Literature DB >> 28989823

Isolation of polymorphic microsatellite loci in the New Zealand endemic sand-binder, Ficinia spiralis (Cyperaceae).

Rachel A van Heugten1, Marie L Hale1, Stacey Bryan2, Bart van Griensven2,3, Sophia Satter2,3, Lily Brailsford1, Hannah L Buckley4.   

Abstract

PREMISE OF THE STUDY: Ficinia spiralis (Cyperaceae) is a declining sand-binding sedge of ecological and cultural importance. Microsatellite primers were developed in F. spiralis to investigate how population genetic structure is related to the pronounced morphological, physiological, and ecological variation observed in this species. METHODS AND
RESULTS: A 454 shotgun-sequencing approach was used to generate 157,274 raw sequence reads, 536 of which contained microsatellites. After initial primer testing for 40 loci, 14 polymorphic loci were isolated, containing five to 27 alleles per locus. Ten of these loci also amplified in a congener, F. nodosa.
CONCLUSIONS: These loci will enable the assessment of the population genetic structure of F. spiralis, improving our understanding of the population processes underlying the observed morphological, physiological, and ecological variation in this endemic species. As the first microsatellites developed in Ficinia, these loci are a valuable resource for population genetic studies within this genus.

Entities:  

Keywords:  Cyperaceae; Ficinia nodosa; Ficinia spiralis; microsatellites; polyploidy; pīngao

Year:  2017        PMID: 28989823      PMCID: PMC5628027          DOI: 10.3732/apps.1700039

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Ficinia spiralis (A. Rich.) Muasya & de Lange (Cyperaceae), otherwise known as pīngao, pikao, or golden sand sedge, is a sand-binding sedge that occurs on the foredunes of New Zealand sandy beaches (Bergin and Herbert, 1998). Small remnants and numerous human-planted restoration populations are all that remain of this previously widespread plant (Courtney, 1983; Bergin, 2011). Despite significant effort being put into conservation and restoration activities, this species is currently ranked as “Declining” in the New Zealand Threat Classification System (de Lange et al., 2013). Pīngao is of great cultural and ecological value and significance for New Zealand because it provides habitat for other native sand dune specialists and is an important weaving fiber, being highly valued for its beautiful golden color when dry. It exhibits pronounced morphological and physiological variation throughout its geographic range (Bergin and Herbert, 1998); however, the causes and consequences of this variation are not understood. Microsatellite markers have not previously been successfully developed for this species, but are essential for characterizing the genetic variation within F. spiralis. In this paper, we present the development of microsatellite markers that will enable future genotyping of individuals from F. spiralis populations to correlate genetic, morphological, physiological, and ecological variation within this species. Our ultimate goal is to determine (1) what genetic variation is being lost as this species continues to decline and (2) what potential there is to use knowledge of the spatial genetic variation in this species to make better-informed conservation and restoration management decisions to reverse its decline.

METHODS AND RESULTS

Whole genomic DNA was extracted from 100-mg leaf samples of two F. spiralis individuals (geographic coordinates: −43.435°S, 172.713°E and −43.852°S, 172.771°E) using a modified cetyltrimethylammonium bromide (CTAB) method (Weising et al., 1995). Voucher specimens could not be collected due to permit restrictions (New Zealand Department of Conservation Research and Collection Permit 47972); a photograph of F. spiralis is provided in Appendix S1. The samples were combined before microsatellite regions were identified using a 454 sequencing approach. The 454 sequencing was conducted by Macrogen (Seoul, Korea) as follows. One microgram of genomic DNA was run on a GS FLX Titanium platform (1/8 region) after GS FLX Rapid Library shotgun library construction (454 Life Sciences, a Roche Company, Branford, Connecticut, USA). This generated 157,274 raw reads (National Center for Biotechnology Information [NCBI] Sequence Read Archive [SRA] Bioproject number PRJNA378666), which were then screened for microsatellite regions using MSATCOMMANDER version 0.8.2 (Faircloth, 2008). The search conditions were: dinucleotide repeats >8, trinucleotide repeats >7, tetranucleotide repeats >7, pentanucleotide repeats >6, and hexanucleotide repeats >6. The number of reads containing microsatellites was 536, and Primer3 (Koressaar and Remm, 2007; Untergasser et al., 2012) was used to design primers for all reads containing microsatellites with sufficient flanking sequence for primer design. Forty loci were then chosen for testing of amplification and variation based on the number of repeats present in the raw sequence. Reads with 15 to 25 repeats were preferred as they will likely maximize the chance of polymorphism while minimizing the likelihood of excessive stutter. Fourteen di-, 15 tri-, six tetra-, two penta-, and three hexanucleotide repeat regions were chosen for testing. The forward primer for each locus was appended with an M13 sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ end to allow the use of universal labeled primers (Schuelke, 2000), and PIG-tails (5′-GTTTCTT-3′) were added to the 5′ end of the reverse primers to reduce incomplete A-addition during PCR (Brownstein et al., 1996). The primers (Invitrogen, Carlsbad, California, USA) were initially tested for amplification against four F. spiralis individuals from two sample sites (geographic coordinates: −43.435°S, 172.713°E and −43.852°S, 172.771°E). Primers showing evidence of amplification were screened for polymorphism with a fluorescent M13 tag (Applied Biosystems, Carlsbad, California, USA) using an additional six F. spiralis individuals spanning the same two sample sites. PCRs used the following protocol: 15-μL reactions containing 1 μL of template DNA, 1× PCR buffer (Bioline, London, United Kingdom), 2 mM MgCl2, 0.08 mM dNTPs, 0.33 μM reverse primer, 0.33 μM fluorescent M13 tag (6-FAM, VIC, NED, PET), 0.08 μM forward primer, and 0.6 unit BIOTAQ (Bioline). PCR cycles for loci FSP2, FSP4, FSP6, FSP11, FSP30, and FSP50 ran on a touchdown protocol (TD) as follows: 95°C for 15 min; 10 cycles of 94°C for 15 s, 62–53°C (decreasing 1°C per cycle) for 30 s, 72°C for 1 min; 25 cycles of 94°C for 15 s, 52°C for 30 s, 72°C for 1 min; and a final extension step of 15 min at 72°C. The remaining loci were amplified with the following PCR cycle: 95°C for 12 min; 10 cycles of 94°C for 15 s, annealing temperature (Table 1) for 30 s, 72°C for 30 s; 30 cycles of 89°C for 15 s, annealing temperature for 30 s, 72°C for 30 s; and a final extension of 72°C for 10 min. DNA fragments were detected and sized using the GeneScan 500 LIZ Internal Size Standard (Applied Biosystems) and an ABI 3130xl Genetic Analyzer (Applied Biosystems). Loci FSP19, FSP44, and FSP45 were genotyped individually. The remaining loci were combined in the following pairs: FSP6 and FSP16, FSP30 and FSP29, FSP7 and FSP2, FSP4 and FSP21, FSP51 and FSP50, and FSP11 and FSP1. Fragments were scored manually using GeneMarker software version 6.41 (SoftGenetics, State College, Pennsylvania, USA).
Table 1.

Characteristics of 15 nuclear microsatellite loci isolated from Ficinia spiralis.

LocusPrimer sequences (5′–3′)Repeat motifAllele size range (bp)cTa (°C)Fluorescent dye
FSP1F: TTGTCTCAAGGGCGGTCTAC(AC)14168–203535-FAM
R: ACCCTGTAAATGGCAAAGCA
FSP2F: CAAGCGACTCCTCCTCCATA(CT)12234–253TD5-FAM
R: GCATTGCTGGCTTATCGTGA
FSP4F: GCCTCCACCCTCTCTCAG(CATT)18213–279TDVIC
R: GTAATCGGCGACAGTGACAG
FSP6F: AGAAGCATAATGTTCATGCACA(ATGT)18220–346TDVIC
R: TGCTCTCATTTGGCGTAGTG
FSP7F: TGCCATTCCTAGATCCACGT(ACT)13257–27953VIC
R: ACTTCTTGACCACCACCACA
FSP11F: CCCTTTGCAAATCTGGTTGGA(ATTT)11247–293TDVIC
R: GAGTAGAGGGGCCCACTTTT
FSP16F: TCTTCATAAGCAAGCAACTAAGC(GTT)12181–227505-FAM
R: TCAATACTGTAACAACAAGAAGT
FSP19F: AGCCGAACTCTGTCATCATCT(CT)1321952VIC
R: TGCGATTTCAACCAATTCAAC
FSP21F: ACCACCACCACAACAACAAC(AGT)13251–269535-FAM
R: TGCCATTCCTAGATCCACGT
FSP29F: AGGCTCCCTTGGTAAAATTT(AGT)11268–283505-FAM
R: AGGGCAGTATTCCCATGCTT
FSP30F: TCTAGCCTACCCCAACTTGT(GTT)10176–201TDVIC
R: TGCTGATGTCGTCTAAAGAGC
FSP44F: CGTGGTAATACTTTAAATGGACA(AT)12183–19550VIC
R: GCCTAGTTTGGTTGGTTTCCT
FSP45F: GTATCACCGATAACATCATTG(AT)12176–198TD5-FAM
R: GTGATTCATTTAGGAGAATAAGT
FSP50F: CACAACAACACAATGCACGC(AAGACG)7178–239TD5-FAM
R: AGAAGACGAGAAGTGCCGAT
FSP51F: TGAAAGCCCAACTGATGCAT(ACACAT)7257–28553VIC
R: TGGATAGGTGTGCTACGAGT

Note: Ta = annealing temperature; TD = touchdown protocol (see Methods and Results).

Raw reads were deposited to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) (Bioproject number PRJNA378666).

Values for all loci except FSP19 were based on 100 samples from four sites around New Zealand (N = 20–30 for each [Table 2]). Values for FSP19 are based on eight samples from two sites in New Zealand (N = 4 for each, geographic coordinates: −43.435°S, 172.713°E and −43.852°S, 172.771°E).

Fragment sizes include the M13 tag (5′-TGTAAAACGACGGCCAGT-3′) attached to the forward primer.

Characteristics of 15 nuclear microsatellite loci isolated from Ficinia spiralis. Note: Ta = annealing temperature; TD = touchdown protocol (see Methods and Results). Raw reads were deposited to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) (Bioproject number PRJNA378666). Values for all loci except FSP19 were based on 100 samples from four sites around New Zealand (N = 20–30 for each [Table 2]). Values for FSP19 are based on eight samples from two sites in New Zealand (N = 4 for each, geographic coordinates: −43.435°S, 172.713°E and −43.852°S, 172.771°E).
Table 2.

Genetic diversity statistics for 14 polymorphic microsatellite loci in four populations of Ficinia spiralis.

Kaitorete (n = 20)Matakana (n = 30)New Brighton (n = 29)Tumbledown Bay (n = 21)Total (n = 100)
LocusAHoAHoAHoAHoAHo
FSP171.000131.00070.92950.667160.898
FSP250.87591.00040.92930.950110.942
FSP4100.95081.000111.00070.952150.978
FSP6110.950210.818141.00040.944270.933
FSP740.30840.96410.00020.23560.455
FSP1180.950121.00080.96470.952120.969
FSP1661.000101.00031.00041.000161.000
FSP2120.23540.96610.00020.23550.439
FSP2971.00040.13881.00051.000100.745
FSP3040.60040.79350.59120.09560.543
FSP4440.95040.77830.91330.84270.865
FSP4570.84290.75070.86250.889120.833
FSP5040.85090.96751.00041.00090.959
FSP5150.83350.92960.96641.00060.937

Note: A = number of alleles; Ho = observed heterozygosity; n = number of individuals sampled.

Geographic coordinate locations of the populations are: Kaitorete Spit (−43.827°S, 172.655°E), Matakana Island (−37.563°S, 176.081°E), New Brighton (−43.523°S, 172.739°E), Tumbledown Bay (−43.852°S, 172.771°E).

Fragment sizes include the M13 tag (5′-TGTAAAACGACGGCCAGT-3′) attached to the forward primer. Of the 40 loci tested, 15 amplified cleanly. Of the 15 loci, one locus (FSP19) was monomorphic in F. spiralis, while 14 were polymorphic (see Appendix S2 for raw sequences for these loci). The 14 polymorphic loci were then used to genotype 100 F. spiralis individuals from across four sample sites (each with at least 20 samples) to gain a better understanding of the variation present at these loci (Table 2). All 15 loci were tested for cross-amplification in six specimens (from two different locations: Christchurch [−43.486°S, 172.693°E] and Auckland [−36.956°S, 174.468°E]) of F. nodosa (Rottb.) Goetgh., Muasya & D. A. Simpson, the only other Ficinia Schrad. species recorded in New Zealand (a photograph of F. nodosa is provided in Appendix S1). Ten of the 15 loci amplified in F. nodosa, and two loci (FSP19 and FSP51) were polymorphic (Table 3). Analysis with POLYSAT version 1.7-1 (Clark and Jasieniuk, 2011; Clark and Schreier, 2017) in R version 3.0.2 (R Core Team, 2013) indicated that F. spiralis individuals are either triploid or tetraploid. However, there is no record in the literature to indicate whether F. spiralis is allopolyploid or autopolyploid. Therefore, F. spiralis alleles were scored as either present or absent, and it was not possible to calculate Hardy–Weinberg equilibrium and linkage disequilibrium.
Table 3.

Cross-amplification of 15 nuclear microsatellite loci developed for Ficinia spiralis in F. nodosa (n = 6).

LocusAAlelle size range (bp)b
FSP11186
FSP21243
FSP41211
FSP6
FSP71238
FSP111236
FSP16
FSP192219–229
FSP211226
FSP291256
FSP30
FSP441273
FSP45
FSP50
FSP512203–259

Note: A = number of alleles.

Geographic coordinates for the sample sites are: −43.486°S, 172.693°E and −36.956°S, 174.468°E.

Fragment sizes include the M13 tag (5′-TGTAAAACGACGGCCAGT-3′) attached to the forward primer.

Genetic diversity statistics for 14 polymorphic microsatellite loci in four populations of Ficinia spiralis. Note: A = number of alleles; Ho = observed heterozygosity; n = number of individuals sampled. Geographic coordinate locations of the populations are: Kaitorete Spit (−43.827°S, 172.655°E), Matakana Island (−37.563°S, 176.081°E), New Brighton (−43.523°S, 172.739°E), Tumbledown Bay (−43.852°S, 172.771°E). Cross-amplification of 15 nuclear microsatellite loci developed for Ficinia spiralis in F. nodosa (n = 6). Note: A = number of alleles. Geographic coordinates for the sample sites are: −43.486°S, 172.693°E and −36.956°S, 174.468°E. Fragment sizes include the M13 tag (5′-TGTAAAACGACGGCCAGT-3′) attached to the forward primer.

CONCLUSIONS

Ficinia spiralis (Cyperaceae) is a declining, endemic species of great cultural and ecological value to New Zealand. Here, we describe one monomorphic and 14 polymorphic microsatellite loci that will enable us to assess genetic variation across the geographic range of this species, and to determine whether this variation correlates with morphological and/or physiological variation. Ten of these loci also amplified in F. nodosa, suggesting these loci may be useful for assessing genetic variation and population structure in other species within this genus. Although the polyploidy of F. spiralis limits the range of population genetic analyses available to those that can accommodate dominant data, numerous other studies have used similar data to investigate population structure and how it relates to other factors such as the environment (i.e., Brito et al., 2016; Wu et al., 2016). The high number of alleles at many of these loci should provide sufficient information for the assessment of fine-scale genetic structure throughout the species’ range. Click here for additional data file. Click here for additional data file.
  8 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  Enhancements and modifications of primer design program Primer3.

Authors:  Triinu Koressaar; Maido Remm
Journal:  Bioinformatics       Date:  2007-03-22       Impact factor: 6.937

3.  POLYSAT: an R package for polyploid microsatellite analysis.

Authors:  Lindsay V Clark; Marie Jasieniuk
Journal:  Mol Ecol Resour       Date:  2011-02-06       Impact factor: 7.090

4.  msatcommander: detection of microsatellite repeat arrays and automated, locus-specific primer design.

Authors:  Brant C Faircloth
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

5.  Resolving microsatellite genotype ambiguity in populations of allopolyploid and diploidized autopolyploid organisms using negative correlations between allelic variables.

Authors:  Lindsay V Clark; Andrea Drauch Schreier
Journal:  Mol Ecol Resour       Date:  2017-01-05       Impact factor: 7.090

6.  Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping.

Authors:  M J Brownstein; J D Carpten; J R Smith
Journal:  Biotechniques       Date:  1996-06       Impact factor: 1.993

7.  Primer3--new capabilities and interfaces.

Authors:  Andreas Untergasser; Ioana Cutcutache; Triinu Koressaar; Jian Ye; Brant C Faircloth; Maido Remm; Steven G Rozen
Journal:  Nucleic Acids Res       Date:  2012-06-22       Impact factor: 16.971

8.  Influence of geography and environment on patterns of genetic differentiation in a widespread submerged macrophyte, Eurasian watermilfoil (Myriophyllum spicatum L., Haloragaceae).

Authors:  Zhigang Wu; Dan Yu; Xing Li; Xinwei Xu
Journal:  Ecol Evol       Date:  2016-01-08       Impact factor: 2.912

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.