Zi-Ye Zhao1, Yu-Liang Jiang2, Bai-Rong Li2, Fu Yang1, Jing Li2, Xiao-Wei Jin2, Shou-Bin Ning3, Shu-Han Sun4. 1. Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd., Shanghai, 200433, China. 2. Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd., Beijing, 100142, China. 3. Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd., Beijing, 100142, China. ningshoubin@126.com. 4. Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd., Shanghai, 200433, China. shsun@vip.sina.com.
Abstract
BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.
BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJSpatient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.
Authors: A D Beggs; A R Latchford; H F A Vasen; G Moslein; A Alonso; S Aretz; L Bertario; I Blanco; S Bülow; J Burn; G Capella; C Colas; W Friedl; P Møller; F J Hes; H Järvinen; J-P Mecklin; F M Nagengast; Y Parc; R K S Phillips; W Hyer; M Ponz de Leon; L Renkonen-Sinisalo; J R Sampson; A Stormorken; S Tejpar; H J W Thomas; J T Wijnen; S K Clark; S V Hodgson Journal: Gut Date: 2010-07 Impact factor: 23.059
Authors: Nicholas Hearle; Valérie Schumacher; Fred H Menko; Sylviane Olschwang; Lisa A Boardman; Johan J P Gille; Josbert J Keller; Anne Marie Westerman; Rodney J Scott; Wendy Lim; Jill D Trimbath; Francis M Giardiello; Stephen B Gruber; G Johan A Offerhaus; Felix W M de Rooij; J H Paul Wilson; Anika Hansmann; Gabriela Möslein; Brigitte Royer-Pokora; Tilman Vogel; Robin K S Phillips; Allan D Spigelman; Richard S Houlston Journal: Clin Cancer Res Date: 2006-05-15 Impact factor: 12.531
Authors: H Mehenni; C Gehrig; J Nezu; A Oku; M Shimane; C Rossier; N Guex; J L Blouin; H S Scott; S E Antonarakis Journal: Am J Hum Genet Date: 1998-12 Impact factor: 11.025
Authors: F M Giardiello; S B Welsh; S R Hamilton; G J Offerhaus; A M Gittelsohn; S V Booker; A J Krush; J H Yardley; G D Luk Journal: N Engl J Med Date: 1987-06-11 Impact factor: 91.245