Literature DB >> 28986664

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

Zi-Ye Zhao1, Yu-Liang Jiang2, Bai-Rong Li2, Fu Yang1, Jing Li2, Xiao-Wei Jin2, Shou-Bin Ning3, Shu-Han Sun4.   

Abstract

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND
RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.
CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

Entities:  

Keywords:  De-novo mutation; Hamartoma; Peutz–Jeghers syndrome; Polyposis; STK11

Mesh:

Substances:

Year:  2017        PMID: 28986664     DOI: 10.1007/s10620-017-4741-5

Source DB:  PubMed          Journal:  Dig Dis Sci        ISSN: 0163-2116            Impact factor:   3.199


  30 in total

Review 1.  Peutz-Jeghers syndrome and management recommendations.

Authors:  Francis M Giardiello; Jill D Trimbath
Journal:  Clin Gastroenterol Hepatol       Date:  2006-04       Impact factor: 11.382

2.  Generalized intestinal polyposis and melanin spots of the oral mucosa, lips and digits; a syndrome of diagnostic significance.

Authors:  H JEGHERS; V A McKUSICK; K H KATZ
Journal:  N Engl J Med       Date:  1949-12-22       Impact factor: 91.245

3.  A novel de novo mutation in LKB1 gene in a Chinese Peutz Jeghers syndrome patient significantly diminished p53 activity.

Authors:  Lin Liu; Xiaohui Du; Jing Nie
Journal:  Clin Res Hepatol Gastroenterol       Date:  2011-03-15       Impact factor: 2.947

4.  Double-balloon enteroscopy (push-and-pull enteroscopy) of the small bowel: feasibility and diagnostic and therapeutic yield in patients with suspected small bowel disease.

Authors:  Andrea May; Lars Nachbar; Christian Ell
Journal:  Gastrointest Endosc       Date:  2005-07       Impact factor: 9.427

5.  Peutz-Jeghers syndrome: a systematic review and recommendations for management.

Authors:  A D Beggs; A R Latchford; H F A Vasen; G Moslein; A Alonso; S Aretz; L Bertario; I Blanco; S Bülow; J Burn; G Capella; C Colas; W Friedl; P Møller; F J Hes; H Järvinen; J-P Mecklin; F M Nagengast; Y Parc; R K S Phillips; W Hyer; M Ponz de Leon; L Renkonen-Sinisalo; J R Sampson; A Stormorken; S Tejpar; H J W Thomas; J T Wijnen; S K Clark; S V Hodgson
Journal:  Gut       Date:  2010-07       Impact factor: 23.059

6.  Endoscopic resection of Peutz-Jeghers polyps throughout the small intestine at double-balloon enteroscopy without laparotomy.

Authors:  Naoki Ohmiya; Ayumu Taguchi; Kennosuke Shirai; Nobuyuki Mabuchi; Daigo Arakawa; Hironobu Kanazawa; Masayasu Ozeki; Masahiro Yamada; Masanao Nakamura; Akihiro Itoh; Yoshiki Hirooka; Yasumasa Niwa; Tetsuro Nagasaka; Masafumi Ito; Shinji Ohashi; Shozo Okamura; Hidemi Goto
Journal:  Gastrointest Endosc       Date:  2005-01       Impact factor: 9.427

7.  Frequency and spectrum of cancers in the Peutz-Jeghers syndrome.

Authors:  Nicholas Hearle; Valérie Schumacher; Fred H Menko; Sylviane Olschwang; Lisa A Boardman; Johan J P Gille; Josbert J Keller; Anne Marie Westerman; Rodney J Scott; Wendy Lim; Jill D Trimbath; Francis M Giardiello; Stephen B Gruber; G Johan A Offerhaus; Felix W M de Rooij; J H Paul Wilson; Anika Hansmann; Gabriela Möslein; Brigitte Royer-Pokora; Tilman Vogel; Robin K S Phillips; Allan D Spigelman; Richard S Houlston
Journal:  Clin Cancer Res       Date:  2006-05-15       Impact factor: 12.531

8.  Loss of LKB1 kinase activity in Peutz-Jeghers syndrome, and evidence for allelic and locus heterogeneity.

Authors:  H Mehenni; C Gehrig; J Nezu; A Oku; M Shimane; C Rossier; N Guex; J L Blouin; H S Scott; S E Antonarakis
Journal:  Am J Hum Genet       Date:  1998-12       Impact factor: 11.025

9.  Increased risk of cancer in the Peutz-Jeghers syndrome.

Authors:  F M Giardiello; S B Welsh; S R Hamilton; G J Offerhaus; A M Gittelsohn; S V Booker; A J Krush; J H Yardley; G D Luk
Journal:  N Engl J Med       Date:  1987-06-11       Impact factor: 91.245

10.  SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information.

Authors:  Marco Biasini; Stefan Bienert; Andrew Waterhouse; Konstantin Arnold; Gabriel Studer; Tobias Schmidt; Florian Kiefer; Tiziano Gallo Cassarino; Martino Bertoni; Lorenza Bordoli; Torsten Schwede
Journal:  Nucleic Acids Res       Date:  2014-04-29       Impact factor: 16.971

View more
  4 in total

1.  The altered activity of P53 signaling pathway by STK11 gene mutations and its cancer phenotype in Peutz-Jeghers syndrome.

Authors:  Yu-Liang Jiang; Zi-Ye Zhao; Bai-Rong Li; Fu Yang; Jing Li; Xiao-Wei Jin; Hao Wang; En-Da Yu; Shu-Han Sun; Shou-Bin Ning
Journal:  BMC Med Genet       Date:  2018-08-09       Impact factor: 2.103

2.  Early screening the small bowel is key to protect Peutz-Jeghers syndrome patients from surgery: a novel mutation c.243delG in STK11 gene.

Authors:  Yu-Liang Jiang; Zi-Ye Zhao; Bai-Rong Li; Jing Li; Xiao-Wei Jin; En-Da Yu; Xiao-Dong Xu; Shou-Bin Ning
Journal:  BMC Gastroenterol       Date:  2019-05-09       Impact factor: 3.067

3.  Delayed diagnosis of Peutz-Jeghers syndrome due to pathological information loss or mistake in family/personal history.

Authors:  Yu-Liang Jiang; Xiao-Dong Xu; Bai-Rong Li; En-Da Yu; Zi-Ye Zhao; Hong Liu
Journal:  Orphanet J Rare Dis       Date:  2021-06-08       Impact factor: 4.123

4.  A novel germline mutation (c.A527G) in STK11 gene causes Peutz-Jeghers syndrome in a Chinese girl: A case report.

Authors:  Zi-Ye Zhao; Yu-Liang Jiang; Bai-Rong Li; Fu Yang; Jing Li; Xiao-Wei Jin; Shu-Han Sun; Shou-Bin Ning
Journal:  Medicine (Baltimore)       Date:  2017-12       Impact factor: 1.817

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.