The comparative mitogenomics and phylogenetics of the two grouse-grasshoppers (Insecta, Orthoptera, Tetrigoidea).

OBJECTIVE: This study aimed to reveal the mitochondrial genomes (mtgenomes) of Tetrix japonica and Alulatettix yunnanensis, and the phylogenetics of Orthoptera species.
METHODS: The mtgenomes of A. yunnanensis and T. japonica were firstly sequenced and assembled through partial sequences amplification, and then the genome organization and gene arrangement were analyzed. Based on nucleotide/amino acid sequences of 13 protein-coding genes and whole mtgenomes, phylogenetic trees were established on 37 Orthoptera species and 5 outgroups, respectively.
RESULTS: Except for a regulation region (A+T rich region), a total of 37 genes were found in mtgenomes of T. japonica and A. yunnanensis, including 13 protein-coding genes, 2 ribosomal RNA genes, and 22 transfer RNA genes, which exhibited similar characters with other Orthoptera species. Phylogenetic tree based on 13 concatenated protein-coding nucleotide sequences were considered to be more suitable for phylogenetic reconstruction of Orthoptera species than amino acid sequences and mtgenomes. The phylogenetic relationships of Caelifera species were Acridoidea and Pamphagoidea > Pyrgomorphoidea > Pneumoroidea > Eumastacoidea > Tetrigoidea > Tridactyloidea. Besides, a sister-group relationship between Tettigonioidea and Rhaphidophoroidea was revealed in Ensifera.
CONCLUSION: Concatenated protein-coding nucleotide sequences of 13 genes were suitable for reconstruction of phylogenetic relationship in orthopteroid species. Tridactyloidea was a sister group of Tetrigoidea in Caelifera, and Rhaphidophoroidea was a sister group of Tettigonioidea in Ensifera.

Introduction

Mitochondrial genome (mtgenome) is a kind of small circular molecule in most of metazoans, which evolves semi-independently from nuclear genomes and plays an important role in the process of metabolism, programmed cell death, illness, and aging. Generally, the closed circular mtDNA was 14–39 kb in length, which consists of a major non-coding region (regulation region, A + T rich region) and a canonical set of 37 genes, including 13 protein-coding genes, 2 ribosomal RNAs (rRNA) and 22 transfer RNAs (tRNA). The distribution of these genes is always compact with infrequent introns and intergenic space [1, 2]. As low frequency of intermolecular genetic recombination and relatively rapid evolutionary rate, mtgenome has been extensively used for researching on population structures, phylogeography and phylogenetic relationships at various taxonomic levels [3, 4].

Recently, mtgenome has been widely used in phylogenetic analyses. It has been reported, mtgenomes could provide rich information’s in phylogenetics [5]. Phylogenetic analyses based on complete mtgenome sequences could improve the statistical confidence of inferred phylogenetic trees with better resolution than analyses only based on partial mtgenes [6]. The evolution of mtgenomes, instead of mtgenes, was a new instrument for studying biological speciation and lineage divergence [7]. In addition, mtgenome may partly represent the whole genome, and be used as a phylogenetic marker in investigation of structural genomic features easily and systematically [8]. All these features of mtgenome greatly promoted the researches on evolutionary trends and relationships of phylogenetically distant organisms [9].

With the growing interest in mtgenomes, a rapid increase of published complete mtgenome sequences was revealed [10]. Despite insects were the most species-rich class animals, the sequenced mtgenomes are majorly vertebrates. Until now, more than 8634 complete metazoan mtgenomes have been sequenced, and only 337 are from insects and 39 are from Orthoptera (http://www.ncbi.nlm.nih.gov). Besides, two mtgenomes of Tetrigoidea were announced by our previous studies [10]. Orthoptera is a kind of primitive hemimetabolous insects, contains approximately 20,000 described species in two suborders of equal size (Caelifera and Ensifera) [11]. A preliminary phylogenetic analyses of Orthoptera based on the mtgenome data have been performed, while the superfamily Tetrigoidea was not involved. Tetrigoidea is a moderately diverse group of basal Caelifera comprising approximately 1400 species in 8 families and 270 genera [12]. As a monophyletic group supported by molecular data, Tetrigoidea was regarded as one of the oldest groups in Caelifera, which closely related to Tridactyloidea [13, 14]. Researches on the mtgenome sequences of Tetrigoidea may contribute to the revelation of phylogenetic relationships in Orthoptera. In this study, the mtgenomes of two Tetrigoidea species, A. yunnanensis and T. japonica were firstly revealed, and the genome organization and gene arrangement were then analyzed. Meanwhile, phylogenetic trees were established to evaluate the phylogenetics of Orthoptera species. Our findings may enrich our knowledge on mtgenomes of Tetrigoidea, and provide an efficient strategy for biodiversity exploring on Orthoptera species.

Materials and methods

Samples and DNA extraction

Specimens of A. yunnanensis and T. japonica were collected from a public land (not a protected area or a national park) in Nanjing, Jiangsu, China. Total genomic DNA was extracted from the femoral muscle of fresh specimens by the standard proteinase K and phenol/chloroform extraction method. Simply, the tissues were firstly disintegrated with 20 mg/ml proteinase K (Genebase Gene-Tech Co., Ltd) at 37 °C for 2–3 h. Then, the samples were incubated with extraction solution, and V/2 of phenol and V/2 of chloroform was added. After centrifugation, the supernatant was obtained, and 1/10 volume of 3 M NaOAc and 2 volumes of 100% ethanol were used to precipitate the DNA. Finally, the precipitate (DNA) was dissolved in Tris–EDTA buffer solution, and quantified with spectrafluorometer. The isolated DNA samples were stored at −20 °C and used as a template for subsequence PCR reactions.

Primer design and PCR amplification

Some partial sequences were firstly amplified and sequenced using general primers based on Simon et al. [15]. Then, new primers were designed based on determined sequences, and each amplified segments could overlap the adjacent segments (Primers were shown in Table 1). The fragments of mtgenomes were amplified by PCR using Takara LA Taq™ (Takara Bio, Otsu, Shiga, Japan). The PCR program included an initial denaturation at 94 °C for 3 min, followed by 10 cycles of denaturation at 94 °C for 30 s, annealing at 52–59 °C to 0.3 °C/cycle (depending on primer combinations) for 30 s, elongation at 68 °C for 60–180 s (depending on putative length of the fragments); then followed by another PCR program included 20 cycle of 30 s denaturation at 94 °C, 30 s annealing at 49–56 °C, 60–180 s elongation at 68 °C and a final extension at 68 °C for 8 min. The PCR products were identified by electrophoresis on 1% agarose gel.

Table 1

Sequencing primers used in the analysis of mitochondrial genome of Alulatettix yunnanensis and Tetrix japonica

Upstream primers sequences (5′–3′)	Downstream primers sequences (5′–3′)	Anneal temperature (°C)
190-J:AAGCTAMTGGGTTCATRCCC	1650-F:AAYCAATTTCCGAATCCACC	53
1600-J:GTTGTTGTAACAGCACATGC	2750-F:CCTCCTATAATAGCAAATACTGCTCC	54
2650-J:TTACCTGTTYTWGCWGGAGC	3660-F:CCACAAATTTCAGAGCATTGACC	55
3600-J:CAATGATACTGATCATATGAATATTC	4900-F:ATCYCGTCATCATTGAATTAT	53
4800-J:TAGTAGACTATAGTCCATGACC	6150-F:CCATTCTTTCAGGTCGAAACTG	55
5800-J:GAGCAWCTTAGGGTTATAGTT	7600-F:TAAGWAATCGKRTWGGTGATGT	52
7500-J:CAGGAGTAGGAGCAGCTATAGC	8650-F:CTTGTAATATATCGGCTCCTCC	56
8500-J:GTGTAATAAGAATAACTAATTAAGCC	9000-F:TGTTGCAGCTTCATTACCATTATTGT	49
8900-J:GGGGCCTCAACATGAGCYTT	10600-F:TTTCATCATATTGAAATRTTTRTTGG	51
10300-J:CAACAATAATGAAACAAYRAATATAG	11600-F:AAATAYCATTCTGGTTGAATGTG	51
11450-J:CCCATATATTATAGGAGAYCC	12300-F:TATGAGTTCGGGGTACTTTACC	53
12050-J:AAAAACCCCCTTCAAGCCAAAT	13350-F:GACYGTRCAAAGGTAGCATAATC	54
13150-J:TTCTCGTTAAACCTTTCATTCCAGT	14300-F:TATTTCAGGTCAAGGTGCAGCTTAT	54
14100-J:CTACTWTGTTACGACTTATCTC	14450-F:ARACTAGGATTAGATACCCT	51
14330-J:TAACATCATTCATGAAACAGGTTCCTCT	250-F:ATTTCTAGTCCTATTCACACACCTAATC	54

Sequencing and sequence assembly

The PCR products with single band were purified using a V-gen PCR clean-up purification kit. If more than one band was present, the appropriately sized PCR product was cut off from the gel and purified using a biospin gel extraction kit. All fragments were sequenced in both directions, and some PCR products were sequenced by primer walking strategy. The identified sequences were assembled by seqman (DNASTAR 2001), BioEdit and Chromas 2.22, and then the complete mtgenome sequences of T. japonica and A. yunnanensis were manually checked. The coverage of each mtgenome was above two times.

Sequence analysis

Gene encoding proteins, rRNA and tRNA were identified according to their amino acid translation or secondary structure features, respectively. Individual gene sequences were compared with the available homologous sequences of Orthoptera species in GenBank. A total of 22 tRNA genes were identified using software tRNA Scan-SE 1.21 (http://lowelab.ucsc.edu/tRNAscan-SE) and their cloverleaf secondary structures and anticodon sequences were identified using DNASIS (Ver.2.5, Hitachi Software Engineering).

The reconstruction of phylogenetic trees

In order to evaluate the phylogenetic relationships in Orthoptera, phylogenetic trees were established based on nucleotide/amino acid sequences of 13 protein-coding genes and whole mtgenome sequences of 37 Orthoptera species whose complete mtgenome sequences were available in GenBank by using two Blattaria species (Periplaneta fuliginosa and Eupolyphaga sinensis), two Isoptera specie (Reticulitermes flavipes and Coptotermes formosanus) and one Mantodea specie (Tamolanica tamolana) as outgroup [6]. Mtgenome sequences were downloaded from GenBank (Table 2).

Table 2

A total of 37 Orthoptera species were used in reconstruction of phylogenetic trees. Two Blattaria species, two Isoptera specie and one Mantodea specie were considered as outgroup

Taxa	Species	Accession
Caelifera/Tetrigoidea	Tetrix japonica
	Alulatettixyunnanensis	JQ272702
Caelifera/Acridoidea	Acridacinerea	GU344100
	Acridawillemsei	EU938372
	Arcypteracoreana	GU324311
	Chorthippuschinensis	EU029161
	Euchorthippusfusigeniculatus	HM583652
	Gastrimargusmarmoratus	EU513373
	Gomphocerussibiricustibetanus	HM131804
	Gomphoceruslicenti	GQ180102
	Locustamigratoriatibetensis	HM219224
	Locustamigratoria	X80245
	Oedaleusdecorusasiaticus	EU513374
	Ognevialongipennis	EU914848
	Oxyachinensis	EF437157
	Phlaeobaalbonema	EU370925
	Prumnaarctica	GU294758
	Schistocercagregariagregaria	GQ491031
	Trauliaszetschuanensis	EU914849
	Xyleusmodestus	GU945503
Caelifera/Eumastacoidea	Pielomastaxzhengi	JF411955
Caelifera/Pamphagoidea	Thrinchusschrenkii	GU181288
Caelifera/Pneumoroidea	Physemacrisvariolosa	GU945504
Caelifera/Pyrgomorphoidea	Atractomorphasinensis	EU263919
	Mekongiellaxizangensis	HM583654
	Mekongianaxiangchengensis	HM583653
Caelifera/Tridactyloidea	Ellipesminuta	GU945502
Ensifera/Tettigonioidea	Anabrus simplex	EF373911
	Deracanthaonos	EU137664
	Elimaeacheni	GU323362
	Gampsocleisgratiosa	EU527333
	Ruspoliadubia	EF583824
Ensifera/Grylloidea	Gryllotalpaorientalis	AY660929
	Gryllotalpapluvialis	EU938371
	Myrmecophilusmanni	EU938370
	Teleogryllusemma	EU557269
Ensifera/Rhaphidophoroidea	Troglophilusneglectus	EU938374
Blattaria	Periplanetafuliginosa	AB126004
	Eupolyphagasinensis	FJ830540
Isoptera	Reticulitermesflavipes	EF206314
	Coptotermesformosanus	AB626145
Mantodea	Tamolanicatamolana	DQ241797

Alignments and bayesian analyses

The nucleotide and amino acid sequences were aligned by ClusterW in MEGA 4.0 with manual refinements [16]. One alignment was based on the complete mtDNA sequences, except for the highly variable ETAS (extended termination associated sequence) domain within regulation region, creating a sequence of 15,612 nt positions. The second alignment was based on the complete set of codons (except stop codons) creating a concatenated sequence of 10,989 nt positions (3663 amino acid positions) corresponding to the 13 protein-coding genes.

Bayesian analyses were performed by MRBAYES 3.1.2, with gaps treated as missing data [10]. The best fitting substitution model judged by Akaike information criterion (AIC) was determined by MrMODELTEST 2.3 [17]. For each BI analysis, two independent sets of monte carlo markov chains (MCMC) were run, each with one cold and three heated chains for 1 × 106 generations, and every 1000 generations were sampled. The burn-in parameter was estimated by plotting-lnL against the generation number using TRACER v1.4.1, and the retained trees were used to estimate the consensus tree and Bayesian posterior probabilities [18].

Results

Genome organization and gene arrangement

By sequencing and sequence assembly, a total of 37 genes were found in mtgenomes of T. japonica and A. yunnanensis, including 13 protein-coding genes (nad2, COI, COII, atp8, atp6, COIII, nad3, nad5, nad4, nad4L, nad6, cob and nad1), 2 rRNA (12S rRNA and 16S rRNA), and 22 tRNA. Meanwhile, a regulation region (A+T rich region) was also found in the mtgenomes (Table 3).

Table 3

Annotation of the mitochondrial genomes in Tetrix japonica (Tj) and Alulatettix yunnanensis (Ay)

Feature	Strand	Position		Initiation codon/Stop codon		Anticodon
		Tj	Ay	Tj	Ay
trnI	J	1–64	1–65			GAT
trnQ	N	65–133	66–134			TTG
trnM	J	134–201	135–202			CAT
nad2	J	201–1202	203–1204	ATG/TAA	ATG/TAA
trnW	J	1201–1266	1203–1268			TCA
trnC	N	1259–1324	1261–1326			GCA
trnY	N	1325–1388	1327–1390			GTA
COI	J	1386–2924	1388–2926	ATC/TAA	ATC/TAA
trnL(UUR)	J	2920–2983	2922–2985			TAA
COII	J	2984–3667	2986–3669	ATG/TAA	ATG/TAA
trnD	J	3666–3729	3668–3729			CTT
trnK	J	3730–3797	3730–3797			GTC
atp8	J	3802–3957	3802–3957	ATG/TAA	ATG/TAA
atp6	J	3951–4622	3951–4622	ATG/TAA	ATG/TAA
COIII	J	4625–5428	4625–5428	ATA/TAA	ATA/TAA
trnG	J	5412–5474	5412–5474			TCC
nad3	J	5472–5828	5472–5828	ATA/TAG	ATA/TAG
trnA	J	5827–5891	5827–5891			TGC
trnR	J	5891–5953	5891–5953			TCG
trnN	J	5950–6013	5950–6013			GTT
trnS	J	6013–6081	6013–6081			GCT
trnE	J	6081–6144	6081–6144			TTC
trnF	N	6143–6205	6143–6205			GAA
nad5	N	6207–7922	6206–7925	ATG/TAA	ATG/T–
trnH	N	7926–7989	7929–7992			GTG
nad4	N	7989–9314	7992–9317	ATG/TAG	ATG/TAG
nad4L	N	9308–9598	9311–9601	ATT/TAA	ATT/TAA
trnT	J	9601–9666	9604–9668			TGT
trnP	N	9667–9730	9669–9732			TGG
nad6	J	9732–10,226	9734–10,228	ATG/TAA	ATG/TAA
cob	J	10,226–11,362	10,228–11,364	ATG/TAG	ATG/TAG
trnS(UCN)	J	11,361–11,428	11,363–11,430			TGA
nad1	N	11,441–12,385	11,443–12,387	ATA/TAA	ATA/TAA
trnL	N	12,380–12,442	12,382–12,444			TAG
16S	N	12,443–13,739	12,445–13,784
trnV	N	13,741–13,811	13,786–13,857			TAC
12S	N	13,812–14,597	13,858–14,644
A+T−rich		14,598–15,128	14,645–15,104

J represents sense strand, N represents antisense strand

The arrangement of mtgenome was very compact in these two species, which exhibited many gene overlaps. In T. japonica, 21 gene overlaps in 1–17 bp with a total of 77 bp in length were found. Similarly, 19 gene overlaps in 1–17 bp with a total of 75 bp in length were found in A. yunnanensis. In addition, 8 non-coding regions in 1–12 bp with a total of 26 bp in length, and 7 non-coding regions in 1–12 bp with a total of 25 bp in length were revealed in A+T-rich regions of T. japonica and A. yunnanensis, respectively. Besides, 22 tRNA genes were also found in mtgenomes of T. japonica and A. yunnanensis, which exhibited a same relative genomic position in other Orthoptera insects. The predicated secondary structures of these 22 tRNA genes in T. japonica and A. yunnanensis were shown in Additional file 1: Figure S1 and Additional file 2: Figure S2.

The nucleotide composition of these two mitogenomes (T. japonica and A. yunnanensis) biased toward adenine and thymine (75.57% in T. japonica and 75.24% in A. yunnanensis). ATN was the preferred initiation codon of 13 protein-coding genes in T. japonica and A. yunnanensis, including 8 ATG, 3 ATA, 1 ATC and 1 ATT. TAA and TAG were considered to be the termination codons of these 13 protein-coding genes in T. japonica and A. yunnanensis, except one T of nad5 gene in A. yunnanensis (Table 3). Besides, the A+T-rich regions of the two mtgenomes were also located between small rRNA and tRNA , which were 531 bp with 82.67% A+T and 460 bp with 80.87% A+T in T. japonica and A. yunnanensis, respectively. Short repeating sequences except Poly A and Poly T could not be found throughout the whole A+T-rich regions.

Phylogenetic analyses

Based on 13 concatenated protein-coding nucleotide sequences, the topology of established phylogenetic tree was similar with the reconstructed tree based on the whole mtgenome sequences. Differently, Teleogryllus emma of Gryllidae was revealed to be basal to all other Orthoptera species in phylogenetic tree of protein-coding nucleotide sequences, which was conflicted with the monophyletic Gryllidae in phylogenetic tree of mtgenome (Fig. 1a, c). In phylogenetic tree based on amino acid, Thrinchus schrenkii was found to belong to Pamphagoidea among various species of Acridoidea, which was also not consistent with the monophyletism of Acridoidea (Fig. 1b). According to the 37 Orthoptera species, 13 concatenated protein-coding DNA sequences were suspected to be accurate and effective for phylogenetic reconstruction of Orthoptera species.

Fig. 1

Phylogenetic tree established by concatenated protein-coding DNA sequences (N = 13) a, concatenated amino acids b, and whole mtgenome sequences c of 37 Orthopteran species and 5 outgroups (two Blattaria species, two Isoptera specie and one Mantodea specie). The red underline is the species position of Alulatettix yunnanensis and Tetrix japonica

As shown in Fig. 1a, two Orthopteran suborders, Caelifera and Ensifera were both recovered as monophyletic groups. In Caelifera branch, Acridoidea, Pyrgomorphoidea and Tetrigoidea were monophyletic groups. The phylogenetic relationships of these superfamilies were Acridoidea and Pamphagoidea > Pyrgomorphoidea > Pneumoroidea > Eumastacoidea > Tetrigoidea > Tridactyloidea. In Ensifera, a sister-group relationship between Tettigonioidea and Rhaphidophoroidea was revealed.

Discussion

According to our previous studies, the mtgenomes of T. japonica (15,128 bp) and A. yunnanensis (15,104 bp) were circular molecules (GenBank accession numbers: JQ340002 and JQ272702) [19, 20]. In this study, a total of 37 typical genes and a regulation region were found in the mtgenomes of T. japonica and A. yunnanensis, which exhibited similar gene order and orientation with other Orthopteran insects. The conserved mtgenome structure in divergent insects identified their close genetic relationships [10]. In addition, the main nucleotide composition of these two mtgenomes was revealed to be adenine and thymine (75.57% of T. japonica and 75.24% of A. yunnanensis). Although the nucleotide composition was slightly lower than that found in some other Orthoptera insects (Locusta migratoria 75.3%, Oxya chinensis 75.9% and Acrida willemsei 76.2%), it was still corresponded well to the normal range of insect mtgenomes from 69.2% to 84.9% [10]. These data should be useful for developing mtgenome genetic markers for species identification of Orthoptera insects.

In mtgenomes of T. japonica and A. yunnanensis, 22 tRNA genes were identified in the same relative genomic positions as observed in other Orthoptera insects. The typical cloverleaf secondary structures and anticodons of these tRNAs were also similar to those found in other metazoan animals. As the only major non-coding region in insect mtgenome, the regulation region (A+T rich region) biased on A+T nucleotides were evolved under a strong directional mutation pressure [21]. It has been reported the A+T rich region was varied greatly in insects, from 70 bp in Ruspolia dubia to 4601 bp in Drosophila melanogaster [22, 23]. In this study, A+T rich regions in 531 bp length with 82.67% A+T and 460 bp length with 80.87% A+T located between small rRNA and tRNA were revealed in T. japonica and A. yunnanensis, respectively. This region may limit its use for both inter- and intra-specific analyses in evolutionary studies.

In phylogenetic analyses, a similar topology of the established phylogenetic trees based on the whole mtgenome sequences and concatenated protein-coding nucleotide sequences were revealed. However, Teleogryllus emma of Gryllidae basal to all other Orthoptera species based on nucleotide sequences was conflict with the monophyletic Gryllidae based on mtgenome sequences. This phenomenon may be explained by that the mitochondrial non-protein-coding sequences of Orthoptera species, such as tRNA genes with nucleotide conservation were different from protein-coding sequences with relatively fast evolutionary rate, thereby disturbing phylogenetic reconstruction [24]. In addition, the phylogenetic tree based on amino acid showed that Thrinchus schrenkii of Pamphagoidea was nested within Acridoidea, which was conflicted with the monophyletism of Acridoidea. As amino acid sequences were usually conserved due to invisible synonymous substitutions in amino acid level, nucleotide sequences may be more reliable for phylogenetic reconstruction of closely related Acridoidea species [25]. These results of phylogenetic trees in 37 Orthopteran species indicated that the best way for phylogenetic reconstruction of Orthoptera was based on the concatenated protein-coding nucleotide sequences, but not the amino acid sequences and entire mtgenomes. As shown in phylogenetic trees based on concatenated protein-coding nucleotide sequences, two Orthopteran suborders, Caelifera and Ensifera, were both recovered as monophyletic groups, which were consisted with previous studies of morphological and molecular data [5]. The phylogenetic relationships of the superfamilies in Caelifera also supported previous results of Flook and Rowell [13]. Besides, a sister group relationship between Tettigonioidea and Rhaphidophoroidea was revealed in Ensifera, which was also consist with the results presented by Fenn et al. [5] and Zhou et al. [26]. The assumption that Gryllidae was basal to all other Ensifera received strong supports.

In conclusion, T. japonica and A. yunnanensis, together with other Orthoptera species, exhibited the same mitochondrial genome organization. The concatenated nucleotide sequences of 13 protein genes were suitable markers for reconstruction of phylogenetic relationship in orthopteroid species. The relationships of Tridactyloidea as sister group of Tetrigoidea in Caelifera and Rhaphidophoroidea as sister group of Tettigonioidea in Ensifera were identified. However, this study was still limited by insufficient species, and their phylogenetic relationships were not accurately identified. Further researches on mtgenome data and morphological characters were still needed to reveal the relationships of Orthoptera species.

Additional file 1: Figure S1. Predicated secondary structure of the 22 tRNA genes of Tetrix japonica.

Additional file 2: Figure S2. Predicated secondary structure of the 22 tRNA genes of Alulatettix yunnanensis.