| Literature DB >> 29024365 |
Masao Yamashita1,2, Bart Fraaije1.
Abstract
BACKGROUND: A new generation of more active succinate dehydrogenase (Sdh) inhibitors (SDHIs) is currently widely used to control Septoria leaf blotch in northwest Europe. Detailed studies were conducted on Zymoseptoria tritici field isolates with reduced sensitivity to fluopyram and isofetamid; SDHIs which have only just or not been introduced for cereal disease control, respectively.Entities:
Keywords: Septoria leaf blotch; fluopyram; fungicide resistance; isofetamid; succinate dehydrogenase inhibitor
Mesh:
Substances:
Year: 2017 PMID: 29024365 PMCID: PMC5814837 DOI: 10.1002/ps.4761
Source DB: PubMed Journal: Pest Manag Sci ISSN: 1526-498X Impact factor: 4.845
Primers used to amplify Sdh genes and MgMFS1 promoter inserts
| Primers and sequences (5′–3′) | Target | Size |
|---|---|---|
| SdhAF1: CTGAACCTCTCCACCATCGAC |
| 2077 |
| SdhAR1: CGGCTCTACAATTCTGGGAGAC | ||
| SdhBF1: TAAACACTCCACGCCTCACG |
| 1270 |
| SdhBR1: GTCTTCCGTCGATTTCGAGAC | ||
| SdhCF1: CTACAARAAMGCCAAMCCCAAC |
| 749 |
| SdhCR1: ATGTTGGCACAGAAGCTCAC | ||
| SdhDF1: CGGGAATAACCAACCTCACT |
| 840 |
| SdhDR1: CCTCACTCCTCCAAACCGTA | ||
| MFF1: AAGGTAGGTGAACACCTTATACTC |
| 490 or 1009 |
| MFR1: TTCTTGCTGAAGAAGCGCATGGTTGT |
SdhBF1 primer sequence according Dubos et al.,38 SdhDF1 and SdhDR1 primer sequences reported by Dooley et al.23
Slight differences in amplicon sizes can be obtained due to size difference of introns of Sdh genes or variation in the MgMFS1 promoter insert length.
Figure 1Chemical structures of six SDHIs tested in this study. Fluxapyroxad (1), bixafen (2), penthiopyrad (3), boscalid (4), fluopyram (5) and isofetamid (6).
Sensitivity profiles of laboratory‐generated Sdh mutants and filed isolates of Z. tritici against six SDHIs
| Isolate | Mutation in Sdh subunit | Amino acid substitution | Resistance factor (RF) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Origin | Boscalid | Bixafen | Fluxapyroxad | Penthiopyrad | Fluopyram | Isofetamid | |||
| M38 | B | D129T | lab | 32.3 | 118.1 | 211.2 | 206.4 | 30.8 | 13.7 |
| Iso − 13 | B | P220T | lab | 4.1 | 2.0 | 2.4 | 1.1 | 9.6 | 40.7 |
| M152 | B | S221P | lab | 1.9 | 2.5 | 0.9 | 3.1 | 1.2 | 4.6 |
| M6 | B | R265P | lab | 15.2 | 10.0 | 13.3 | 6.2 | 3.7 | 2.9 |
| M46 | B | R265P | lab | 15.9 | 6.5 | 11.9 | 10.8 | 3.2 | 3.6 |
| 18 − 11 | B | H267Y | lab | > 64 | 13.0 | 34.6 | 26.5 | 0.6 | 0.5 |
| M36 | B | H267Y | lab | > 64 | 22.0 | 48.0 | 40.3 | 1.0 | 0.3 |
| 15‐8 | B | H267L | lab | > 64 | > 363 | > 284 | > 213 | 45.3 | 110.2 |
| V5 − 1 | B | T268I | lab | 5.7 | 9.5 | 15.7 | 13.0 | 2.4 | 4.4 |
| V5 − 12 | B | T268I | lab | 7.5 | 12.2 | 17.2 | 9.8 | 2.9 | 2.8 |
| M62 | B | I269V | lab | 7.4 | 7.4 | 12.4 | 6.6 | 11.2 | 7.3 |
| M96 | B | I269V | lab | 7.7 | 9.3 | 13.4 | 7.8 | 12.4 | 10.1 |
| 20 − 13 | C | T79I | lab | > 64 | > 363 | > 284 | > 213 | 11.0 | 7.2 |
| 16 − 12 | C | S83G | lab | > 64 | > 363 | 207.7 | > 213 | > 51 | 28.1 |
| Flu‐6 | C | A84V | lab | 1.7 | 2.3 | 0.7 | 2.2 | 18.1 | > 174 |
| Iso‐30 | C | L85P | lab | 13.5 | 39.1 | 39.8 | 87.9 | 15.1 | 33.1 |
| M142 | C | N86 K | lab | > 64 | > 363 | > 284 | > 213 | 38.2 | 24.6 |
| 12 − 17 | C | H152R | lab | > 64 | > 363 | > 284 | > 213 | 28.3 | 24.0 |
| V9C‐23 | C | I161S | field | 2.1 | 6.8 | 5.4 | 1.5 | 1.4 | 1.6 |
| V6A‐9 | C | T79 N, V128 M | field | 10.1 | 12.4 | 16.3 | 16.4 | 3.6 | 4.9 |
| M112 | D | D129E | lab | > 64 | 14.9 | 20.8 | 5.9 | 2.5 | 3.6 |
| IPO323 (EC50; mg L−1) | none | field | 0.16 | 0.03 | 0.04 | 0.05 | 0.20 | 0.06 | |
Ratio between EC50 value of each isolate and of IPO323. Owing to dose–response curve‐fitting and/or solubility, 10 mg L−1 was used as the cut‐off value for EC50 determination. Each value is based on the means of two individual EC50 values.
IPO323‐derived laboratory mutant (lab) or UK field isolates collected in Norfolk (V6A‐9) and Wiltshire (V9C‐23) in 2015.
Figure 2Spearman's correlations between six SDHIs for Zymoseptoria tritici isolates with Sdh mutations shown in Table 2 (n = 22). Sensitivity data measured as EC50 (mg L−1) values were expressed with log10 scale. P < 0.05 means the correlation was statistically significant.
Figure 3Sensitivity distribution of French and UK strains of Zymoseptoria tritici to bixafen, fluopyram and isofetamid. Isolates are ranked according increasing EC50 values (cumulative). French strains (n = 65) sampled from untreated plots near Lyon (n = 33) and Orleans (n = 32) in 2015. UK strains (n = 48) sampled from untreated plots at Rothamsted Research (Harpenden) in 2015.
SDHI sensitivity ranges and distributions for French and UK strains isolated in 2015
| Active ingredient | France | UK | ||||
|---|---|---|---|---|---|---|
| EC50 (mg L−1) | W‐test | EC50 (mg L−1) | W‐test | |||
| Range | Median | Range | Median | |||
| Bixafen | 0.017 to 0.406 | 0.063 |
| 0.011 to 0.38 | 0.096 |
|
| Fluopyram | 0.080 to 7.784 | 0.190 |
| 0.089 to 19.51 | 0.215 |
|
| Isofetamid | 0.027 to >50 | 0.090 |
| 0.035 to >50 | 0.096 |
|
Shapiro–Wilk test for normal distribution (log10 scale); P < 0.05 assumed to be not normally distributed.
Sdh variants and fungicide sensitivity profiles of selected field isolates and control strains
| Resistance factor (RF) | Sdh polymorphism | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Fluopyram | Isofetamid | Bixafen | Fluxapyroxad | Chlorothalonil | Fentin Cl | Tolnaftate | Sdh B | Sdh C | Sdh D | |
| Orleans 26 | 38.6 | > 174 | 9.1 | 2.5 | 1.3 | 0.9 | 1.7 | None | N33 T, N34 T | None |
| Lyon 35 | 34.0 | > 174 | 5.6 | 3.1 | 1.3 | 1.0 | 1.5 | None | N33 T, N34 T | None |
| R15 ‐ 46 | 30.5 | > 174 | 3.1 | NT | NT | 1.1 | NT | None | N33 T, N34 T | V106 L |
| Orleans 8 | 23.3 | > 174 | 3.8 | 2.4 | 0.7 | 1.0 | 1.5 | None | None | None |
| Lyon 26 | 15.2 | > 174 | 4.1 | NT | NT | NT | NT | None | None | None |
| Orleans 6 | 10.2 | > 174 | 1.6 | NT | NT | NT | NT | none | N33 T, N34 T | None |
| Lyon 24 | 9.8 | > 174 | 3.3 | 2.0 | NT | NT | NT | none | None | None |
| Orleans 12 | 8.9 | > 174 | 4.0 | NT | 0.8 | 0.8 | 1.2 | None | None | None |
| Orleans 11 | 4.1 | > 174 | 1.6 | NT | NT | NT | NT | None | None | None |
| Lyon 14 | 1.2 | > 174 | 1.2 | 2.7 | NT | NT | NT | None | None | None |
| Orleans 40 | 0.9 | 1.1 | 2.8 | 2.9 | 1.2 | 0.5 | 1.1 | None | None | None |
| Lyon 31 | 0.8 | 1.6 | 2.5 | 2.9 | 1.3 | 0.9 | 1.2 | None | N33 T, N34 T | None |
| Lyon 16 | 2.9 | 4.3 | 13.1 | NT | 1.3 | 6.6 | > 58 | None | N33 T, N34 T | None |
| NT 321.17 | 19.4 | 29.4 | 64.4 | 45.6 | 1.4 | 11.6 | > 58 | None | None | None |
| IPO323 (EC50; mg L−1) | 0.20 | 0.06 | 0.03 | 0.04 | 0.13 | 0.07 | 0.17 | None | None | None |
Values are the means of two independent EC50 determinations. Due to dose response curve‐fitting and/or solubility 10 mg L−1 was used as cut‐off value for EC50 determination.
Ratio between EC50 value of each isolates and reference IPO323.
Not tested.
Figure 4PCR detection of the 519‐bp MgMFS1 promoter insert in Zymoseptoria tritici strains using primers MFF1 and MFR1. Samples of EasyLadder I (Bioline, London, UK) in lanes 1 and 16, products of strains Orleans 26 (lane 2), Lyon 35 (3), R15‐46 (4), Orleans 8 (5), Lyon 26 (6), Orleans 6 (7), Lyon 24 (8), Orleans 12 (9), Orleans 11 (10), Lyon 14 (11), Orleans 40 (12), Lyon 31 (13), Lyon 16 (14), NT321.17 (15), IPO323 (17) and Flu‐6 (18). No amplification for Lyon 24, Lyon 31 and water control (not shown). Largest product (1009 bp) in lane 14 and 15, Lyon 16 and NT321.17, respectively, indicates the presence of 519 bp promoter insert; no insert present in smaller 490 bp product.
Inhibition of mitochondrial succinate dehydrogenase (SDH) activity by different SDHIs in field isolates of Z. tritici shown to be less sensitive to both fluopyram and isofetamid
| IC50 (μM) | RF | |||||
|---|---|---|---|---|---|---|
| Bixafen | Fluopyram | Isofetamid | Bixafen | Fluopyram | Isofetamid | |
| Lyon 35 | 0.038 ± 0.011 | 9.672 ± 3.793 | > 32 | 1.2 | 80.4 | > 640 |
| Orleans 26 | 0.031 ± 0.01 | 3.603 ± 0.994 | > 32 | 0.9 | 30.0 | > 640 |
| R15‐46 | 0.044 ± 0.011 | 12.41 ± 1.322 | > 32 | 1.3 | 103.1 | > 640 |
| Lyon 14 | 0.049 ± 0.013 | 1.053 ± 0.094 | 0.827 ± 0.018 | 1.4 | 8.3 | 16.7 |
| Flu‐6 | 0.106 ± 0.017 | 14.76 ± 1.317 | > 32 | 3.2 | 122.7 | > 640 |
| MM20 | 0.031 ± 0.017 | 0.134 ± 0.067 | 0.046 ± 0.009 | 0.9 | 1.1 | 0.9 |
| IPO323 | 0.033 ± 0.017 | 0.12 ± 0.008 | 0.05 ± 0.002 | 1.0 | 1.0 | 1.0 |
Values ± SD are indicated as means of three independent experiments.
Values are indicated as ratio between means of IC50 (field isolates) and IC50 (IPO323).
In planta control of Z. tritici strains using three different SDHIs
| Application | Control efficacy | |||||
|---|---|---|---|---|---|---|
| dose | MM20 | Lyon 35 | Orleans 26 | R 15‐46 | Lyon 14 | |
| Fluopyram | 100 | 100 | 13 | 71 | 0 | 100 |
| 30 | 100 | 0 | 0 | 0 | 100 | |
| 10 | 98 | 0 | 0 | 0 | 22 | |
| 3 | 66 | 0 | 0 | 0 | 0 | |
| 1 | 35 | 0 | 0 | 0 | 0 | |
| Isofetamid | 100 | 100 | 42 | 0 | 0 | 47 |
| 30 | 100 | 35 | 0 | 0 | 0 | |
| 10 | 87 | 29 | 0 | 0 | 0 | |
| 3 | 68 | 0 | 0 | 0 | 0 | |
| 1 | 31 | 0 | 0 | 0 | 0 | |
| Bixafen | 10 | 100 | 97 | 100 | 100 | 100 |
| 3 | 100 | 51 | 96 | 8 | 77 | |
| 1 | 91 | 31 | 0 | 0 | 22 | |
| Untreated check | — | 10 | 10 | 10 | 10 | 10 |
Values in mg L−1.
Values are indicated as means of three independent experiments.
Means of disease severity (0 − 10) based on area with pycnidia 18 days after inoculation.
Frequency of SDHI‐resistant strains in Z. tritici field populations. Frequencies (%) of low and highly resistant fluopyram, isofetamid and bixafen strains within populations are presented
| Location | Year |
| EC50 (mg L−1) | |||||
|---|---|---|---|---|---|---|---|---|
| Fluopyram | Isofetamid | Bixafen | ||||||
| > 0.5 | > 5.0 | > 0.5 | > 5.0 | > 0.3 | > 3.0 | |||
| Harpenden (UK) | 2003 | 27 | 3.7 | 0 | 7.4 | 7.4 | 0 | 0 |
| 2010 | 39 | 7.7 | 2.6 | 15.4 | 12.8 | NT | NT | |
| 2015 | 46 | 23.9 | 2.2 | 28.3 | 23.9 | 2.2 | 0 | |
| 2017 | 36 | 50 | 11.1 | 33.3 | 30.6 | 19.4 | 0 | |
| Carlow (Ireland) | 2003 | 42 | 7.1 | 0 | 7.1 | 7.1 | 0 | 0 |
| 2017 | 46 | 80.4 | 4.3 | 45.6 | 15.2 | 76.1 | 0 | |
| Middlesborough (UK) | 2003 | 38 | 2.6 | 0 | 2.6 | 2.6 | 0 | 0 |
| Long Ashton (UK) | 2003 | 39 | 10.3 | 0 | 10.3 | 7.7 | 0 | 0 |
| New Zealand | 2004 | 39 | 20.5 | 0 | 23.1 | 20.5 | 0 | 0 |
| New Plymouth (NZ) | 2008 | 24 | 41.7 | 0 | 41.7 | 33.3 | 0 | 0 |
| Lyon (France) | 2015 | 33 | 15.2 | 6.1 | 12.1 | 12.1 | 3 | 0 |
| Orleans (France) | 2015 | 32 | 18.8 | 3.1 | 18.8 | 18.8 | 3.1 | 0 |
Populations were sampled from untreated crops at the same location with exception of the 2004 New Zealand population that contains strains sampled from one location in the North Island and four different locations on the South Island.