Literature DB >> 28989825

Fungus-specific SSR markers in the Antarctic lichens Usnea antarctica and U. aurantiacoatra (Parmeliaceae, Ascomycota).

Elisa Lagostina1, Francesco Dal Grande2, Sieglinde Ott3, Christian Printzen1.   

Abstract

PREMISE OF THE STUDY: Usnea antarctica and U. aurantiacoatra (Parmeliaceae) are common lichens in the maritime Antarctic. These species share the same habitats on King George Island (South Shetland Islands, Antarctica) and are distinguishable based on reproductive strategies. METHODS AND
RESULTS: We developed 23 fungus-specific simple sequence repeat (SSR) markers that cross-amplify between the two species. We used a low-coverage genome-skimming approach on one sample of each species to identify SSR repeats in the two species. Primers were designed for 3-4-bp repeats, and only the loci common to both species were selected for further analyses. Seventy-seven samples of the two species were selected to assess fungal specificity, genetic variability, and linkage of the markers. In addition, we tested cross-amplification in other Usnea species.
CONCLUSIONS: The 23 newly designed SSR markers are suitable for population genetic and phylogeographic studies of Usnea species.

Entities:  

Keywords:  Antarctic lichens; Parmeliaceae; Usnea antarctica; Usnea aurantiacoatra; microsatellites

Year:  2017        PMID: 28989825      PMCID: PMC5628029          DOI: 10.3732/apps.1700054

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Lichens constitute an important component of Antarctic terrestrial biota. The most common lichen species in the maritime Antarctic are Usnea aurantiacoatra (Jacq.) Bory and U. antarctica Du Rietz (Lecanoromycetes, Parmeliaceae). The two species occupy similar habitats but show different dispersal strategies, morphology, and distribution. Usnea antarctica usually propagates asexually by so-called soredia, while U. aurantiacoatra has apothecia and its thalli are usually larger. Usnea antarctica is reported to be circumpolar and to have the widest ecological amplitude and distribution of any Antarctic macrolichen (Øvstedal & Lewis Smith, 2001), while U. aurantiacoatra is absent from the continental Antarctic. Phylogenetic analysis, performed on several Southern Hemisphere Usnea Dill. ex Adans. species, showed that the two species are closely related, and they are considered a single group. Some authors have suggested that the two species might constitute a species pair, in which U. aurantiacoatra represents the fertile and U. antarctica the sterile counterpart, but phylogenetic studies indicated that they could be conspecific (Wirtz et al., 2012). Here, we developed highly variable microsatellite loci to better understand the genetic differences between the two lichen species and to investigate gene flow between maritime Antarctica and South America.

METHODS AND RESULTS

Total genomic DNA was extracted from a thallus of U. antarctica from population C1 and from one thallus of U. aurantiacoatra from a population that was not included in the later primer design (Appendix 1) from King George Island, Antarctica, in the austral summer of 2015/2016. Twenty milligrams of thallus were pretreated with acetone to remove secondary metabolites and ground with liquid nitrogen using a sterilized mortar and pestle. DNA was extracted using a modified cetyltrimethylammonium bromide (CTAB) protocol (Cubero and Crespo, 2002). Paired-end libraries (300 bp) were prepared and sequenced on a MiSeq version 3 (2 × 300-bp) Illumina sequencer (LGC Genomics GmbH, Berlin, Germany). We obtained 3,098,758 raw reads for U. antarctica and 1,755,882 for U. aurantiacoatra. Raw data were adapter-, quality- (PHREAD = 26), and length- (>150 bp) filtered using Trimmomatic version 0.35 (Bolger et al., 2014). Forward and reverse reads were assembled with Paired-End reAd mergeR (PEAR) software (Zhang et al., 2014). The resulting overlapping, paired, and singleton reads were then assembled with SPAdes version 3.9 (Nurk et al., 2013). Scaffolds were taxonomically binned using Metawatt (Strous et al., 2012). Scaffolds assigned to the phylum Ascomycota were used to search for mycobiont-specific microsatellite motifs. Simple sequence repeat (SSR) motifs repeated at least six times were searched in both genomes with the MIcroSAtellite Identification Tool (MISA) (Thiel et al., 2003), and primers were designed for 3–4-bp repeats using the Primer3 plugin in Geneious 10 (Kearse et al., 2012). A total of 150 SSRs were identified in the two species. Each repeat from one genome was BLASTed against the other genome. Due to the partial coverage of both genomes, only 30 SSRs were found to share the same flanking regions in silico. We designed primers for these 30 markers and tested them on four samples of U. antarctica and U. aurantiacoatra in single touchdown PCR reactions. After sequencing we selected 23 markers (Table 1) with perfectly matching flanking regions to be tested in multiplex reactions and on algal pure cultures to confirm that they were fungal specific. The remaining seven markers were excluded because of insertions and/or deletions in the flanking regions.
Table 1.

Characteristics of 23 fungus-specific SSR primers developed for Usnea antarctica and U. aurantiacoatra.

LocusPrimer sequences (5′–3′)Repeat motifTailbFluorescent dyeAllele size range (bp)cNo. of SSR repeatsAMultiplexGenBank accession no.
Ua1F: GCATCTGGGCTCTTGGACTT (CTT)n A FAM 235–271 3–15 9 1 KY940723
R: CATTTGCAGGCAGTCCATCG
Ua2F: GGGATAACTCGCTATGGCCC (CTT)n B VIC 256–283 6–15 9 1 KY940724
R: ACACCCTGATCGATCAAACCA
Ua3F: AAGCACACGCAAAGCTTCAG (CTG)n C NED 248–275 4–13 6 1 KY940725
R: CGGAGGTCTGAATGTCGGAG
Ua4F: CTTTCACTGTCCTGCCCTGT (CCT)n D PET 277–304 2–13 10 1 KY940726
R: GAGACCCCGTGTCCAATCAG
Ua5F: GGAAGGGGAAGGGGAGAGAT (CTT)n A FAM 555–573 8–14 4 1 KY940727
R: GGTGGGCAACTGGAATGGTA
Ua6F: TTGAGCCGCCACAAGAGATT (AAG)n B VIC 337–349 4–8 5 1 KY940728
R: ATCGGCCAATTGATACCCCG
Ua7F: AAGACGGACATTCCACCACC (GGA)n D PET 552–573 2–9 5 1 KY940729
R: ACCGCTCTGGCTACCTCTTA
Ua8F: AAGAAGCCAGCTTTGACGGA (TGT)n A FAM 393–402 6–9 4 1 KY940730
R: GCTTGTCTCAGGCAGGATGA
Ua9F: AACGGAGCTTCCTTCCATTGA (CATC)n A FAM 285–297 8–11 4 2 KY940731
R: ACAACACAGACAACCCCGAA
Ua10F: GACTTTACGGCCCACATCCA (AGA)n B VIC 284–314 4–14 8 2 KY940732
R: TTTCCATGTGGCTTGGAGGG
Ua11F: TCGCATTATTCGTGCAAGCG (TATG)n C NED 254–274 5–10 6 2 KY940733
R: GTAATATCCGCTCGCCCACA
Ua12F: AGGCGCTGTGTGAGAACC (CGAA)n D PET 232–256 3–9 6 2 KY940734
R: AGCAAGACCAAGAAGGCGAG
Ua13F: CCAAGCCAACCTCAGACCAT (CAG)n A FAM 393–408 4–9 6 2 KY940735
R: CGACGTCTCCTTCCATAGCC
Ua14F: GTCAGCCCATCTACCGTACG (GAA)n B VIC 386–419 5–16 8 2 KY940736
R: TGGGTTGGGAAAGGAAGTGT
Ua15F: CGCAAACAGTACAACCGGAA (GCT)n C NED 341–347 5–7 3 2 KY940737
R: GCCACAACAAAGGTGACGAC
Ua16F: GTTTGGAAGACCACCGGCTA (AGT)n D PET 334–355 10–17 6 2 KY940738
R: CCAAGCACACCCTGACATCT
Ua17F: ATGACGTGCTGTAGGTGTGG (CTGGTA)n A FAM 403–415 4–6 3 3 KY940739
R: GTGTCAAGTGTCGAGCAGGA
Ua18F: AGGGAGTTCTGCAGGGGATA (GAA)n B VIC 355–388 6–17 6 3 KY940740
R: AGTGATTGATGCTCCGGTGG
Ua19F: AGCCATTTTTCCGAGGTCGT (GAC)n C NED 349–367 6–12 4 3 KY940741
R: GCTTTGTTGCGCTTCACTGA
Ua20F: GATCACTCTTCGAGCTCCCG (AAGC)n D PET 405–421 6–10 5 3 KY940742
R: CCAGAGTACCTTCCGTTGCA
Ua21F: TTCCCGAGCTCCAATCACAC (TCC)n A FAM 260–272 7–11 5 3 KY940743
R: CCATATCCCGTCCTCGCAAA
Ua22F: TGGTCCACTTTAGCCAGTCAT (ATG)n C NED 272–290 8–14 6 3 KY940744
R: TCTGCCCTTGACATCTTTGACA
Ua23F: TAGTGCGAGGCCTGATGTTC (CTT)n D PET 244–253 6–9 3 3 KY940745
R: ACCGAAAAGGCTTGGACGAT

Note: A = number of alleles.

Melting temperature (Tm) for all primers ranged from 59.1°C to 60.3°C.

Tails attached to the forward primers: A = GCCTCCCTCGCGCCA, B = GCCTTGCCAGCCCGC, C = CAGGACCAGGCTACCGTG, D = CGGAGAGCCGAGAGGTG.

The range includes the size of the tail.

Characteristics of 23 fungus-specific SSR primers developed for Usnea antarctica and U. aurantiacoatra. Note: A = number of alleles. Melting temperature (Tm) for all primers ranged from 59.1°C to 60.3°C. Tails attached to the forward primers: A = GCCTCCCTCGCGCCA, B = GCCTTGCCAGCCCGC, C = CAGGACCAGGCTACCGTG, D = CGGAGAGCCGAGAGGTG. The range includes the size of the tail. A fluorescent dye–associated tag was attached to the forward primers. Four different tails were selected to multiplex the reactions (FAM: GCCTCCCTCGCGCCA, VIC: GCCTTGCCAGCCCGC, NED: CAGGACCAGGCTACCGTG, PET: CGGAGAGCCGAGAGGTG) (Blacket et al., 2012). PCRs were performed in 25-μL reactions using illustra PuReTaq Ready-To-Go PCR Beads (GE Healthcare Life Sciences, Little Chalfont, Buckinghamshire, United Kingdom) according to the manufacturer’s protocol with the following touchdown conditions: initial hot start at 94°C for 15 min; five cycles of 94°C for 45 s, 65°C for 45 s, 72°C for 45 s; five cycles of 94°C for 45 s, 60°C for 45 s, 72°C for 45 s; 10 cycles of 94°C for 45 s, 57°C for 45 s, 72°C for 45 s; 20 cycles of 94°C for 45 s, 55°C for 45 s, 72°C for 45 s; and final elongation at 72°C for 15 min. The PCR products were sent to Macrogen Europe (Amsterdam, The Netherlands) for sequencing to check the stability of the flanking regions in both species. To confirm that the chosen SSRs are indeed fungal loci, the primers were also tested on four axenic cultures of Trebouxia jamesii (Hildreth and Ahmadjian) Gärtner isolated from U. antarctica, U. aurantiacoatra, U. lambii (Imshaug) Wirtz & Lumbsch, and U. trachycarpa (Stirt.) Müll. Arg. (Appendix 1). The PCRs were performed under the same conditions as above, and no amplifications were observed. After fungal specificity of the primers was confirmed, 77 samples from two populations of U. antarctica and U. aurantiacoatra (sampled in the same areas on King George Island) were chosen to evaluate the variability of the markers. All samples were tested with multiplexed PCRs of seven to eight markers with the Type-it Multiplex Kit (QIAGEN, Hilden, Germany). PCR reactions were conducted in 10-μL volumes containing 1.5 μg of genomic DNA, 5 μL of PCR Master Mix, and 3 μL of primer multiplex (0.25 μM of each forward primer and fluorescent dye, 0.125 μM of each reverse primer). PCR products were amplified using the same touchdown program as above. PCR amplicons were electrophoresed using an Applied Biosystems 3730 platform, with the LIZ 600 Size Standard (Applied Biosystems, Foster City, California, USA), and allele sizes were manually scored using the Geneious 10 microsatellite tool (Kearse et al., 2012). The variability of each microsatellite locus was measured by counting the number of alleles and calculating Nei’s unbiased gene diversity using GenAlEx 6.5 (Peakall and Smouse, 2012). All of the 23 markers amplified in both species. In U. aurantiacoatra, all of the SSR markers were polymorphic, while five were monomorphic in U. antarctica (Table 2).
Table 2.

Allelic richness and genetic diversity of SSR loci in four populations of Usnea spp. collected on King George Island.

Total (n = 77)U. antarctica (C1; n = 20)U. antarctica (P3; n = 19)U. aurantiacoatra (C1; n = 20)U. aurantiacoatra (P3; n = 18)
Locusnmean AHenAHenAHenAHenAHe
Ua1765.30.662030.361940.611960.611880.90
Ua2775.30.752040.711950.762060.761860.78
Ua3772.50.382020.101930.372030.371820.50
Ua4745.50.732050.721950.781750.781870.77
Ua5771.80.082010.001920.112010.111830.22
Ua6772.50.222020.191920.282030.281830.22
Ua7702.30.192020.191930.201420.201720.22
Ua8772.30.162010.001910.002040.001830.22
Ua9762.50.532020.441920.461930.461830.66
Ua10764.50.451940.301920.112050.111870.75
Ua11774.30.682060.791950.752030.751830.62
Ua12762.80.321910.001910.002040.001850.61
Ua13762.80.312010.001910.001940.001850.56
Ua14764.80.731940.731960.822050.821840.73
Ua15771.50.052010.001910.002010.001830.22
Ua16772.50.322020.101910.002040.001830.66
Ua17753.00.541930.291830.652030.651830.57
Ua18773.00.572040.571920.492030.491830.60
Ua19771.50.052020.101910.002010.001820.11
Ua20772.50.322030.591930.372020.371820.11
Ua21773.80.632040.591940.592030.591840.70
Ua22772.00.222020.191920.202010.201830.50
Ua23771.80.212010.001910.002020.001830.46
Mean3.050.402.610.302.610.333.220.333.780.51

Note: A = number of alleles; He = Nei’s unbiased gene diversity; n = total number of samples.

Locality data for populations can be found in Appendix 1.

Allelic richness and genetic diversity of SSR loci in four populations of Usnea spp. collected on King George Island. Note: A = number of alleles; He = Nei’s unbiased gene diversity; n = total number of samples. Locality data for populations can be found in Appendix 1. Linkage disequilibrium was tested with GENEPOP (Raymond and Rousset, 1995; Rousset, 2008) twice: separately for each species to estimate P values and with the two species together to perform a global test (Fisher’s method) for each pair of loci across populations and species. Holm-Bonferroni correction (Holm, 1979) of the P values resulting from the last test using the implementation by Gaetano (2013) revealed significant evidence for linkage disequilibrium between loci Ua3, Ua4, and Ua6 (Ua3–Ua4: P = 0.001, Ua3–Ua6: P = 0.006, Ua4–Ua6: P = 0.0). Cross-species amplification was tested on DNA extracts of U. sphacelata R. Br. and U. trachycarpa, two related species from Usnea subgenus Neuropogon (Nees & Flotow) Jatta (Truong et al., 2013). First, we tested a population of eight samples of U. sphacelata with the multiplex protocol. To verify the identity and stability of the flanking regions, we then selected two samples with different peaks for single PCR amplification and sequencing. The multiplex analysis was omitted for U. trachycarpa. Thirteen markers showed the same flanking regions in all three species, five markers had deletions and/or insertions in the flanking regions in U. sphacelata and U. trachycarpa, and for four markers the PCRs failed. Marker Ua18 shared the flanking region only with U. sphacelata, while it had a deletion in U. trachycarpa (Table 3).
Table 3.

Cross-amplification of SSR markers developed for Usnea antarctica and U. aurantiacoatra with related species of Usnea subgenus Neuropogon.

SpeciesUa1Ua2Ua3Ua4Ua5Ua6Ua7Ua8Ua9Ua10Ua11Ua12Ua13Ua14Ua15Ua16Ua17Ua18Ua19Ua20Ua21Ua22Ua23
U. sphacelata+++DD++++++D+++D+D+
U. trachycarpa+++DD++++++D+D+D+D+

Note: + = SSRs present; — = PCR failed; D = deletion/insertion within the flanking region.

Cross-amplification of SSR markers developed for Usnea antarctica and U. aurantiacoatra with related species of Usnea subgenus Neuropogon. Note: + = SSRs present; — = PCR failed; D = deletion/insertion within the flanking region.

CONCLUSIONS

The markers developed here are suitable to study population structure and gene flow in U. antarctica and U. aurantiacoatra. The markers shared the same flanking regions in the two species and showed high variability even within a small geographic area. Nineteen of these microsatellite primers also cross-amplify in related species from Usnea subgenus Neuropogon; however, the flanking regions of some markers are less stable. The usability of the newly developed SSR markers for cross-amplification in other Usnea species therefore requires further validation using a broader taxon sampling and a higher number of replicates per species. We conclude that the newly developed SSR markers presented here can be used to infer gene flow within Southern Hemisphere lichen populations and resolve connectivity patterns among populations of U. antarctica and U. aurantiacoatra.
Appendix 1.

Locality and collection data for Usnea samples used in this study.

Species (Population)nGeographic coordinatesLocality dataCollector (Collection year)Voucher no. (Herbarium)a
U. antarctica Du Rietz (C1)2062°14.220′S, 58°39.492′WKing George Island, AntarcticaLagostina, Kanz (2015)FR-0264579 (FR)
U. antarctica (P3)1962°15.174′S, 58°38.971′WKing George Island, AntarcticaLagostina, Kanz (2015)FR-0264581 (FR)
U. aurantiacoatra (Jacq.) Bory (C1)2062°14.220′S, 58°39.492′WKing George Island, AntarcticaLagostina, Kanz (2015)FR-0264584 (FR)
U. aurantiacoatra (P3)1862°15.174′S, 58°38.971′WKing George Island, AntarcticaLagostina, Kanz (2015)FR-0264586 (FR)
U. aurantiacoatra162°14.363′S, 58°39.202′WKing George Island, AntarcticaLagostina, Kanz (2015)FR-0264585 (FR)
U. sphacelata R. Br.479°17′N, 16°04′WSpitsbergen, SvalbardTønsberg (2002)BG-L94105 (BG)
U. sphacelata464°45′N, 18°15′WCentral Highland, IcelandHeiđmarsson (2002)Heiđmarsson 28916 (F)
U. trachycarpa (Stirt.) Müll. Arg.254°58.257′S, 67°38.004′WIsla Navarino, ChilePrintzen (2017)FR-0264590 (FR)

Note: n = number of individuals tested.

Vouchers are deposited in the Herbarium Senckenbergianum Frankfurt (FR), Frankfurt am Main, Germany; University Museum of Bergen (BG), Bergen, Norway; and the Field Museum of Natural History (F), Chicago, Illinois, USA.

  9 in total

1.  Universal primers for fluorescent labelling of PCR fragments--an efficient and cost-effective approach to genotyping by fluorescence.

Authors:  M J Blacket; C Robin; R T Good; S F Lee; A D Miller
Journal:  Mol Ecol Resour       Date:  2012-01-24       Impact factor: 7.090

2.  genepop'007: a complete re-implementation of the genepop software for Windows and Linux.

Authors:  François Rousset
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

3.  Testing the use of ITS rDNA and protein-coding genes in the generic and species delimitation of the lichen genus Usnea (Parmeliaceae, Ascomycota).

Authors:  Camille Truong; Pradeep K Divakar; Rebecca Yahr; Ana Crespo; Philippe Clerc
Journal:  Mol Phylogenet Evol       Date:  2013-04-16       Impact factor: 4.286

4.  Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.).

Authors:  T Thiel; W Michalek; R K Varshney; A Graner
Journal:  Theor Appl Genet       Date:  2002-09-14       Impact factor: 5.699

5.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

6.  The binning of metagenomic contigs for microbial physiology of mixed cultures.

Authors:  Marc Strous; Beate Kraft; Regina Bisdorf; Halina E Tegetmeyer
Journal:  Front Microbiol       Date:  2012-12-05       Impact factor: 5.640

7.  Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.

Authors:  Matthew Kearse; Richard Moir; Amy Wilson; Steven Stones-Havas; Matthew Cheung; Shane Sturrock; Simon Buxton; Alex Cooper; Sidney Markowitz; Chris Duran; Tobias Thierer; Bruce Ashton; Peter Meintjes; Alexei Drummond
Journal:  Bioinformatics       Date:  2012-04-27       Impact factor: 6.937

8.  PEAR: a fast and accurate Illumina Paired-End reAd mergeR.

Authors:  Jiajie Zhang; Kassian Kobert; Tomáš Flouri; Alexandros Stamatakis
Journal:  Bioinformatics       Date:  2013-10-18       Impact factor: 6.937

9.  Trimmomatic: a flexible trimmer for Illumina sequence data.

Authors:  Anthony M Bolger; Marc Lohse; Bjoern Usadel
Journal:  Bioinformatics       Date:  2014-04-01       Impact factor: 6.937

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.