Does Sc1-70 modulate collagen production in systemic sclerosis?

Sc1-70, an autoantigen in systemic sclerosis, may accelerate collagen gene transcription by virtue of its activity as a topoisomerase I (topo I), a DNA template-modifying enzyme. A survey of sequences corresponding to all or part of the known topo I binding sequence AGAACTTAGAGAAAATTTAAA in four fibrillar collagen genes (three of them dermal) and sixteen non-collagen genes showed a striking preponderance of the tetramer 5'-CTTA-3', comprising the core of this binding sequence, at the exon-intron junctions of the fibrillar collagen genes (59% compared with 16% in the control group). In addition, a non-random clustering of three potential topo I binding sites was seen within 350 base-pairs of 5' flanking DNA in the dermal collagen gene alpha 2(I), and a fourth site occurred in the promoter region of the alpha 1(III) gene. The findings suggest that a selective vulnerability to the action of Sc1-70/topo I is built into the structure of the dermal collagen genes.