β-Amyrin synthase from Conyza blinii expressed in Saccharomyces cerevisiae.

Conyza blinii H.Lév. is a widely used medicinal herb in southwestern China. The main pharmacological components of C. blinii are a class of oleanane-type pentacyclic triterpene glycosides known as conyzasaponins, which are thought to be synthesized from β-amyrin. However, no genes involved in the conyzasaponin pathway have previously been identified. Here, we identify an oxidosqualene cyclase (OSC), a β-amyrin synthase, which mediates cyclization of 2,3-oxidosqualene to yield β-amyrin. Ten OSC sequences were isolated from C. blinii transcript tags. Phylogenetic analysis was used to select the tag Cb18076 as the putative β-amyrin synthase, named CbβAS. The open reading frame of CbβAS is 2286 bp and encodes 761 amino acids. Its mature protein contains the highly conserved motifs (QXXXGXW/DCTAE) of OSCs and (MWCYCR) of β-amyrin synthases. Transcription of CbβAS was upregulated 4-24 h after treatment of the seedlings of the C. blinii cultivar with methyl jasmonate. Furthermore, expression of CbβAS in Saccharomyces cerevisiae successfully yielded β-amyrin. The chemical structures and concentrations of β-amyrin were confirmed by GC-MS/MS. The target yeast ultimately produced 4.432 mg·L-1 β-amyrin. Thus, CbβAS is an OSC involved in conyzasaponin biosynthesis.

β‐Amyrin synthase

cycloartenol synthase

dammarenediol synthase

glyceraldehyde‐3‐phosphate dehydrogenase

Gene Ontology

3‐hydroxyl‐3‐methylglutaryl‐CoA

isopentenyl pyrophosphate

lupeol synthase

methyl jasmonate

multireaction monitor

oxidosqualene cyclase

protein family

Polygala tenuifolia Willd. βAS

SC minimal media lacking uracil

universal gene

Conyza blinii H.Lév. is a medicinal herb distributed in southwestern China (Sichuan, Yunnan, and Guizhou provinces). It is well known for its treatment of bronchitis cough and inflammatory diseases. The entirety of the plant can be medicinally prepared and the highest accumulate of its secondary metabolites are conyzasaponins (3.0% w/w, of dry weight). Seventeen conyzasaponins have been isolated from the ethanol extract of C. blinii, of which all are oleanane‐type saponins 1, 2, 3.

The current studies suggest that the synthesis of saponins is divided into four stages: first, the biosynthesis of isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate; second, the biosynthesis of 2, 3‐oxidosqualene; third, the biosynthesis of the basic backbone; fourth, the modification of the backbone ring. The third step is a branch. This step is catalyzed by oxidosqualene cyclases (OSCs) and resulted in multiple saponins backbones, including oleanane type, lupeol type, ursane type. Many OSCs have been reported to have multifunctional activities that can biosynthesize more than one saponins backbone 4, 5, 6. However, one of the OSCs, β‐amyrin synthase, controls flux toward the oleanane‐type backbone (β‐amyrin).

β‐Amyrin synthase (βAS) has been isolated and characterized from many high plants with abundant oleanane‐type saponins. Jin et al. 7 isolated a Polygala tenuifolia Willd. βAS (PtBS) that contained a 2289‐bp reading frame. Expression of PtBS in the yeast led to the production of β‐amyrin as the sole product. The βAS from Artemisia annua expressed in Saccharomyces cerevisiae with manipulation of 3‐hydroxyl‐3‐methylglutaryl‐CoA (HMG‐CoA) reductase and lanosterol synthase produced levels of 6 mg·L−1 culture of β‐amyrin 8. Huang et al. 9 transformed Panax japonicus βAS into rice to produce ‘ginseng rice’, which was capable of producing oleanane‐type sapogenin.

Saccharomyces cerevisiae was widely used as an excellent host for the production of medicinal terpenes because of its mevalonate pathway and safety. Paddon et al. 10 have semisynthesized artemisinin in S. cerevisiae. The production of artemisinic acid, a precursor of artemisinin, reached a level of 25 g·L−1. This technology may increase antimalarial treatments in the developing world. Engels et al. 11 produced 8.7 ± 0.85 mg·L−1 taxadiene by using coexpression of codon‐optimized taxadiene synthase, truncated HMG‐CoA reductase, the UPC2‐1 transcription factor gene, and geranylgeranyl diphosphate synthase in S. cerevisiae. Furthermore, Han et al. 12 combined biosynthesis of protopanaxadiol in S. cerevisiae via coexpression of dammarenediol synthase (DS) and cytochrome P450 monooxygenase. After 2‐day induction, the engineering yeast yielded 17.32 μg·g−1 (FW) protopanaxadiol. In this study, we express a β‐amyrin synthase gene of C. blinii in S. cerevisiae to produce β‐amyrin. The putative biosynthesis pathway for β‐amyrin in native yeast is shown in Fig. 1.

Figure 1

β‐Amyrin biosynthesis pathway engineered in yeast. The CbβAS cyclizes 2,3‐oxidosqualene to β‐amyrin. The enzymes involved in this pathway: AACT, acetyl coenzyme A acetyltransferase; HMGS, 3‐hydroxy‐3‐methylglutaryl coenzyme A synthase; HMGR, 3‐hydroxy‐3‐methylglutaryl coenzyme A reductase; MVK, mevalonate kinase; PMK, phosphor mevalonate kinase; MVD, mevalonate diphosphate decarboxylase; IDI, IPP isomerase; GPPS, geranyl diphosphate synthase; FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; SQE, squalene epoxidase; CbβAS, Conyza blinii β‐amyrin synthase.

Here, we cloned and characterized CbβAS, a β‐amyrin synthase that catalyzes the cyclization of oxidosqualene in the biosynthesis of conyzasaponins. Ectopic expression of CbβAS in INVSc1 yeast successfully yielded β‐amyrin. The results confirm that CbβAS is a β‐amyrin synthase.

Materials and methods

Plant material

Conyza blinii used for gene cloning were collected in 2014 from Panzhihua, Sichuan, China. C. blinii multiple shoots (differentiated by our laboratory) were induced in 1/2 MS culture medium, which containing 0.1 mg·L−1 1‐naphthylacetic acid to obtain aseptic seedling. Seedlings were grown with light and constant temperature at 24 °C. Two months later, plants were treated with either the 100 μmol·L−1 methyl jasmonate (MeJA) or the control ethanol by spraying. Leaves were collected at 0, 2, 4, 8, 12, and 24 h after treatment and then stored at −80 °C.

Cloning of CbβAS

Ten OSC genes were discovered from the C. blinii transcriptome annotation library 13. The phylogenetic analysis was used to select the βAS gene. OSC protein sequences including βAS, DS, CAS, and LUS were retrieved from NCBI. The sequence alignments were performed using clustalw program (http://clustalw.ddbj.nig.ac.jp). The mega 5.05 software 14 was used to build the phylogenetic tree with neighbor‐joining method and 1000 bootstrap replications.

According to the selected sequence, specific primers BAS1 and BAS2 (Table 1) were designed. The 50 μL reaction system included 25 μL PrimeSTAR Max DNA Polymerase Premix (2×) (TaKaRa, Kyoto, Japan), 10 pmol BAS1, 10 pmol BAS2, 100 ng cDNA, and ddH2O. According to the introduction of Max DNA Polymerase, the three‐step PCR program was used to amplify the CbβAS gene. PCR products were then purified (TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0) and sequenced (Invitrogen Trading, Shanghai, China). Afterward, the nucleotide sequence and the deduced amino acid sequence were characterized by bioinformatics tools.

Table 1

Primers used in this study

Primers	Sequence (5′→3′)
Gene cloning primers
BAS1	ATGTGGAGAATGAATATAG
BAS2	CTAGATGCGTTTGAGCTTTGG
Quantitative RT‐PCR primers
GAPDHqF	CGGGATGGCTTTCCGTGTA
GAPDHqR	TTGCCTTCTGATTCCTCCTTGA
BASqF	TTGGCAGTCAAGAGTGGGATG
BASqR	GGAAGGATTGTCTTTGACCTGTGA
Saccharomyces cerevisiae expression primers
BAS3	AAATATgcggccgcATGTGGAGAATGAATATAG
BAS4	TGCtctagaCTAGATGCGTTTGAGCTTTGG

Quantitative RT‐PCR analysis

Methyl jasmonate‐treated leaves were used as samples for qRT‐PCR analysis. The same amount of RNA from samples was used for reverse transcription into the single‐stranded cDNA according to the PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa). The housekeeping gene previously published, glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH; GenBank ID: KF027475) 15, was used as the internal control. The qRT‐PCR primers are in Table 1. A 25 μL reaction system with SYBR Premix Ex Taq II (TaKaRa) was used for quantification on a CFX96 Real‐Time PCR Instrument (Bio‐Rad, Hercules, CA, USA). The method 16 was used to calculate differences among gene expression. The experiments were replicated four times.

Expression of CbβAS in Saccharomyces cerevisiae INVSc1

The expression vector pYES2/NT B (provided by Zongyun Feng, Sichuan Agricultural University) and the S. cerevisiae strain INVSc1 (provided by Zongyun Feng, Sichuan Agricultural University) were used to examine CbβAS function. The open reading frame of CbβAS was amplified with primers BAS3 and BAS4 (Table 1). The PCR products were inserted into the NotI and XbaI restriction sites of the pYES2/NT B vector to construct pYES‐CbβAS recombinant plasmid. The pYES‐CbβAS plasmid was transformed into INVSc1 by electroporation (1.5 kV, 3 ms, 2.5 μF, 200 Ω) 17. After 3 days of growth, single clones of INVSc1 containing pYES‐CbβAS or pYES2/NT B were inoculated in 15 mL of SC minimal media lacking uracil (SC‐U) medium containing 2% glucose. Precultures were grown overnight at 30 °C with shaking at 200 r.p.m. To induce gene expression, the precultures were washed and inoculated into 50 mL of induction medium (SC‐U medium containing 2% galactose) with a starting optical density of 0.4. The cultures were further incubated for 60 h to induce CbβAS expression.

Metabolite extraction for GC‐MS/MS analysis

Extraction of metabolites followed the method previously described by Kirby et al. 8 with some modifications. 50 mL of induction cells was centrifuged at 2739 for 5 min to obtain a cell pellet. The cells were resuspended in 10 mL 20% KOH/50% EtOH (W/V), and the supernatant was discarded. The mixture was boiled for 10 min. After cooling, metabolites were extracted twice using hexane (15 mL). The extracts were combined and analyzed by GC‐MS/MS.

The GC‐MS/MS analysis was performed by 7890B GC model and 7000C MS model (Agilent, Santa Clara, CA, USA). A 1 μL aliquot of the sample was injected (splitless mode) into a HP‐5MS ultra‐inert column (30 m × 0.25 mm × 0.25 μm) (Agilent). The flow rate of helium was 1.5 mL·min−1. The column temperature program was performed using the same method described by Seki et al. 18. For the quantification of β‐amyrin, the secondary MS was used. The ion m/z 189 and m/z 203 were designated as quantitative ion and qualitative ion, respectively. The standard β‐amyrin was purchased from Sigma‐Aldrich (St. Louis, MO, USA).

Results

Phylogenetic analysis of OSCs and cloning of CbβAS

According to the transcriptome analysis, ten tags corresponded to OSC genes (Table 2). Annotation results showed that six tags were predicted to be β‐amyrin synthase. To further determine the βAS gene, we performed the phylogenetic analysis between these tags and OSCs from other plants. The results revealed that tag Cb18076 was homologous to β‐amyrin synthase from Aster sedifolius, which has been reported to only produce β‐amyrin in yeast 19 (Fig. 2). The tags Cb54088, Cb70382, Cb827, and Cb874 were phylogenetically related to Ricinus communis LUS 20. Cb72002 was similar to LUS from Kalanchoe daigremontiana, which produces lupeol and β‐amyrin in a ratio of 13 : 1 21. In addition, another four tags Cb34533, Cb35585, Cb38895, and Cb46070 were homologous to DS from the Panax species, which is involved in the ginsenoside biosynthetic pathway 22, 23. Therefore, we selected the Cb18076 tag as a β‐amyrin synthase gene.

Table 2

The tags corresponding to OSC genes and the annotations of them. GO, Gene Ontology; Pfam, protein family

Gene ID	GO annotation	Pfam annotation	SwissProt annotation	Nr annotation
Cb18076	GO:0019745	Prenyltransferase and squalene oxidase repeat	Beta‐amyrin synthase GN = OSCBPY OS = Betula platyphylla (Asian white birch) PE = 1 SV = 1	Beta‐amyrin synthase (Aster sedifolius)
	GO:0042300
Cb34533	GO:0008152	–	Dammarenediol II synthase GN = PNA OS = Panax ginseng (Korean ginseng) PE = 1 SV = 1	OSC2 (Artemisia annua)
	GO:0016021
	GO:0016829
	GO:0016866
Cb35585	GO:0008152	Prenyltransferase and squalene oxidase repeat	Dammarenediol II synthase GN = PNA OS = Panax ginseng (Korean ginseng) PE = 1 SV = 1	OSC2 (A. annua)
	GO:0016866
Cb38895	GO:0003824	Prenyltransferase and squalene oxidase repeat	Dammarenediol II synthase GN = PNA OS = Panax ginseng (Korean ginseng) PE = 1 SV = 1	OSC2 (A. annua)
Cb46070	GO:0008152	–	Dammarenediol II synthase GN = PNA OS = Panax ginseng (Korean ginseng) PE = 1 SV = 1	OSC2 (A. annua)
	GO:0016021
	GO:0016829
	GO:0016866
Cb54088	GO:0008152	–	Beta‐amyrin synthase GN = OSCBPY OS = Betula platyphylla (Asian white birch) PE = 1 SV = 1	PREDICTED: beta‐amyrin synthase‐like (Fragaria vesca subsp. vesca)
	GO:0016866
Cb70382	GO:0016104 GO:0042299	–	Lupeol synthase GN = LUS OS = Bruguiera gymnorhiza (Burma mangrove) PE = 1 SV = 1	PREDICTED: beta‐amyrin synthase‐like (Prunus mume)
Cb72002	GO:0008152	–	Beta‐amyrin synthase 1 GN = OSCPNY1 OS = Panax ginseng (Korean ginseng) PE = 1 SV = 1	PREDICTED: beta‐amyrin synthase‐like (F. vesca subsp. vesca)
	GO:0016866
Cb827	GO:0008152	Prenyltransferase and squalene oxidase repeat	Beta‐amyrin synthase GN = OSCBPY OS = Betula platyphylla (Asian white birch) PE = 1 SV = 1	PREDICTED: beta‐amyrin synthase‐like (F. vesca subsp. vesca)
	GO:0016866
Cb874	GO:0008152	–	Beta‐amyrin synthase GN = OSCBPY OS = Betula platyphylla (Asian white birch) PE = 1 SV = 1	PREDICTED: beta‐amyrin synthase‐like (F. vesca subsp. vesca)
	GO:0016866

Figure 2

A phylogenetic tree between Conyza blinii OSCs and other plant OSCs. The OSCs from C. blinii have been marked with triangle, blocks, and circles. The species abbreviations are As, Aster sedifolius; Aa, Artemisia annua; Pj, Panax japonicus; Sl, Solanum lycopersicum; Ks, Kalopanax septemlobus; Ae, Aralia elata; Pg, Panax ginseng; Si, Sesamum indicum; Vv, Vitis vinifera; Bp, Betula platyphylla; Mt, Medicago truncatula; Gg, Glycyrrhiza glabra; Lj, Lotus japonicus; Rc, Ricinus communis; At, Arabidopsis thaliana; Kd, Kalanchoe daigremontiana; Eg, Erythranthe guttata; Pv, Panax vietnamensis; Pq, Panax quinquefolius; Ps, Panax sokpayensis; Cr, Chlamydomonas reinhardtii; Cp, Cucurbita pepo.

The cDNA of Cb18076 was cloned and we renamed it as CbβAS. The open reading frame of CbβAS (GenBank ID: KX907781) was 2286 bp and encoded an 87.7‐kDa protein. The sequence alignment between CbβAS and other plant βAS revealed 85.68% similarity (Fig. 3). The mature protein contained highly conserved motifs (QXXXGXW/DCTAE) of OSCs 24, 25. Its secondary structure was predicted by the SOPMA method (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_sopma.html). The most abundant structures were alpha helices (42.84%), then 31.41% random coils, 15.9% extended strands, and 9.86% beta turns.

Figure 3

Alignment of the deduced amino acid sequences of Conyza blinii βAS and βAS from Artemisia annua (ACB87531.1), Lotus japonicus (AAO33580.1), Medicago truncatula (CAD23247.1), and Panax ginseng (BAA33461.1). The 100% homology levels of the residues are shaded in black, and ≥ 75% homology levels of the residues are shaded in gray. The QXXXGXW motifs and DCTAE motif are indicated by arrows and hyphen, respectively.

Expression of CbβAS gene following treatment by MeJA

Methyl jasmonate is used as an exogenous elicitor that can enhance the content of secondary metabolites such as saponins 26, 27 and the transcription levels of genes involved in saponins biosynthesis 12, 28. Therefore, to identify whether CbβAS gene involved in conyzasaponins pathway, we investigated expression of CbβAS after elicitation by MeJA using qRT‐PCR (Fig. 4). The transcript level of CbβAS at 24 h was 2.8‐fold higher than at 0 h. Furthermore, MeJA‐treated CbβAS transcript levels were six times higher than those of EtOH‐treated CbβAS at 24 h. CbβAS expression was significantly upregulated by MeJA. The results preliminarily confirm that CbβAS is involved in conyzasaponins biosynthetic pathway.

Figure 4

Expression analysis of the CbβAS gene in Conyza blinii seedling under EtOH and MeJA treatments. The quantitative real‐time PCR assay was used to examine the CbβAS relative transcription levels at 0, 2, 4, 8, 12, and 24 h. The expression level of CbβAS in no treated seedling was set as control. Standard deviation was calculated by spss software (IBM Corporation, Armonk, NY, USA).

Functional characterization of CbβAS

To detect the activity of CbβAS, the recombinant plasmid pYES‐CbβAS was constructed. The pYES‐CbβAS plasmid was then expressed in INVSc1 under the control of GAL1 promoter. To verify the function of CbβAS, the yeast extracts were examined by GC‐MS. The GC retention time showed that at 19.5 min, pYES‐CbβAS strain and standard β‐amyrin appeared a peak, while the pYES strain did not (Fig. 5). The MS spectrum then confirmed that the peak detected in pYES‐CbβAS transgenic strain was β‐amyrin (Fig. 6).

Figure 5

GC chromatograms of yeast extracts. (A) Chromatograms of yeast extracts with an empty pYES2/NT B vector. (B) Chromatograms of standard β‐amyrin. (C) Chromatograms of yeast extracts with pYES‐CbβAS.

Figure 6

MS spectrum and structure of β‐amyrin. (A) MS spectrum of β‐amyrin produced in pYES‐CbβAS yeast. (B) MS spectrum and structure of the β‐amyrin standard.

GC‐MS/MS is an advanced detection system that provides high sensitivity for achieving very low detection thresholds. The precursor ion 203 m/z and daughter ion 105.1 m/z were used to detect β‐amyrin. Simultaneously precursor ion 189 m/z and daughter ion 119.1 m/z were used for quantification analysis (Fig. 7). The results showed that the pYES‐CbβAS yeast yielded 4.432 mg·L−1 β‐amyrin after induction by galactose for 60 h in 50 mL medium.

Figure 7

Multireaction monitor (MRM) analysis of 19.5‐min peak. (A) MRM analysis of β‐amyrin standard. (B) MRM analysis of pYES‐CbβAS yeast. (C) MRM analysis of pYES2/NT B control yeast.

Discussion

Currently, Chinese herbal medicine has become increasingly popular due to their abundant primary and secondary metabolites. These metabolites can be used to treat many diseases and have little side effects. However, the natural plants yield low contents of metabolites and require a long time to grow, which hampered the applications of the pharmacologically active compounds. Therefore, synthetic biology is an effective way to solve this contradiction 29. For example, the popular anticancer drug taxol 30, 31, 32 and the antimalarial drug artemisinin 33, 34, 35 are both successfully biosynthesized by microorganisms. The major pharmacological compound of C. blinii to be used in Chinese traditional medicine is conyzasaponins. However, there is a lack of information on the biosynthetic pathways of a majority of pharmacologically active compounds in C. blinii, especially conyzasaponins. In this study, we investigated this specific pathway by cloning and characterizing a βAS gene involved in it. To our knowledge, this is first study on conyzasaponins pathway.

Previous reports indicated that the DCTAE motif is highly conserved in eukaryotic OSCs. This motif is responsible for initiating the polycyclization reaction of squalene epoxide 36. The acidic carboxyl residue Asp in this motif releases protons to attack on the terminal epoxide ring of 1, which triggers a cascade of the ring‐forming reaction. The sequence analysis results of CbβAS suggest that it is an OSC. Besides, the MWCYCR is a characteristic motif of β‐amyrin synthase 37. In this motif, the Trp residue controls β‐amyrin formation by stabilization of oleanyl cation and the Tyr residue is involved in producing pentacyclic triterpenes. Therefore, the MWCYCR motif in CbβAS (Fig. 3) indicated that it is a special OSC, β‐amyrin synthase.

The preliminary functional verification of CbβAS is carried out by qRT‐PCR after the treatment of MeJA. Hayashi et al. 26 previously described that MeJA treatment can upregulate βAS mRNA levels and enhance the accumulation of soyasaponin (oleanane‐type triterpene saponin). Another report described by Liu et al. 38 also indicated that MeJA treatment upregulated the Gentiana straminea βAS expression levels and oleanolic acid accumulations. Conclusively, MeJA treatment can stimulate the accumulation of oleanane‐type saponins or sapogenins and the expression level of βAS gene. Therefore, if CbβAS is involved in the conyzasaponins pathway, its expression level will be upregulated by MeJA treatment. The qRT‐PCR results confirmed this conjecture that CbβAS is an enzyme involved in conyzasaponins formation.

We expressed CbβAS in S. cerevisiae to determine its function. GC‐MS/MS analysis showed that genetically engineered yeast with CbβAS produced 4.432 mg·L−1 β‐amyrin. Currently, the highest β‐amyrin titer achieved by microbial fermentation is 107.0 mg·L−1 39. And the others indicated that by introducing βAS of A. annua 8 and Pisum sativum 40, the engineered S. cerevisiae produced 6 and 3.93 mg·L−1 β‐amyrin, respectively. The β‐amyrin yield of CbβAS transgenic yeast compared with earlier is not high. Modification of promoter and coexpression of genes involved in β‐amyrin pathway can be solutions to increase β‐amyrin contents.

In addition, further research on cytochrome P450 genes and glycosyltransferase genes involved in the conyzasaponins biosynthetic pathway is required to expand upon our results to utilize synthetic biology to produce conyzasaponins.

Author contributions

HC and QW conceived and designed research. RS wrote the manuscript. SL provided C. blinii samples. ZZT and CLL contributed reagents or analytical tools. TRZ and TW performed the experiments. All authors read and approved the manuscript.