| Literature DB >> 28979335 |
Hamid Reza Aslani1, Shadi Ziaie1,2, Jamshid Salamzadeh1, Sara Zaheri3, Fariba Samadian2, Shayan Mastoor-Tehrani4.
Abstract
Human cytomegalovirus (CMV) remains the most common infection affecting organ transplant recipients. Despite advances in the prophylaxis and acute treatment of CMV, it remains an important pathogen affecting the short- and long-term clinical outcome of solid organ transplant recipient. The emergence of CMV resistance in a patient reduces the clinical efficacy of antiviral therapy, complicates therapeutic and clinical management decisions, and in some cases results in loss of the allograft and/or death of the patient. Common mechanisms of CMV resistance to ganciclovir have been described chiefly with the UL97 mutations. Here we evaluate Incidence of ganciclovir resistance in 144 CMV-positive renal transplant recipients and its association with UL97 gene mutations. Active CMV infection was monitored by viral DNA quantification in whole blood, and CMV resistance was assessed by UL97 gene sequencing. Six mutations in six patients were detected. Three patients (2.6%) of 112 patients with history of ganciclovir (GCV) treatment had clinical resistance with single UL97 mutations at loci known to be related to resistance (including mutations at codon 594, codon 460, and codon 520). three patients who were anti-CMV drug naïve had single UL97 mutations (D605E) without clinical resistance. Our results confirm and extend our earlier findings on the specific mutations in the UL97 phosphotransferase gene in loci that have established role in ganciclovir resistance and also indicate that clinical ganciclovir resistance due to UL97 gene mutations is an issue in subjects with history of with ganciclovir treatment. D605E mutations remains a controversial issue that needs further investigations.Entities:
Keywords: Cytomegalovirus; Mutations; Resistance; Transplant Recipients; UL97; ganciclovir
Year: 2017 PMID: 28979335 PMCID: PMC5603891
Source DB: PubMed Journal: Iran J Pharm Res ISSN: 1726-6882 Impact factor: 1.696
Primers used for UL97 gene amplification and sequencing
|
|
|
|
|
| UL97 | First-round PCR (outer primers) | UL97PCR1S | F: GTGCTCACGGTCTGGATGT |
| UL97 | Second-round PCR (inner primers) and sequence reaction | UL97PCR2S | F: GCACAACGTCACGGTACATC |
Patient’s characteristics, viral loads, and CMV UL97 phosphotransferase mutations
|
|
|
|
|
|
|
|
|
|
|---|---|---|---|---|---|---|---|---|
| 1 | F | UL97 | A594V | 9×104 | YES | NO | 95 | Allograft loss |
| 2 | M | UL97 | M460T | 4.6×104 | YES | NO | 184 | Allograft loss |
| 3 | M | UL97 | H520Q | 8×106 | YES | NO | 166 | Allograft loss |
| 4 | F | UL97 | D605E | 4 × 103 | NO | NO | 0 | No relapse |
| 5 | M | UL97 | D605E | 3.6 × 103 | NO | NO | 0 | No relapse |
| 6 | M | UL97 | D605E | 4.2 × 104 | NO | NO | 0 | No relapse |
Cumulative duration of induction and intravenous or oral maintenance treatments.