| Literature DB >> 29033908 |
Daniel A John1, Lisa K Williams1, Venkateswarlu Kanamarlapudi1,2, Thomas J Humphrey1, Thomas S Wilkinson1.
Abstract
Campylobacter remain the major cause of human gastroenteritis in the Developed World causing a significant burden to health services. Campylobacter are pathogens in humans and chickens, although differences in mechanistic understanding are incomplete, in part because phenotypic strain diversity creates inconsistent findings. Here, we took Campylobacter jejuni isolates (n = 100) from multi-locus sequence typed collections to assess their pathogenic diversity, through their inflammatory, cytotoxicity, adhesion, invasion and signaling responses in a high-throughput model using avian and human intestinal epithelial cells. C. jejuni induced IL-8 and CXCLi1/2 in human and avian epithelial cells, respectively, in a MAP kinase-dependent manner. In contrast, IL-10 responses in both cell types were PI 3-kinase/Akt-dependent. C. jejuni strains showed diverse levels of invasion with high invasion dependent on MAP kinase signaling in both cell lines. C. jejuni induced diverse cytotoxic responses in both cell lines with cdt-positive isolates showing significantly higher toxicity. Blockade of endocytic pathways suggested that invasion by C. jejuni was clathrin- and dynamin-dependent but caveolae- independent in both cells. In contrast, IL-8 (and CXCLi1/2) production was dependent on clathrin, dynamin, and caveolae. This study is important because of its scale, and the data produced, suggesting that avian and human epithelial cells use similar innate immune pathways where the magnitude of the response is determined by the phenotypic diversity of the Campylobacter species.Entities:
Keywords: CXCLi1/CXCLi2; Campylobacter jejuni; IL-8; endocytosis; human and avian epithelial cells; invasion; signaling
Year: 2017 PMID: 29033908 PMCID: PMC5626877 DOI: 10.3389/fmicb.2017.01840
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Presence and absence of important virulence factors in Campylobacter jejuni isolates used in this study.
| Gene | Presence % | Absence % |
|---|---|---|
| flaA/flaB | 28.95 | 71.05 |
| flaC | 96.72 | 3.28 |
| flgS | 95.39 | 4.61 |
| flgR | 95.39 | 4.61 |
| fliA | 96.72 | 3.28 |
| cadF | 96.72 | 3.28 |
| pldA | 93.42 | 6.58 |
| peb1A | 97.36 | 2.64 |
| peb3 | 82.23 | 17.77 |
| peb4 | 96.05 | 3.95 |
| ciaB | 94.07 | 5.93 |
| htrA | 97.37 | 2.63 |
| iamA | 96.05 | 3.95 |
| iamB | 96.71 | 3.29 |
| cdtA | 86.85 | 13.15 |
| cdtB | 91.45 | 8.55 |
| cdtC | 88.82 | 11.18 |
| porA | 96.05 | 3.95 |
| fcl | 48.68 | 51.32 |
| hddC | 14.47 | 85.53 |
| rfbC | 51.97 | 48.03 |
| cj0794 | 65.78 | 34.22 |
| cj0859c | 46.71 | 53.29 |
List of 100 strains used in this study.
| Isolate | Species | Clonal complex | Source | IL-8 |
|---|---|---|---|---|
| CAMP45 | ST-45 | Chicken | ||
| CAMP61 | ST-61 | Cattle | ||
| CampsClin11 | ST-45 | Human | High | |
| CampsClin45 | ST-45 | Human | High | |
| CampsClin262 | ST-21 | Human | ||
| CampsClin583 | ST-45 | Human | High | |
| CampsClin266 | ST-21 | Human | ||
| CampsClin883 | ST-21 | Human | High | |
| CampsClin1003 | ST-45 | Human | ||
| Chick2219 | ST-45 | Chicken | ||
| Chicka21 | ST-21 | Chicken | ||
| Cow55 | – | Cattle | ||
| Cow42 | ST-42 | Cattle | ||
| Chick2253 | – | Chicken | ||
| Chick594 | ST-45 | Chicken | ||
| Cow2673 | – | Cattle | ||
| Cow2674 | ST-21 | Cattle | ||
| Cow206 | ST-206 | Cattle | ||
| Cow38 | ST-48 | Cattle | ||
| Cow190 | – | Cattle | ||
| Cow334 | ST-45 | Cattle | ||
| Chicka45 | – | Chicken | ||
| Chick267 | ST-283 | Chicken | ||
| CampsClin230 | ST-45 | Human | ||
| Cowa45 | ST-45 | Chicken | ||
| Chick2213 | ST-45 | Chicken | ||
| Cow518 | ST-21 | Cattle | High | |
| CampsClin53 | ST-21 | Human | ||
| Cow58 | – | Cattle | ||
| Cowa21 | ST-21 | Cattle | ||
| Chickc21 | ST-21 | Chicken | ||
| Chick25 | ST-661 | Chicken | ||
| Chick104 | ST-21 | Chicken | ||
| Chick353 | ST-353 | Chicken | ||
| Chickb354 | ST-354 | Chicken | ||
| Chick573 | ST-573 | Chicken | ||
| Chick2568 | ST-661 | Chicken | ||
| Chickc45 | ST-45 | Chicken | Low | |
| Chick19 | ST-21 | Chicken | Low | |
| Chick50 | ST-21 | Chicken | High | |
| Chick53 | ST-21 | Chicken | Low | |
| Chick262 | ST-21 | Chicken | ||
| Chick266 | ST-21 | Chicken | ||
| Chick861 | – | Chicken | ||
| Chick1086 | ST-21 | Chicken | ||
| Chick1360 | ST-21 | Chicken | ||
| Chick11 | ST-45 | Chicken | ||
| Chick137 | ST-257 | Chicken | High | |
| Chick1003 | ST-45 | Chicken | ||
| Chick2048 | ST-45 | Chicken | ||
| Chick2197 | ST-354 | Chicken | ||
| Chick2223 | ST-45 | Chicken | Low | |
| Cow3583 | ST-42 | Cattle | Low | |
| Cow618 | ST-61 | Cattle | Low | |
| Cow237 | ST-206 | Cattle | High | |
| Cow270 | ST-403 | Cattle | Low | |
| Cowb21 | ST-21 | Cattle | ||
| Cowb45 | ST-45 | Cattle | ||
| Cowc45 | ST-45 | Cattle | ||
| Cowd45 | ST-45 | Cattle | ||
| Cow53 | ST-21 | Cattle | ||
| Cow104 | ST-21 | Cattle | Low | |
| Cow3189 | – | Cattle | High | |
| Cow3201 | ST-21 | Cattle | ||
| Cow3205 | ST-206 | Cattle | ||
| Cow137 | ST-45 | Cattle | ||
| Cow230 | – | Cattle | ||
| Cow583 | ST-45 | Cattle | ||
| Cow3207 | ST-45 | Cattle | High | |
| Cow3214 | ST-45 | Cattle | ||
| Chick354 | ST-257 | Chicken | ||
| Chick51 | ST-443 | Chicken | ||
| Chick1079 | ST-573 | Chicken | Low | |
| Chick574 | ST-574 | Chicken | ||
| Chick814 | ST-661 | Chicken | ||
| Chickb21 | ST-21 | Chicken | ||
| Chickb45 | ST-45 | Chicken | ||
| Chickd45 | ST-45 | Chicken | High | |
| Chick883 | ST-21 | Chicken | ||
| Chick230 | ST-45 | Chicken | ||
| Chick2663 | ST-45 | Chicken | ||
| CampsClin21 | – | Human | High | |
| OxClina21 | ST-21 | Human | ||
| OxClinb21 | ST-45 | Human | Low | |
| OxClina45 | ST-45 | Human | High | |
| OxClinb45 | ST-21 | Human | High | |
| Starling177 | ST-177 | Starling | Low | |
| Starling682 | ST-682 | Starling | Low | |
| Starling45 | ST-45 | Starling | ||
| Starling1020 | ST-682 | Starling | Low | |
| Goose1033 | ST-1034 | Goose | High | |
| Goose702 | – | Goose | Low | |
| Goose137 | ST-45 | Goose | Low | |
| Goose696 | ST-1332 | Goose | Low | |
| Duck702 | ST-702 | Duck | ||
| Duck45 | ST-45 | Duck | Low | |
| CAMP2381 | – | Environmental waters | ||
| NCTC11168 | ST-21 | Human | High | |
| M1 | ST-45 | Human | High |
Primer sequences used in this study.
| Genbank | cDNA | bp | AA | Primer sequence | Annealing T°C | Expected size (Kb) |
|---|---|---|---|---|---|---|
| BC013615.1 | Human IL-8 | 300 | 99 | cagttttgccaaggagtgct | 60 | 73 |
| NM_205018.1 | Chicken CXCLi1 | 315 | 104 | cgattgaactccgatgccag | 59 | 105 |
| NM_205498.1 | Chicken CXCLi2 | 312 | 103 | ggatggaagagaggtgtgct | 59 | 79 |
| NM_000572 | Human IL-10 | 537 | 178 | ggcgctgtcatcgatttctt | 60 | 63 |
| AJ621254.1 | Chicken IL-10 | 528 | 175 | acatccaactgctcagctct | 59 | 142 |
| X00351.1 | Human β-actin | 1128 | 375 | tggcatccacgaaactacct | 60 | 68 |
| L08165.1 | Chicken β-actin | 1128 | 375 | aagatcattgccccacctga | 59 | 100 |
List of Inhibitors used in study.
| Inhibitor | Pathway/mechanism | Reference |
|---|---|---|
| Dynasore (20 μM) | Dynamin – Endocytosis, Dynamin GTPase activity | |
| Filipin (20 μM) | Lipid raft Caveolin pathway Endocytosis | |
| Genistein (20 μM) | Caveolin Endocytosis, tyrosine kinase inhibitor | |
| Chlorpromazine (20 mM) | Clathrin Endocytosis, clathrin misassembly | |
| LY294002 (20 μM) | PI-3 Kinase | |
| InSolutionTM Akt Inhibitor V, Triciribine (20 μM) | Akt | |
| PD98059 (20 μM) | ERK/MEK | |
| Cytochalasin D | Actin polymerization | |
| Methyl β-cytodextrin | Lipid rafts/extraction of cholesterol |