| Literature DB >> 28979283 |
Jun Yuan1,2, Jun Meng1,2, Xiao Liang1,2, Yang E1,2, Xu Yang1,2, Wenfu Chen1,2.
Abstract
Biochar is known to have a number of positive effects on plant ecopn>hysiology. However, limited research has been carried out to date on the effects and mechanisms of biochar on plant ecophysiology under abiotic stresses, especially responses to cold. In this study, we report on a series of experiments on rice seedlings treated with different concentrations of biochar leacheates (between 0 and 10% by weight) under cold stress (10°C). Quantitative real-time PCR (qRT-PCR) and cold-resistant physiological indicator analysis at low temperatures revealed that the cold tolerance of rice seedlings increased after treatment with high concentrations of biochar leacheates (between 3 and 10% by weight). Results also show that the organic molecules in biochar leacheates enhance the cold resistance of plants when other interference factors are excluded. We suggest that the positive influence of biochar on plant cold tolerance is because of surface organic molecules which likely function by entering a plant and interacting with stress-related proteins. Thus, to verify these mechanisms, this study used gas chromatography-mass spectrometry (GC-MS) techniques, identifying 20 organic molecules in biochar extracts using the National Institute of Standards and Technology (NIST) library. Further, to illustrate how these organic molecules work, we utilized the molecular docking software Autodock to show that the organic molecule 6-(Methylthio)hexa-1,5-dien-3-ol from biochar extracts can dock with the stress-related protein zinc-dependent activator protein (ZAP1). 6-(Methylthio)hexa-1,5-dien-3-ol has a similar binding mode with the ligand succinic acid of ZAP1. It can be inferred that the organic molecule identified in this study performs the same function as the ZAP1 ligand, stimulating ZAP1 driving cold-resistant functions, and enhancing plant cold tolerance. We conclude that biochar treatment enhances cold tolerance in rice seedlings via interactions between organic molecules and stress related proteins.Entities:
Keywords: GC/MS; biochar; cold stress; molecular docking; rice seedlings
Year: 2017 PMID: 28979283 PMCID: PMC5611414 DOI: 10.3389/fpls.2017.01624
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Physical and chemical properties of biochar leacheates.
| EC (μs/cm) | 10.6 | 11.3 | 12.1 | 13.4 | 14.1 |
| PH (units) | 7.23 | 7.35 | 7.50 | 7.82 | 7.96 |
| K | 3.231 | 3.255 | 3.317 | 3.324 | 3.352 |
| Na | 3.163 | 3.172 | 3.187 | 3.189 | 3.194 |
| Mg | 0.022 | 0.024 | 0.025 | 0.031 | 0.035 |
| Ca | 0.036 | 0.036 | 0.037 | 0.039 | 0.041 |
| Cu | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 |
| Fe | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 |
| Zn | 0.000 | 0.000 | 0.000 | 0.000 | 0.000 |
| B | 0.001 | 0.001 | 0.001 | 0.002 | 0.003 |
| P | 0.001 | 0.001 | 0.002 | 0.003 | 0.005 |
| N-NO3 | 0.0001 | 0.0003 | 0.0003 | 0.0004 | 0.0006 |
| N-NH4 | 0.0000 | 0.0000 | 0.0000 | 0.0001 | 0.0002 |
| TOC | 45.2 | 48.5 | 52.1 | 56.8 | 62.7 |
Soil characteristics.
| Moisture (%) | 50% |
| OM (%) | 42% |
| P (g/kg) | 13 |
| N (g/kg) | 15 |
| K (g/kg) | 12 |
| Si (g/kg) | 0.3 |
| PH | 6.6 |
| Mg (g/kg) | 12 |
List of primers used in this study.
| CTCGAGCAGAGCAAATACAG | |
| AGTAGTGTCCGTACAGTACC | |
| TCCAAGTCTCCAACCTCAGC | |
| CCCCCAATTTCTGGAGAATC | |
| ATGGAGCACAAGGAGACT | |
| CTAAATTTTGTCAAGTTTCTC | |
| ATGAGCTCTCTATGCCCCTTTGCCA | |
| CTTGTCATCCAATTGTTT TTGTAGA | |
| GGGCTGAAACGCACAGGCAAGA | |
| CTGCTTGGCGTGCTTCTGC | |
| CATCGTGCCCGGTGAAGAAGAA | |
| AATTCGGGCAGCTTCTGGAGGAT | |
| ACCACAGGTATTGTGTTGGACTC | |
| AGAGCATATCCTTCATAGATGGG |
List of polar and non-polar organic solvents used in this study.
| Chloroform | Hexanes |
| Ethanol | Heptanes |
| Acetonitrile | |
| Methanol | |
| Ethyl acetate | |
| Dichloromethane |
Phenotypic parameters for one part of each 5-day-old rice plant grown at 10°C for 3 weeks.
| Plant height (cm) | 10.56 ± 0.89 | 8.8 ± 0.96 | 11.86 ± 1.76 | 13.44 ± 0.59 | 15.14 ± 1.15 | 16.14 ± 0.23 |
| Dry weight (mg) | 23.6 ± 0.6 | 22.3 ± 0.5 | 24.6 ± 0.7 | 25.5 ± 0.5 | 26.8 ± 0.4 | 29.6 ± 0.9 |
| Root length (cm) | 1.76 ± 0.13 | 1.46 ± 0.18 | 1.97 ± 0.11 | 2.24 ± 0.05 | 2.52 ± 0.10 | 2.69 ± 0.08 |
| Chlorophyll (mg/g FW) | 8.83 ± 0.29 | 7.58 ± 0.04 | 9.06 ± 0.27 | 10.27 ± 0.74 | 11.31 ± 0.41 | 11.95 ± 0.47 |
The error bars in this table are SE, while asterisks indicate statistically significant differences from the control (n = 10,
P < 0.05,
P < 0.01).
Figure 1High concentrations of biochar leacheates impart enhanced cold tolerance. Rice plants were subject to different concentrations of biochar leacheates (i.e., control, 1, 3, 5, 7, and 10%). One part of each 5-day-old rice plants was then grown at 10°C for 3 weeks, while non-cold-stressed plants were grown at 28°C for 2 days, following 28°C treatment for 5 days. This figure shows different plant phenotypes.
Figure 2High concentrations of biochar leacheates modulate physiological indexes in response to cold stress. Subsequent to 5 days at 28°C, rice plants were grown at 10°C for 3 weeks. (A) MDA concentration, (B) H2O2 concentration, (C) SOD activity, (D) POD activity, (E) CAT activity, (F) soluble sugar content, (G) proline content. All data are means ± standard error (SE) while asterisks indicate statistically significant differences from the control (n = 3, *P < 0.05, **P < 0.01).
Figure 3High concentrations of biochar leacheates activate cold response genes in rice seedlings. RT-PCR results performed using cDNA from 5-day-old rice plants grown at 10°C for 3 weeks. Error bars indicate SE (n = 3). Asterisks indicate statistically significant differences from control (*P < 0.05, **P < 0.01).
Figure 4Total ion chromatogram of rice husk fast pyrolysis of at 400°C.
Compounds from biochar extracts identified by GC-MS.
| Dichloromethane | 2.087 | Pyrrole[1,2-a]quinoline-1-ethanol, dodecahydro-6-(2,4-pentadienyl)-, [1R-[1.alpha.,3a.beta.,5a.alpha.,6.alpha.(Z),9a.alpha.]]- | C19H31NO | 289 | 49.163 |
| 2.260 | Pentanamide, 2-(dimethylamino)-4-methyl-N-[2-methyl-1-[[3,3a,11,12,13,14,15,15a-octahydro-12,15-dioxo-13-(phenylmethyl)-5,8-ethenopyrrolo[3,2-b][1,5,8]oxadiazacyclotetradecin-1(2H)-yl]carbonyl]butyl]- | C36H49N5O5 | 631 | 42.492 | |
| 2.755 | Pyridine | C5H5N | 79 | 0.022 | |
| 4.523 | 6-(Methylthio)hexa-1,5-dien-3-ol | C7H12OS | 144 | 0.118 | |
| 5.759 | Formamide, N,N-diethyl- | C5H11NO | 101 | 0.177 | |
| 5.925 | Ethanamine, N-pentylidene- | C7H15N | 113 | 0.170 | |
| 6.666 | trans-2,4-Dimethylthiane, S,S-dioxide | C7H14O2S | 162 | 0.076 | |
| 7.022 | Acetamide, N,N-diethyl- | C6H13NO | 115 | 0.111 | |
| 7.158 | 2,2-Diethylacetamide | C6H13NO | 115 | 0.040 | |
| 7.821 | Cyclopentanone, 2-(1-methylpropyl)- | C9H16O | 140 | 0.014 | |
| 16.096 | 2-Acetyl-5-methylfuran | C7H8O2 | 124 | 0.018 | |
| 18.441 | Tritetracontane | C43H88 | 604 | 0.012 | |
| Methyl alcohol | 2.124 | Pentanamide, 2-(dimethylamino)-4-methyl-N-[2-methyl-1-[[3,3a,11,12,13,14,15,15a-octahydro-12,15-dioxo-13-(phenylmethyl)-5,8-ethenopyrrolo[3,2-b][1,5,8]oxadiazacyclotetradecin-1(2H)-yl]carbonyl]butyl]- | C36H49N5O5 | 631 | 79.126 |
| 2.225 | Pyrrolidin-2-one, 1-[1-(4-carbomethoxyphenyl)butan-1-ol-2-yl]- | C15H12Cl2O3 | 310 | 0.0.230 | |
| 5.153 | 6-(Methylthio)hexa-1,5-dien-3-ol | C7H12OS | 144 | 0.518 | |
| 5.741 | Ethanamine, N-pentylidene- | C7H15N | 113 | 0.116 | |
| Ethyl alcohol | 2.076 | (1R,2R,4S)-2-(6-Chloropyridin-3-yl)-7-azabicyclo[2.2.1]heptane | C11H13ClN2 | 208 | 1.556 |
| 3.149 | 6-(Methylthio)hexa-1,5-dien-3-ol | C7H12OS | 144 | 1.871 | |
| 3.938 | Formamide, N,N-diethyl- | C5H11NO | 101 | 1.725 | |
| 4.169 | 1,2-Dimethylaziridine | C4H9N | 71 | 2.151 | |
| 4.892 | Acetamide, N,N-diethyl- | C6H13NO | 115 | 0.912 | |
| 5.198 | Pyrrole, 2-(4-methyl-5-cis-phenyl-1,3-oxazolidin-2-yl)- | C14H16N2O | 228 | 1.027 | |
| Chloroform | 2.101 | 4,6-Dimethyl-2-thioxo-1,2-dihydro-3-pyridinecarbonitrile tbdms | C14H22N2SSi | 278 | 48.326 |
| 2.241 | Pentanamide, 2-(dimethylamino)-4-methyl-N-[2-methyl-1-[[3,3a,11,12,13,14,15,15a-octahydro-12,15-dioxo-13-(phenylmethyl)-5,8-ethenopyrrolo[3,2-b][1,5,8]oxadiazacyclotetradecin-1(2H)-yl]carbonyl]butyl]- | C36H49N5O5 | 631 | 42.529 | |
| 4.414 | 6-(Methylthio)hexa-1,5-dien-3-ol | C7H12OS | 144 | 0.146 | |
| 5.462 | Formamide, N,N-diethyl- | C5H11NO | 101 | 0.213 | |
| 5.757 | 1-Oxa-4-azaspiro[4.5]decan-4-oxyl, 3,3-dimethyl-8-oxo- | C10H16NO3 | 198 | 0.191 | |
| 7.021 | 2-Propanamine, N,N-dimethyl- | C5H13N | 87 | 0.113 | |
| Acetonitrile | 2.940 | 6-(Methylthio)hexa-1,5-dien-3-ol | C7H12OS | 144 | 1.160 |
| 3.650 | Formamide, N,N-diethyl- | C5H11NO | 101 | 1.455 | |
| 3.861 | Ethanamine, N-pentylidene- | C7H15N | 113 | 2.480 | |
| 4.538 | Acetamide, N,N-diethyl- | C6H13NO | 115 | 1.036 | |
| 4.814 | 2,2-Diethylacetamide | C6H13NO | 115 | 1.544 | |
| 4.948 | Cyclopentanone, 2-(1-methylpropyl)- | C9H16O | 140 | 6.247 | |
| Ethyl acetate | 2.932 | 6-(Methylthio)hexa-1,5-dien-3-ol | C7H12OS | 144 | 2.424 |
| 3.649 | Formamide, N,N-diethyl- | C5H11NO | 101 | 2.005 | |
| 3.862 | Ethanamine, N-pentylidene- | C7H15N | 113 | 3.018 | |
| 4.529 | Acetamide, N,N-diethyl- | C6H13NO | 115 | 1.089 | |
| n-hexane | 2.057 | Cyclopentane, 1,2,3-trimethyl- | C8H16 | 112 | 100 |
| n-heptane | – | – | – | – | – |
Figure 5Structural diagrams for 14 candidate organic molecules from biochar extracts.
Figure 6Docked ZAP1 active site with 6-(Methylthio)hexa-1,5-dien-3-ol and succinic acid. (A) Succinic acid docked with the ZAP1 active site, (B) 6-(Methylthio)hexa-1,5-dien-3-ol and succinic acid docked with ZAP1. These images were drawn using the software PyMOL.