Literature DB >> 28993549

Isolation of equine papillomavirus type 1 from racing horse in Japan.

Jianbao Dong1,2,3, Wei Zhu1,2,3, Nanako Yamashita2, James K Chambers4, Kazuyuki Uchida4, Atsutoshi Kuwano5,6, Takeshi Haga2.   

Abstract

Although many studies have been conducted worldwide for Equus caballus papillomavirus (EcPV), limited information is available on the virus in Japan. We recently collected one classical viral papillomatosis sample (E150904) from a racing horse in Japan. Papillomavirus infection was confirmed by histopathology, immunohistochemistry and PCR assays, and the sample was diagnosed as epithelial papilloma. Full-length genome of the virus was cloned and sequenced. It was 7,613 bp in length and had the same genome organization with reported EcPV-1. Moreover, phylogenetic analysis based on L1 gene revealed that the infection was caused by a variant of EcPV-1. This is the first report of EcPV infection in Japan, and would further contribute to the molecular epidemiological and pathological studies for EcPV.

Entities:  

Keywords:  EcPV type 1; equine papillomatosis; initial detection; racing horse

Mesh:

Year:  2017        PMID: 28993549      PMCID: PMC5745171          DOI: 10.1292/jvms.17-0322

Source DB:  PubMed          Journal:  J Vet Med Sci        ISSN: 0916-7250            Impact factor:   1.267


Equus caballus papillomavirus (EcPV, also named equine papillomavirus) is associated with diseases in horse including classical viral papillomatosis, genital papillomas/papillomatosis, and aural plaques [9]. Papillomaviruses (PVs) have strict tissue specificity, thus each of these diseases is associated with a different type of PVs. To date 7 types of EcPV have been identified and are classified into 3 genera according to the nucleotide sequence diversity in the open reading frame (ORF) of the L1 gene [5, 9]. EcPV type 1 (EcPV-1) was first isolated from cutaneous papillomas [3, 6]. So far all EcPV-1 have been reported to be associated with the classical papillomatosis which is a typical benign proliferative lesion and usually transient in young horses younger than 3 years [3, 6, 7, 9]. EcPV-2 and EcPV-7 were found in genital papillomas/papillomatosis [4, 5, 8], while EcPV-3, -4, -5 and -6 were detected in aural plaques [2, 4, 5, 7]. Although many studies for EcPV have been conducted worldwide since the first EcPV was identified in 1986 [6], limited information is available on EcPV in Japan. Therefore, this study aimed to investigate the presence of EcPVs in Japan. We recently collected one classical viral papillomatosis sample (E150904) from a racing horse (Thoroughbred, colt, 2 years old) in Japan. E150904 was one of the 10 millet or rice grain sized papillomas located on the muzzle of the animal. DNA was extracted with the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. One pair of oligonucleotide primer EcPVF/EcPVR (5′-CCDGCHHTBGGNGAGTAYTGG-3′/5′-TGCCAGCANARNCCATTGTT-3′) was designed according to the published genome sequences of EcPVs (GenBank access number: AF394740, AF498323, NC003748, HM461973, NC012123, NC017862, NC020085, NC020084, NC020500 and NC020501) to amplify 502 base pair (bp) segment of L1 gene. The amplification of the primer set was carried out using an initial denaturation at 94°C for 5 min followed by 35 cycles of 94°C for 30 sec, 50°C for 30 sec, 72°C for 40 sec, and a final extension of 72°C for 10 min. The sample E150904 show positive by PCR. The 502 bp PCR product was cloned and sequenced. The sequence analysis using BLAST demonstrated 97.4% nucleotide identity with EcPV-1 (NC003748) [3], suggesting that the papillomatosis was associated with EcPV-1 infection. Tissue sample of E150904 was fixed with 10% formalin and routinely embedded in paraffin. Sections were stained with haematoxylin and eosin for histopathological examination. For immunohistochemistry, mouse anti-papillomavirus antibody (clone BPV-1/1H8 + CAMVIR, Abcam, Cambridge, U.K.) was used for primary antibody, and horseradish peroxidase labeled detection kit (Envision+ System, Dako Japan, Kyoto, Japan) was used. Antigen-antibody complex were visualized using 3,3′- diaminobenzidine. Sections were counterstained with haematoxylin. For negative control, primary antibody was substituted with Tris-buffered saline. The neoplasm consisted of hyperkeratotic squamous epithelial cells arranged in papillary pattern. Pale basophilic intranuclear inclusion bodies were observed occasionally in epithelial cells; the inclusion bodies were strongly positive for BPV antigens by immunohistochemistry (Fig. 1). Based on these histopathological characteristics and the presence of PV antigens, the neoplastic mass was diagnosed as epithelial papilloma associated with papillomavirus infection.
Fig. 1.

Histopathological and immunohistochemical findings. (a and b) Haematoxylin and eosin stain. (b) a higher magnification of the boxed part of (a). (c) PV immunostaining. The neoplasm consists of papillary growth of squamous epithelium (a). There are intranuclear inclusion bodies (b) that are immunopositive for PV antigen (arrow). Bar=100 µm (a); 50 µm (b and c).

Histopathological and immunohistochemical findings. (a and b) Haematoxylin and eosin stain. (b) a higher magnification of the boxed part of (a). (c) PV immunostaining. The neoplasm consists of papillary growth of squamous epithelium (a). There are intranuclear inclusion bodies (b) that are immunopositive for PV antigen (arrow). Bar=100 µm (a); 50 µm (b and c). Full-length genome sequences were amplified from the sample E150904 by using 5 pairs of oligonucleotide primer (Table 1) which designed according to published EcPV-1 genome sequences [3]. Subsequently, PCR products were purified using a QIAquick gel extraction kit (Qiagen). Five overlapping fragments were cloned into pMD20-T (Takara, Otsu, Japan) and then sequenced respectively. To reconstitute the full-length genome sequence, overlapping sequences were assembled into contiguous sequences using Seqman DNASTAR software (Lasergene) (DNASTAR, Madison, WI, U.S.A.). The sequence of the whole genome of EcPV-1 from E150904 had 7,613 bp (GenBank MF288893), shared 99.7% nucleotide identity with 3 PVs of EcPV-1 (AF394740, NC003748 and AF498323) reported so far, and had the same genome organization with them. The whole EcPV-1 genome of previously reported was either 7,610 bp (NC003748 and AF498323) or 7,613 bp (AF394740) in length. The difference of three nucleotides (GCG) exists within coding regions of L2, resulting in one amino acid (alanin) insertion or deletion. In the present study, EcPV1 from E150904 revealed to have the same insertion of alanin in L2 (the insertion located in 5,169–5,171 nt in whole genome and 1,404–1,406 nt in L2 gene). Moreover, L1 gene shared 99.5% (AF394740) and 99.6% (NC003748 and AF498323) nucleotide identity with reported EcPV-1. According to PV taxonomy following the general criteria established by the International Committee on the Taxonomy of Viruses (ICTV), a PV is recognized as a variant if the complete genome has been cloned and the DNA sequence of the L1 ORF differs less than 2% homology with the closest known PV type [1]. Based on this criterion, it is concluded that the PV from E150904 is a variant of EcPV-1.
Table 1.

Oligonucleotides for whole genome amplification and cloning

NameSequence Location (NC003748)Predict length
EcPV1clone1FCCTGGGGACGGTTCGCATTT6,550–6,5691,788
EcPV1clone1RGCATCTCTCACAGGCGTACC708–727
EcPV1clone2FGCCGTGTGTACCGTCTGCTG545–5642,148
EcPV1clone2RCCTGCTTTGCCTGTGATTGG2,673–2,692
EcPV1clone3FCGATGGGAGTCCTGTTTACC2,375–2,3941,533
EcPV1clone3RCCACCTTGTTTACAACGTCC3,888–3,907
EcPV1clone4FCCTTTACCCTAACCCCCTCCT3,680–3,7001,721
EcPV1clone4RGCACCCGCATGGTTTGGTCAC5,380–5,400
EcPV1clone5FGTTGATAGTCCAGACACCTCG5,110–5,1301,660
EcPV1clone5RCATCAGGCAAGAACGAGCAGG6,749–6,769
In the present study, the EcPV-1 was isolated from a racing horse whose age is less than 3 years, in accordance with the conclusion that viral classical papillomatosis typically affects horses younger than 3 years [9]. Moreover, the racing horse was born and growing up in Japan without any travel overseas. Therefore, it suggested that the infection was occurred in Japan. Further studies are required to determine whether EcPV-1 exist in local horse herd. This study is the first report of EcPV infection in Japan, and would further contribute to the molecular epidemiological and pathological studies for EcPV.
  9 in total

1.  The electron microscopic and immunohistochemical demonstration of a papillomavirus in equine aural plaques.

Authors:  R A Fairley; D M Haines
Journal:  Vet Pathol       Date:  1992-01       Impact factor: 2.221

2.  Equus caballus papillomavirus-2 (EcPV-2): an infectious cause for equine genital cancer?

Authors:  T Scase; S Brandt; C Kainzbauer; S Sykora; S Bijmholt; K Hughes; S Sharpe; A Foote
Journal:  Equine Vet J       Date:  2010-11       Impact factor: 2.888

3.  Evaluation of equine papillomas, aural plaques, and sarcoids for the presence of Equine papillomavirus DNA and Papillomavirus antigen.

Authors:  Rosemary C Postey; Greg D Appleyard; Beverly A Kidney
Journal:  Can J Vet Res       Date:  2007-01       Impact factor: 1.310

4.  Cloning and characterization of an equine cutaneous papillomavirus.

Authors:  M K O'Banion; M E Reichmann; J P Sundberg
Journal:  Virology       Date:  1986-07-15       Impact factor: 3.616

5.  Identification of two novel equine papillomavirus sequences suggests three genera in one cluster.

Authors:  Christian E Lange; Kurt Tobler; Mathias Ackermann; Claude Favrot
Journal:  Vet Microbiol       Date:  2010-11-04       Impact factor: 3.293

6.  Equine papillomavirus type 1: complete nucleotide sequence and characterization of recombinant virus-like particles composed of the EcPV-1 L1 major capsid protein.

Authors:  Shin-Je Ghim; Annabel Rector; Hajo Delius; John P Sundberg; A Bennett Jenson; Marc Van Ranst
Journal:  Biochem Biophys Res Commun       Date:  2004-11-19       Impact factor: 3.575

7.  Four novel papillomavirus sequences support a broad diversity among equine papillomaviruses.

Authors:  Christian E Lange; Elisabeth Vetsch; Mathias Ackermann; Claude Favrot; Kurt Tobler
Journal:  J Gen Virol       Date:  2013-03-13       Impact factor: 3.891

Review 8.  Classification of papillomaviruses.

Authors:  Ethel-Michele de Villiers; Claude Fauquet; Thomas R Broker; Hans-Ulrich Bernard; Harald zur Hausen
Journal:  Virology       Date:  2004-06-20       Impact factor: 3.616

Review 9.  Papillomavirus-associated diseases.

Authors:  Sheila M F Torres; Sandra N Koch
Journal:  Vet Clin North Am Equine Pract       Date:  2013-10-01       Impact factor: 1.792

  9 in total
  2 in total

1.  First detection and complete genome analysis of the Lyon IARC polyomavirus in China from samples of diarrheic cats.

Authors:  Yuying Li; Haixin Huang; Tian Lan; Wei Wang; Jie Zhang; Min Zheng; Liang Cao; Wenchao Sun; Huijun Lu
Journal:  Virus Genes       Date:  2021-05-10       Impact factor: 2.332

2.  Equus caballus Papillomavirus Type-9 (EcPV9): First Detection in Asymptomatic Italian Horses.

Authors:  Livia De Paolis; Chiara Grazia De Ciucis; Simone Peletto; Katia Cappelli; Samanta Mecocci; Tiziana Nervo; Lisa Guardone; Maria Ines Crescio; Daniele Pietrucci; Floriana Fruscione; Federica Gabbianelli; Silvia Turco; Katia Varello; Gian Guido Donato; Cristiana Maurella; Paola Modesto; Maria Grazia Maniaci; Giovanni Chillemi; Alessandro Ghelardi; Elisabetta Razzuoli
Journal:  Viruses       Date:  2022-09-15       Impact factor: 5.818

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.