shen; Yongfa Wang; Xiaobo Wang; Kuohai Yu; Wanjun Song; Yongming Chen; Mingming Xin; Zhaorong Hu; Weilong Guo; Yingyin Yao; Zhongfu Ni; Qixin Sun; Huiru Peng
Journal:  Theor Appl Genet       Date:  2019-05-22       Impact factor: 5.699

5.  Fine mapping and validation of a major QTL for grain weight on chromosome 5B in bread wheat.

Authors:  Dehui Zhao; Li Yang; Dan Liu; Jianqi Zeng; Shuanghe Cao; Xianchun Xia; Jun Yan; Xiyue Song; Zhonghu He; Yong Zhang
Journal:  Theor Appl Genet       Date:  2021-07-29       Impact factor: 5.699

6.  Global QTL Analysis Identifies Genomic Regions on Chromosomes 4A and 4B Harboring Stable Loci for Yield-Related Traits Across Different Environments in Wheat (Triticum aestivum L.).

Authors:  Panfeng Guan; Lahu Lu; Lijia Jia; Muhammad Rezaul Kabir; Jinbo Zhang; Tianyu Lan; Yue Zhao; Mingming Xin; Zhaorong Hu; Yingyin Yao; Zhongfu Ni; Qixin Sun; Huiru Peng
Journal:  Front Plant Sci       Date:  2018-04-25       Impact factor: 5.753

7.  A wheat protein kinase gene TaSnRK2.9-5A associated with yield contributing traits.

Authors:  Shoaib Ur Rehman; Jingyi Wang; Xiaoping Chang; Xueyong Zhang; Xinguo Mao; Ruilian Jing
Journal:  Theor Appl Genet       Date:  2018-12-05       Impact factor: 5.699

8.  TaDA1, a conserved negative regulator of kernel size, has an additive effect with TaGW2 in common wheat (Triticum aestivum L.).

Authors:  Hong Liu; Huifang Li; Chenyang Hao; Ke Wang; Yamei Wang; Lin Qin; Diaoguo An; Tian Li; Xueyong Zhang
Journal:  Plant Biotechnol J       Date:  2019-12-04       Impact factor: 9.803

9.  SNP-based association study of kernel architecture in a worldwide collection of durum wheat germplasm.

Authors:  Longqing Sun; Sisi Huang; Genlou Sun; Yujuan Zhang; Xin Hu; Eviatar Nevo; Junhua Peng; Dongfa Sun
Journal:  PLoS One       Date:  2020-02-14       Impact factor: 3.240

10.  Mapping Quantitative Trait Loci for 1000-Grain Weight in a Double Haploid Population of Common Wheat.

Authors:  Tao Liu; Lijun Wu; Xiaolong Gan; Wenjie Chen; Baolong Liu; George Fedak; Wenguang Cao; Dawn Chi; Dengcai Liu; Huaigang Zhang; Bo Zhang
Journal:  Int J Mol Sci       Date:  2020-05-31       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.