Josué Álvaro-Blanco1, Katia Urso2, Yuri Chiodo1, Carla Martín-Cortázar1, Omar Kourani1, Pablo Gómez-Del Arco2,3,4, María Rodríguez-Martínez1, Esther Calonge5, José Alcamí5, Juan Miguel Redondo2,4, Teresa Iglesias6,7, Miguel R Campanero1,4. 1. Department of Cancer Biology, Instituto de Investigaciones Biomédicas Alberto Sols, CSIC-UAM, Madrid 28029, Spain. 2. Gene regulation in cardiovascular remodeling and inflammation group, Centro Nacional de Investigaciones Cardiovasculares, Madrid 28029, Spain. 3. Department of Molecular Biology, Universidad Autónoma de Madrid, Centro de Biología Molecular, Cantoblanco, Madrid 28049, Spain. 4. CIBERCV, Spain. 5. Unidad de Inmunopatología del SIDA, Centro Nacional de Microbiología, Majadahonda 28220, Spain. 6. Department of Endocrine and Nervous Systems Pathophysiology, Instituto de Investigaciones Biomédicas Alberto Sols, CSIC-UAM, Madrid 28029, Spain. 7. CIBERNED, Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas, Spain.
Abstract
Most E2F-binding sites repress transcription through the recruitment of Retinoblastoma (RB) family members until the end of the G1 cell-cycle phase. Although the MYB promoter contains an E2F-binding site, its transcription is activated shortly after the exit from quiescence, before RB family members inactivation, by unknown mechanisms. We had previously uncovered a nuclear factor distinct from E2F, Myb-sp, whose DNA-binding site overlapped the E2F element and had hypothesized that this factor might overcome the transcriptional repression of MYB by E2F-RB family members. We have purified Myb-sp and discovered that Myc-associated zinc finger proteins (MAZ) are major components. We show that various MAZ isoforms are present in Myb-sp and activate transcription via the MYB-E2F element. Moreover, while forced RB or p130 expression repressed the activity of a luciferase reporter driven by the MYB-E2F element, co-expression of MAZ proteins not only reverted repression, but also activated transcription. Finally, we show that MAZ binds the MYB promoter in vivo, that its binding site is critical for MYB transactivation, and that MAZ knockdown inhibits MYB expression during the exit from quiescence. Together, these data indicate that MAZ is essential to bypass MYB promoter repression by RB family members and to induce MYB expression.
Most E2F-binding sites repress transcription through the recruitment of Retinoblastoma (RB) family members until the end of the G1 cell-cycle phase. Although the MYB promoter contains an E2F-binding site, its transcription is activated shortly after the exit from quiescence, before RB family members inactivation, by unknown mechanisms. We had previously uncovered a nuclear factor distinct from E2F, Myb-sp, whose DNA-binding site overlapped the E2F element and had hypothesized that this factor might overcome the transcriptional repression of MYB by E2F-RB family members. We have purified Myb-sp and discovered that Myc-associated zinc finger proteins (MAZ) are major components. We show that various MAZ isoforms are present in Myb-sp and activate transcription via the MYB-E2F element. Moreover, while forced RB or p130expression repressed the activity of a luciferase reporter driven by the MYB-E2F element, co-expression of MAZ proteins not only reverted repression, but also activated transcription. Finally, we show that MAZ binds the MYB promoter in vivo, that its binding site is critical for MYB transactivation, and that MAZ knockdown inhibits MYBexpression during the exit from quiescence. Together, these data indicate that MAZ is essential to bypass MYB promoter repression by RB family members and to induce MYBexpression.
The proto-oncogene MYB was initially identified as a frequent integration site for avian and murine retroviruses, leading to a range of leukemias (1). In addition, MYB overexpression was found in several other cancer types, including neuroblastoma, melanoma, glioblastoma and neoplasias from colon, pancreas and breast (2,3). MYB encodes a sequence-specific DNA-binding transcriptional regulator that is highly expressed in embryonic nervous system, liver, kidney and colon mucosa. In the adult, its expression levels are high in epithelial progenitor cells in colon crypts; hematopoietic progenitors; activated mature T and B lymphocytes; and ependymal cells, progenitor cells and some neuroblasts located at neurogenic regions in the subventricular zone of adult brain (2,3). MYB, also known as proto-oncogene C-MYB, plays a central role in the regulation of hematopoietic cell development, and the control of its expression is critically important in cell proliferation and differentiation of both normal and tumor cells. Indeed, MYB anti-sense oligonucleotides inhibit cell proliferation and its forced expression blocks cell differentiation (3,4). In addition, the analysis of Myb-targeted mice demonstrated a critical role for Myb in fetal hematopoiesis and colon development (1,3).In normal cells, MYBexpression is tightly regulated at transcriptional and post-transcriptional levels. However, in spite of its critical relevance, the regulation of MYBexpression is not well understood. MYB is not expressed in quiescent cells, but its transcription is promoted shortly after the stimulation of cell proliferation. Its promoter lacks canonical TATAA and CAAT boxes, but harbors several GC boxes and binding sites for various transcriptional regulators. In particular, the human and mouse promoters contain a binding site for members of the E2F family of transcriptional regulators (5,6). This family plays a central role in cell cycle regulation by restricting genes expression to the precise time of the cell cycle in which their products are required (7). Most E2F factors are composed of two subunits, termed E2F and declustering potential (DP), which form heterodimeric complexes. Eight E2F genes (E2F1-E2F8) and two DP genes (DP1 and DP2) are expressed in mammals. The Retinoblastoma tumor suppressor protein (RB) and its family members p107 and p130 bind to E2F factors and block their transactivation capacity. The recruitment of RB family members to gene promoters exerts a dominant negative effect on their transcription due to the association of RB and its family members with chromatin remodelers (8,9). The RB family member p130 is particularly essential, as a component of the dimerization partner, RB-like, E2F and multi-vulval class B (DREAM) complex, for repression of E2F-regulated genes in quiescent cells (9,10). RB family members are inactivated by phosphorylation mediated by cyclin-dependent kinases (CDKs) at the G1-S boundary and thus release E2F repressors from promoters and enable transcriptional activation (7). As a consequence, most genes that contain E2F elements are not transcriptionally activated before the G1-S transition. MYB, however, is an exception to this rule; although MYB contains an E2F element and can be induced by forced E2F1expression (6), its induction occurs early after the exit from quiescence (11,12), before RB family inactivation and remains constitutive in subsequent cell cycles (12). These results indicated that MYB is able to escape from the dominant transcriptional repression of E2F–RB family complexes during specific times of G1.We hypothesized that the interaction of proteins distinct from E2F with the MYB-E2F site might account for the early activation of its promoter. We had previously discovered a nuclear factor, referred to as Myb-sp, that contained no E2F/DP or RB family members and specifically interacted with the MYB-E2F site, but not with the E2F element from other promoters (5). However, the identity of this factor remained elusive. Here we have identified Myc-associated zinc finger proteins (MAZ) as major components of Myb-sp and demonstrated their capacity to overcome transcriptional repression by RB family members through the MYB-E2F element. We also show that MAZ proteins are essential mediators of MYB induction during the exit from quiescence.
MATERIALS AND METHODS
Cell culture and preparation of nuclear extracts and in vitro-translated proteins
DG-75 and Jurkat cells were grown in RPMI 1640 medium, whereas Saos-2 and humanembryonic kidney293T (HEK-293T) cells were grown in Dulbecco's modified Eagle's medium. Both media were supplemented with 10% fetal bovine serum (FBS), penicillin, streptomycin and L-glutamine. All cells were maintained at 37°C in a humidified 5% CO2-containing atmosphere. Buffy coats of healthy individuals were obtained from the Madrid Blood Donor Centre (Madrid, Spain). Human peripheral blood lymphocytes (PBLs) were isolated from buffy coats as described previously (13) and then stimulated with 5 μg/ml leucoagglutinin (L4144; Sigma-Aldrich, Madrid, Spain) and cultured in RPMI 1640 medium supplemented with 10% FBS, penicillin, streptomycin, L-glutamine and 50 U/ml of human recombinant interleukin 2 (IL2) (14). Cell cycle synchronization of lymphocytes was done as described (15). Briefly, after 12 days, blast cells were turned quiescent by transferring them to medium without IL2 and 2 days later cells were induced to exit quiescence by stimulation with 5 μg/ml leucoagglutinin plus 50 U/ml of IL2. Institutional Review Board approval was obtained for these studies and all participants provided written informed consent. Nuclear extracts were prepared as previously reported (16). pcDNA3-HA-MAZ-1 or -MAZ-2s were in vitro transcribed and translated by using TnT® coupled reticulocyte lysate systems (L-4610; Promega, Madison, WI, USA) following manufacturer recommendations.
Antibodies and immunoblotting
The anti-MAZMAZ-N12, MAZ-C13, MAZ-C2 and MAZ-123 polyclonal rabbit sera were raised against KLH-conjugated peptides derived from the amino- or carboxy-terminal regions of HumanMAZ proteins. Antibodies against HA (MMS-101P), SMAD2/3 (sc-6032x) and Tubulin (T9026) were purchased from Covance (Covance), Santa Cruz (Santa Cruz, CA, USA) and Sigma-Aldrich, respectively. The anti-DP1polyclonal rabbit antibody was described previously (5). For immunoblotting, we used antibodies to MAZ, MAZ phospho-S460 (sc-16318, Santa Cruz), E2F1 (sc-193x, Santa Cruz), pRB (554136, BD Biosciences Pharmingen), p130 (sc-374521, Santa Cruz), p130 phospho-S672 (ab76255, Abcam), Tubulin (T9026, Sigma-Aldrich) and a combination of RB phospho-S780, phospho-S795 and phospho-S807/811 (8180, 9301 and 8516 from Cell Signaling), followed by peroxidase-conjugated anti-rabbit (A1949) or anti-mouse (A2304) antibodies (Sigma-Aldrich). Chemiluminescent detection reagent (Perkin-Elmer, Waltham, MA, USA) was used and the membrane exposed to X-Ray Medical film.
Electrophoretic mobility shift analysis
Gel shifts were performed with labeled double-stranded oligonucleotides (Sigma–Aldrich) encompassing the E2F elements from the MYB, DHFR and CDC2 promoters. The sequences of these oligonucleotides (5′ to 3′) were: MYB (CTAGACAGATTTGGCGGGAGG GGGG and GATCCCCCCCTCCCGCCAATCTGT); DHFR (CTAGAGCAATTTCGCGCCA AACTTG and GATCCAAGTTTGGCGCGAAATTCGT); and CDC2 (CTAGATTTCTTTCG CGCTCTAGCCG and GATCCGGCTAGAGCGCGAAAGAAAT). The top-strand oligonucleotide sequence (5′ to 3′) of the MYB-E2F mutants was: MYB-Sp (CTAGAC AGATTTATAGGGAGGGGGG), MYB-E2F (CTAGACAGATTTGGCGGGAGATGGG) and MYB-Null (CTAGACAGATTTATAGGGAGATGGG). Binding reactions were performed in buffer D (BFD) (20 mM HEPES pH 7.9, 20% glycerol, 80 mM KCl, 0.2 mM ethylenediaminetetraacetic acid, 0.5 mM dithiothreitol (DTT)) supplemented with sheared salmon sperm DNA and purified bovine serum albumin (BSA), as described previously (13). Unlabeled oligonucleotide competitors (100 ng) and antibodies (1 μg of purified antibodies or 1 μl of crude polyclonal antibodies) were also added to the initial mix prior to the pre-incubation step. Following pre-incubation, the labeled oligonucleotides were added (1 ng) and the mixtures were incubated for another 20 min at room temperature. Samples were then loaded directly onto a running non-denaturing 4% acrylamide-0.1% bisacrylamide gel at 4°C. Retarded complexes were visualized by autoradiography (1–16 h at room temperature).
UV cross-linking experiments
Ultraviolet (UV) cross-linking of DNA/protein complexes was carried out essentially as described (13). Bromodeoxyuridine (BrdU)-substituted 32P-labeled probes were prepared by annealing the oligonucleotide primer UV-common (5′-GATCCACTGAGCCT-3′) with the E2F-c-myb-UV oligonucleotide (CTAGACAGATTTGGC GGGAGGGGGAGGCTCAGTG-3′). Labeling (200 ng) was achieved by a Klenow fill-in reaction performed for 1–2 h at 4°C with [α-32P]dGTP and [α-32P]dCTP and unlabeled dATP and bromo-dUTP (Sigma-Aldrich) in the labeling reaction. Unincorporated nucleotides were removed by chromatography over Sephadex G25. Electrophoretic mobility shift analyses (EMSAs) were performed with the BrdU-substituted probes as described above except that the binding reaction was scaled-up 2-fold. Immediately after electrophoresis, the wet gel was covered with plastic wrap and exposed to UV light (500 mJ) with a Stratalinker 1800 (Agilent Technologies, Santa Clara, CA, USA). The positions of various complexes were determined by 1–2 h autoradiography at 4°C. Gel slices containing various complexes were excised and soaked in 50–100 μl of 2× sodium dodecyl sulfate (SDS) sample buffer at 65°C for 30 min. The samples were boiled for 5 min and electrophoresed through an SDS-8% polyacrylamide gel along with pre-stained molecular weight markers (BioRad Laboratories, Hercules, CA, USA).
Purification and identification of Myb-sp
DNA affinity columns were prepared. Double-strand oligonucleotidesMyb-Sp-ac (5′-CTAGACAGATTTATAGGGAGGGGGG-3′ and 5′-GATCCC CCCCTCCCTATAAATCTGT-3′) or Myb-Null-ac (5′-CTAGACAGATTTATAGGGAGATGGG-3′ and 5′-GATCCCCATCTCCCTA TAAATCTGT-3′) where subjected to 5′-phosphorylation and concatemerized with DNA ligase. The concatemerized DNA (100 μg) was coupled to 1 ml of cyanogen bromide-activated-Sepharose 4B (17–0430-01, Amersham) and loaded onto columns that were then equilibrated in BFD80 (as BFD except that KCl was used at 80 mM). Nuclear extracts from 109 DG-75 cells were pre-cleared by partial protein precipitation with 25% acetone (2 h at 4°C). Acetone was evaporated during 1 h at 4°C in a vacuum chamber and samples were centrifuged 15 min at 17 000 × g at 4°C. Supernatant was dialyzed against BFD80 and then loaded onto a column prepared with Myb-Null-ac-coupled resin. The flow-through was loaded in a column prepared with Myb-Sp-ac-coupled resin and both columns were washed with three volumes of BFD80 supplemented with 1% NP40, two volumes of BFD80, three volumes of BFD150 (as BFD except that KCl was used at 150 mM) and two volumes of BFD80. Bound proteins were eluted with 300 ng/μl of double-strand Myb-Sp-ac oligonucleotides in BFD. All buffers contained 1 mM PMSF, 1 mM Na3VO4 and 1 mM NaF added immediately before use. Eluted proteins were precipitated with 10% tri-chloro-acetic acid and fractionated through 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). A silver-stained band at 30 kDa in the Myb-Sp column was excised from the gel, subjected to tryptic digestion and analyzed by mass spectrometry at the proteomics facility of The Spanish National Center for Biotechnology (CNB-CSIC; Madrid, Spain). Bands of interest were trypsin-digested by automated in-gel digestion in a Proteineer DP (Bruker Daltonics). Tryptic peptides were extracted and analyzed by LC-MS/MS using a nano-HPLC system (Eksigent Technologies nanoLC Ultra 1D plus, AB SCIEX) coupled online to a TripleTOF 5600 mass spectrometer (AB SCIEX) with a nano-spray ionization source. The analytical and trap columns were a nano-Acquity UPLC column (1.7 μm, BEH 130 C18; Waters) and a nanoViper column Acclaim PepMap C18, 5 μm (Thermo Fisher Scientific), respectively. The loading pump delivered 0.1% formic acid in water at 2 μl/min; the nanopump provided a flow rate of 250 nl/min and was operated in gradient elution conditions with 0.1% formic acid in water as mobile phase A, and 0.1% formic acid in acetonitrile (ACN) as mobile phase B. Gradient elution was performed as follows: 98% A:2% B for 1 min, a linear increase to 30% B in 110 min and to 40% B in 10 min, then to 90% B in 5 min; isocratic conditions of 90% B for 5 min and return to initial conditions in 2 min. One-third of the sample was processed by nanoLC-MS in a 5-μl injection volume. Settings for TripleTOF were: ionspray voltage floating (ISVF) = 2800 V, curtain gas (CUR) = 20, interface heater temperature (IHT) = 150, ion source gas 1 (GS1) = 30, DP = 85 V. Data were acquired in an information-dependent acquisition (IDA) mode with Analyst TF 1.7 software (AB SCIEX). For IDA parameters, a MS survey scan (250 ms) in the mass range of 350–1250 m/z was followed by 25 MS/MS scans (100 ms) in the mass range of 100–1500 m/z. Switching criteria set to ions greater than m/z = 350 and smaller than m/z = 1250, with a charge state of 2–5, threshold >90 counts (cps) and dynamic exclusion of 20 s. Collision energy (CE) was set as rolling CE using a parameter script.MS and MS/MS data were processed using Analyst TF 1.7 Software. Raw data were translated to mascot general file (mgf) format using the PeakView program v.1.2 and a Uniprot database (26 March 2014) with human taxonomy restriction (NEWT 9606), containing 39 785 protein-coding genes and their reverse entries in an in-house Mascot Server v.2.5.1 (Matrix Science). Search parameters were as follows: fixed modification of carbamidomethyl cysteine; variable modifications oxidation of methionines and acetylation of the peptide N-termini; peptide mass tolerance ±25 ppm; fragment mass tolerance ±0.05 Da; maximum of two trypsin digestion missed-cleavages. Typical MS and MS/MS spectra accuracy was ±10 ppm. Criteria to accept individual spectra were based on Mascot ion score threshold (0.05) as the standard ion score threshold, and the identification certainty was established using false discovery rate criteria (FDR ≤ 1%) for peptide and protein matches using the Scaffold bioinformatic tool v.4.2.1 (Proteome Software). This cutoff value for protein identification corresponded to a Mascot score of protein identification of 25. A. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (17) partner repository with the dataset identifier PXD006857 and 10.6019/PXD006857.
Construction of vectors
Full-length MAZ-1, MAZ-2 and MAZ-2s coding sequences were obtained by polymerase chain reaction (PCR) amplification from cDNA obtained from DG-75 cells and cloned immediately downstream from the HA-tag into pcDNA3 (ThermoFischer Scientific, Waltham, MA USA). PCR primer sequences (5′-3′) were as follows: MAZ-1/2Forward: CTAACGGGATCCATGTTCCCGGTG TTTCCTTGCACGCTGC; MAZ-1Reverse: CTAACGGAATTCTCACCAGGGTTGGGAGGGA AGTGGC; MAZ-2sForward: TTAACGGGATCCATGGTGCCCCTGAGCCTCCTGAGC; MAZ-2Reverse: TGACTGGAATTCTCAGCAGGTGGGCTGTGGCTGGGGGG. MAZ-1, MAZ-2 and MAZ-2s cDNAs were generated employing, respectively, MAZ-1/2Forward and MAZ-1Reverse, MAZ-1/2Forward and MAZ-2Reverse and MAZ-2sForward plus MAZ-2Reverse.pBG-LUC was described previously (18) and was generated by cloning the ß-globin TATA box immediately upstream from the luciferase gene in the pGL2-basic plasmid. To generate the wild-type (WT) version of 2xE2F/MAZ-Luc and its mutant derivatives, the annealed 2xMYB-WT (CGCGTCAGATTTGGCGGGAGGGGGACAGATTTGGCGGGAGGG GGAA) and (GATCTTCCCCCTCCCGCCAAATCTGTCCCCCTCCCGCCAAATCTGA); 2xMYB-E2F (CGCGTCAGATTTGGCGGGAGATGGACAGATTTGGCGGGAGATGGAA) and (GATCTTCCATCTCCCGCCAAATCTGTCCATCTCCCGCCAAATCTGA); 2xMYB-Sp, (CGC GTCAGATTTATAGGGAGGGGGACAGATTTATAGGGAGGGGGAA) and (GATCTTCCCC CTCCCTATAAATCTGTCCCCCTCCCTATAAATCTGA); and 2xMYB-Null (CGCGTCAGAT TTATAGGGAGATGGACAGATTTATAGGGAGATGGAA) and (GATCTTCCATCTCCCTAT AAATCTGTCCATCTCCCTATAAATCTGA), oligonucleotides were ligated to pBG-LUC, immediately upstream from the ß-globin TATA box.To generate MYBpr-Luc and its mutant derivatives, PCR products encompassing the MYB promoter (−687 to +5 relative to the transcription start site) were obtained from myb(WT)-Luc, myb(E2F)-Luc, myb(myb-sp)-Luc and myb(null)-Luc (5) and cloned into pGL2-Basic. PCR primer sequences were as follows (5′-3′): GACTTCGGATCCGGGAGGGAGTGAA AGCTC and GAAGTCGGATCCTTAAAGTGTAAACTCTGTAAACAG. To generate MYBpr(+205)-Luc and its mutant derivatives, the MYB 5′UTR was obtained from B1-CAT (19) and cloned directly downstream from the WT or mutant versions of the MYB promoter into MYBpr-Luc.Knockdown plasmids were generated by cloning MAZ-specific shRNAs (shMAZ-A and shMAZ-B) or a control shRNA into the lentiviral plasmid, pLVTHM (a gift from D. Trono's lab). The shRNA sequences used (5′-3′) were as follows: shMAZ-A: CGCGTGGTACTGGTGAGGTTTGTCCAATGGCGGCATCTAGAGCCGCCATTGGACAAACCTCACCAGTACCTTTTTTAT and CGATAAAAAAGGTACTGGTGAGGTTTGTCCAATGGC GGCTCTAGATGCCGCCATTGGACAAACCTCACCAGTACCA; shMAZ-B: CGCGTCCCTCA ACAGTCACGTCAGACAAGTGCAATCTAGATGCACTTGTCTGACGTGACTGTTGAGGTGTTTTTTAT and CGATAAAAAACACCTCAACAGTCACGTCAGACAAGTGCATCTAGATTGCA CTTGTCTGACGTGACTGTTGAGGTGA; Control: CGCGTTTAATATCAAGGGACACAATC AGTATTACATCTAGAGTAATACTGCTTGTGTCCCTTGATATTAATTTTTTAT and CGATAA AAAATTAATATCAAGGGACACAATCAGTATTACTCTAGATGTAATACTGCTTGTGTCCCTTGATATTAAA. All plasmids were sequence verified.
Chromatin immunoprecipitation (ChIP)
Chromatin immunoprecipitation (ChIP) was done as described (16) with modifications to enable lymphocytes chromatin fragmentation. Briefly, cells were treated with 1% formaldehyde for 10 min at RT and subsequently with 1.25 M glycine for 5 min. Nuclei were frozen at −80°C before treating them with 0.15 u micrococcal nuclease (8805, Thermo Scientific) for 5 min at 37°C. Reaction was stopped with 1% SDS plus 5 mM Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA). Digested chromatin was sonicated (8 pulses of 30 s) in a sonicator bath and cell debris was eliminated by centrifugation (15 min, 17 000 × g, 4°C). The average DNA length achieved was 200–600 bp. Fragmented chromatin was pre-cleared with protein A-Sepharose beads (preincubated with sonicated salmon sperm DNA, BSA and normal rabbit serum) and immunoprecipitated with Rabbit anti-mouse IgG (M7023, Sigma), anti-MAZ M-123 or anti-RNA Polymerase II (MMS-126R; Covance). Immunoprecipitated complexes were collected with Protein A-Sepharose beads pre-incubated with sonicated salmon sperm DNA and BSA. The beads were washed and eluted, and DNA was extracted from the eluates according to the ChIP Assay Kit protocol (Upstate). One-third of the final volume was analyzed by Syber-Green real time PCR using the following oligonucleotides:DNA was analyzed by Sybr Green real-time PCR using specific primers that amplified the MYB promoter, the POLR2A promoter or the 5′-UTR of BMP7: Mybchip1-F (GAGCGGGGTTTGCTCAGGAAAAGGC), Mybchip1-R (AAGAGCTTTGGACACTCCCCCT CCC), Pol2-F (GAGAAGAAGGCGGCTCCCGGAAGG) Pol2-R (CCGCCTAGGTGCTCAG ACCTCGTCAG), Bmp7-F (GGCTTCTCCTACCCCTACAAGGCCGT), Bmp7-R (CGGAGGAT CCCTCCTTCCCAGTAACC).
Transfections and reporter gene assays
Saos-2 and HEK-293T cells were transfected by employing the calcium phosphate method (20). Transfections of Saos-2 cells included 10 μg of appropriate firefly luciferase reporter plasmid plus 0.1 μg of pRL-Null (Promega, Madison, WI, USA) and 20 μg of carrier plasmid (Bluescript; Stratagene, Agilent Technologies, Santa Clara, CA, USA). Where indicated, pRc-CMV-E2F1 plus pRc-CMV-DP1, pcDNA3-HA-RB, pcDNA3-HA-p130 and/or increasing amounts of pcDNA3-HA-MAZ1, -MAZ2 or -MAZ-2s were also used. In control transfections, mock pcDNA3 or pRc-CMV was used. PBLs were harvested and resuspended at a density of 1 × 108 cells/ml in RPMI 1640 and, then, electroporated as described previously (21). Transfected PBLs were split in two 35-mm-diameter dishes, incubated in RPMI with 10% FCS at 37°C and activated or not with 5 μg/ml leucoagglutinin (Sigma–Aldrich) plus 50 U/ml IL-2 for 24 h. PBLs transfection included 40 μg MYBpr(+205)-Luc reporter vectors and 5 μg pRL-SV40 (Promega Biotech, Madrid, Spain). Firefly and Renilla luciferase activities were assayed using Dual Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized with that of Renilla luciferase.
Lentiviral production and infection
Lentivirus expressing green fluorescent protein (GFP) and MAZ-specific shRNAs or scrambled shRNA sequences were obtained, as previously described (22), by transient calcium-phosphate transfection of HEK-293T cells, using pLVTHM, psPAX2 and pMD2G-VSVG plasmids provided by D. Trono (Ecole Polytechnique Federale de Lausanne, Lausanne, Swisse). The supernatant containing the lentiviral particles was collected 48 h after removal of the calcium phosphate precipitate, filtered through a 45-μM polyvinylidene difluoride (PVDF) membrane (Steriflip; Millipore), concentrated by ultracentrifugation (88 000 × g, 2 h at 4°C) and stored at −80°C. Functional viruses were titrated by infecting Jurkat cells with limiting virus dilutions and quantification of GFP positive cells by flow cytometry after 24 h. Similar infection efficiencies with the different constructs were found across experiments. IL2-dependent, proliferating lymphocytes (107 cells) were infected 10 days after leucoagglutinin stimulation by adding lentivirus particles (MOI = 50) and incubating for 48 h. At this time, blast cells were ≥98% positive for CD3 expression (a marker of T lymphocytes) as determined by flow cytometry analysis. Cells were subsequently washed with RPMI 1640 medium and transferred to culture medium without IL2. Two days later, cells were stimulated again with 5 μg/ml leucoagglutinin plus 50 U/ml of IL2 or left untreated. Infection efficiency (GFP expression) was monitored by flow cytometry.
Quantitative PCR analysis
Total RNA was extracted from 5 × 106 lymphocytes using RNeasy (74104; Qiagen, Venlo, Netherlands). The genomic facility at Instituto de Investigaciones Biomedicas synthesized complementary DNA using M-MLV retro transcriptase (ThermoFischer Scientific) and analyzed gene expression by real-time quantitative (RT-qPCR) as described (23) using TaqMan Gene Expression Assays (ThermoFischer Scientific) specific for humanMAZ (Hs00911157_g1), MYB (Hs00193527_m1), CYCNG2 (Hs00171119_m1), E2F1 (Hs00153451_m1) and GUSB (Hs99999908_m1). GUSB was chosen as a control gene on the basis of its homogeneous expression in stimulated and untreated lymphocytes. Each gene expression experiment was performed at least three times and calculations were made from measurements of three replicates of each sample.
Immunofluorescence
Primary lymphocytes cultured on poly-Lys-coated coverslips were fixed with 4% paraformaldehyde (PFA), permeabilized with 0.1% Triton X-100 in phosphate-buffered saline (PBS) for 5 min and then incubated in 4% BSA in PBS for 30 min. Coverslips were then incubated for 1 h at room temperature with anti-CD45 D3/9 (a generous gift of Dr F. Sanchez-Madrid) and anti-phospho-MAZ (S460) in blocking solution followed by the corresponding secondary antibody. The nuclei were stained with DAPI and coverslips were mounted with Prolong medium (ThermoFisher Scientific, Waltham, MA, USA). Confocal microscopy images were acquired using plan-apochromatic objectives in an inverted Zeiss LSM 710 laser-scanning microscope (Zeiss, Germany). Sequential scanning mode was used to avoid crosstalk between channels. All images shown correspond to single sections. Pictures were processed with Zen 2009 (Carl Zeiss MicroImaging) and Adobe Photoshop CS (Adobe Systems Inc.) software.
Statistical analysis
Experiments were performed at least three times. Graphpad Prism software 6.01 was used for the analysis. Differences were analyzed by one-way or two-way analysis of variance (ANOVA) with Bonferroni post-tests, as appropriate. Differences were considered significant at P < 0.05.
RESULTS
Myb-sp contains a 30 kDa DNA-binding protein
EMSA of nuclear extracts from the B-cell line DG-75 and the E2F element in the MYB promoter (MYB-E2F) showed, as previously described with other cells (5), four major protein complexes (I–IV) that are common to other E2F probes (Figure 1A). In addition, the MYB-E2F site formed an additional complex (complex V) that was not observed with any of the other E2F elements (Figure 1A). While complexes I to IV contained E2F/DP heterodimers associated to p107 (complex I), RB (complex II) or to no RB family member (complexes III and IV), complex V contained no DP/E2F factors (5). Given the specificity of complex V, its constituent nuclear factor was named Myb-sp (5).
Figure 1.
Identification of a 30-kDa DNA-binding protein in Myb-sp. (A) Complex formation employing nuclear extracts from the lymphoma B-cell line DG-75 and radiolabeled E2F elements from the DHFR, CDC2 and MYB promoters were analyzed by EMSA. The position of complexes I–V, containing p107, RB, free E2F or Myb-sp is indicated. The free MYB-E2F probe is indicated. (B) Relative molecular weight estimation of DNA-binding components of complexes formed with the MYB-E2F probe. Ultraviolet (UV) cross-linking analysis of complexes I–V was performed employing DG-75 nuclear extracts and a bromodeoxyuridine-substituted MYB-E2F probe. Following native gel electrophoresis, the gel was irradiated with UV light and the indicated complexes were excised from the gel. Labeled proteins in the excised bands were then separated by electrophoresis in a 10% SDS-PAGE. The gel mobility of pre-stained protein molecular weight markers following compensation for the size of the cross-linked probes (11 kDa) is indicated in kDa. The arrow indicates the position of Myb-sp.
Identification of a 30-kDa DNA-binding protein in Myb-sp. (A) Complex formation employing nuclear extracts from the lymphoma B-cell line DG-75 and radiolabeled E2F elements from the DHFR, CDC2 and MYB promoters were analyzed by EMSA. The position of complexes I–V, containing p107, RB, free E2F or Myb-sp is indicated. The free MYB-E2F probe is indicated. (B) Relative molecular weight estimation of DNA-binding components of complexes formed with the MYB-E2F probe. Ultraviolet (UV) cross-linking analysis of complexes I–V was performed employing DG-75 nuclear extracts and a bromodeoxyuridine-substituted MYB-E2F probe. Following native gel electrophoresis, the gel was irradiated with UV light and the indicated complexes were excised from the gel. Labeled proteins in the excised bands were then separated by electrophoresis in a 10% SDS-PAGE. The gel mobility of pre-stained protein molecular weight markers following compensation for the size of the cross-linked probes (11 kDa) is indicated in kDa. The arrow indicates the position of Myb-sp.Since Myb-sp did not contain any DP/E2F factor, we hypothesized that, by using UV cross-linking, we might uncover a protein component of complex V that would not be present in complexes I–IV. UV cross-linking of complexes I–IV revealed strong and specific bands of 45–60 kDa (Figure 1B), which are consistent with the expected size of DP and E2F subunits and with previous results using other E2F elements or cells (13). In contrast, the only specific band observed upon UV cross-linking of Myb-sp (complex V) showed an apparent mass of 30 kDa (Figure 1B).
Myb-sp contains the transcription factor MYC-associated zinc finger protein (MAZ)
To identify the 30-kDa-protein present in Myb-sp, we purified this factor by affinity chromatography. We had previously identified the key nucleotides of the MYB-E2F site required for binding of either E2F factors or Myb-sp (5) and used this information to design oligonucleotides that bind only Myb-sp (MYB-Sp), only E2F (MYB-E2F) or no factor (MYB-Null) (Figure 2A). As expected, complex formation employing DG-75 nuclear extracts and the wild-type (WT) probe (MYB-WT) was competed with a self-oligonucleotide, but not with the Null mutant (Figure 2B). Notably, the MYB-Spoligonucleotide inhibited formation of complex V, but did not affect complexes I-IV (Figure 2B). In contrast, the MYB-E2F oligonucleotide inhibited complexes I-IV, but did not affect complex V appearance (Figure 2B).
Figure 2.
Myb-sp contains the transcription factor MAZ. (A) Sequence of WT and mutant MYB-E2F probes. For each mutant, alterations relative to the WT sequence are indicated in bold. Lines indicate the binding sites for E2F and Myb-sp. (B) Complexes formed between DG-75 nuclear factors and the radiolabeled MYB-E2F probe were analyzed by EMSA. Reaction mixtures were incubated in the absence (indicated as None) or in the presence of a 100-fold excess of the indicated unlabeled competitor oligonucleotides. The position of complexes I–V is denoted. The free probe is not shown. (C) A nuclear extract derived from DG-75 cells was subjected to sequence-specific DNA affinity chromatography employing concatemerized MYB-Sp or MYB-Null oligonucleotides bound to sepharose beads. Samples were eluted with an excess of MYB-Sp oligonucleotides and analyzed by 10% SDS-PAGE and silver staining. A 30-kDa band (B30) was excised and subjected to mass spectrometry analysis. (D) Sequence of the seven tryptic peptides derived from B30. (E) Schematic representation of major MAZ isoforms. The Uniprot code of these isoforms and the approximate position of the detected peptides are indicated. (F) EMSA analysis of complex formation employing the radiolabeled MYB-E2F probe and a nuclear extract from DG-75 cells (NE), a control reticulocyte lysate (Mock) or in vitro translated MAZ-2s or MAZ-1. Reaction mixtures were incubated in the absence or in the presence of a 100-fold excess of the indicated unlabeled MYB-E2F competitor oligonucleotides.
Myb-sp contains the transcription factor MAZ. (A) Sequence of WT and mutant MYB-E2F probes. For each mutant, alterations relative to the WT sequence are indicated in bold. Lines indicate the binding sites for E2F and Myb-sp. (B) Complexes formed between DG-75 nuclear factors and the radiolabeled MYB-E2F probe were analyzed by EMSA. Reaction mixtures were incubated in the absence (indicated as None) or in the presence of a 100-fold excess of the indicated unlabeled competitor oligonucleotides. The position of complexes I–V is denoted. The free probe is not shown. (C) A nuclear extract derived from DG-75 cells was subjected to sequence-specific DNA affinity chromatography employing concatemerized MYB-Sp or MYB-Null oligonucleotides bound to sepharose beads. Samples were eluted with an excess of MYB-Sp oligonucleotides and analyzed by 10% SDS-PAGE and silver staining. A 30-kDa band (B30) was excised and subjected to mass spectrometry analysis. (D) Sequence of the seven tryptic peptides derived from B30. (E) Schematic representation of major MAZ isoforms. The Uniprot code of these isoforms and the approximate position of the detected peptides are indicated. (F) EMSA analysis of complex formation employing the radiolabeled MYB-E2F probe and a nuclear extract from DG-75 cells (NE), a control reticulocyte lysate (Mock) or in vitro translated MAZ-2s or MAZ-1. Reaction mixtures were incubated in the absence or in the presence of a 100-fold excess of the indicated unlabeled MYB-E2F competitor oligonucleotides.DNA affinity columns were then prepared by covalently binding concatemerized MYB-Sp or MYB-Null oligonucleotides to sepharose beads. Nuclear extracts from DG-75 cells were loaded onto both affinity columns and proteins bound to the beads were eluted with an excess of Sp oligonucleotides and fractionated through SDS-PAGE. The presence of a silver-stained band of 30 kDa (B30) was detected only in the proteins eluted from the Sp column (Figure 2C). Mass spectrometry analysis of tryptic peptides derived from this band detected seven peptides that were unequivocally identified as peptides from the MAZ family of zinc finger proteins (Figure 2D and Supplementary Figure S1).MAZ is expressed in humans as three major isoforms, MAZ-1 (477 aa), MAZ-2 (493 aa) and MAZ-3 (454 aa) (Figure 2E and Supplementary Figure S1) (24–26). A shorter MAZ-2 protein, encompassing only aa 229–493 (hereafter referred to as MAZ-2s) has also been found (27). MAZ-1 and MAZ-2 share 427 aa and differ only in their carboxy-terminal tails, whereas the first 34 aa of MAZ-1 have been substituted in MAZ-3 by a sequence of 13 aa that is not present in MAZ-1 or MAZ-2 (Figure 2E and Supplementary Figure S1B). All isoforms contain a DNA-binding domain, a nuclear localization signal, and several domains that positively or negatively regulate transcription (Supplementary Figure S2), as described for MAZ-1 (28).While six of the seven tryptic peptides identified in band B30 were common to all MAZ isoforms, one peptide was found only in MAZ-2 or MAZ-2s (Figure 2D and Supplementary Figure S1), strongly suggesting that MAZ-2 and/or MAZ2-s are present in Myb-sp. Since the theoretical mass of MAZ-2 (51 073 Da) is much larger than that of the purified protein or that of the DNA-binding protein detected by UV cross-linking, we hypothesized that the MAZ-2 isoform present in Myb-sp might be MAZ-2s (theoretical mass of 28 621 Da).To determine whether MAZ-2s is the only MAZ protein in Myb-sp or if other MAZ family members might also be present in this complex, we first tested the ability of in vitro translated (IVT) MAZ-2s and MAZ-1 to bind the MYB-E2F site in EMSA assays. As expected five major complexes were observed employing a nuclear extract from DG-75 cells (Figure 2F). A major complex, showing a similar mobility to that of Myb-sp, was detected employing IVT MAZ-2s or MAZ-1 (Figure 2F). Formation of this complex was efficiently competed by a self-oligonucleotide and by its mutant derivative Sp, but not by its E2F or Null mutant derivatives (Figure 2F). These results strongly suggest that all MAZ proteins are capable of binding the MYB-E2F site. Only one major complex, with a similar mobility to that of complex III, was observed employing a control reticulocyte lysate (Figure 2F). This complex appeared to be specific and might perhaps contain E2F from the reticulocytes because its formation was efficiently competed by a self-oligonucleotide and by its mutant derivative that binds only E2F factors, but not by its mutant derivatives Sp or Null (Figure 2F).To further confirm that Myb-sp contains MAZ factors, we generated antibodies against different MAZ isoforms and used them as competitors in EMSA assays to identify the isoforms involved in complex formation. Peptides from the amino- or carboxy-terminal end of MAZ-1, MAZ-2 or MAZ-2s were used as immunogens to generate polyclonal rabbit antibodies (Figure 3A). The specificity of these antibodies was confirmed by immunoblot of cell lysates from HEK-293T cells forced to express MAZ-1, MAZ-2 or MAZ-2s. The M-13 antibody, raised against a peptide from the carboxy-terminal end of MAZ-1 and MAZ-3 (Figure 3A), specifically recognized ectopically expressed MAZ-1 and a major endogenous protein of ∼30 kDa (Figure 3B). The M-2 antibody, raised against a peptide from the carboxyl-terminal end of MAZ-2 (Figure 3A), detected ectopically expressed MAZ-2 and MAZ-2s and a major endogenous protein of ∼30 kDa (Figure 3B). The M-123 antibody, raised against a peptide from the amino-terminal end of MAZ-2s (common to all isoforms; Figure 3A), recognized ectopically expressed MAZ-1, MAZ-2 and MAZ-2s (Figure 3B). Of note, this antibody also hybridized strongly with an ∼30-kDa-band in cell lysates from cells forced to express full-length MAZ-1, suggesting the possibility that these cells might express high levels of a smaller version of MAZ-1 (MAZ-1s), similar to MAZ-2s. Finally, the M-12 antibody, raised against a peptide from the amino-terminal end of MAZ-1 (identical to MAZ-2; Figure 3A), recognized ectopically expressed MAZ-1 and MAZ-2, but not MAZ-2s or any other endogenous protein with a relative mass close to 30 kDa (Figure 3B).
Figure 3.
Production of antibodies against various MAZ isoforms. (A) Schematic representation of major MAZ isoforms indicating the approximate position of the peptides employed as immunogens in the production of the indicated anti-MAZ antibodies. (B) Immunoblot analysis employing the indicated anti-MAZ antibodies and protein extracts derived from HEK-293T overexpressing MAZ1, MAZ-2, MAZ-2s or from Mock-transfected cells. Arrowheads indicate the position of the major proteins identified by these antibodies.
Production of antibodies against various MAZ isoforms. (A) Schematic representation of major MAZ isoforms indicating the approximate position of the peptides employed as immunogens in the production of the indicated anti-MAZ antibodies. (B) Immunoblot analysis employing the indicated anti-MAZ antibodies and protein extracts derived from HEK-293T overexpressing MAZ1, MAZ-2, MAZ-2s or from Mock-transfected cells. Arrowheads indicate the position of the major proteins identified by these antibodies.Complex formation between the MYB-E2F probe and IVT MAZ-2s tagged with HA was markedly affected by an anti-HA antibody and by anti-MAZ antibodies M-2 and M-123 (Figure 4A). In contrast, the anti-MAZ M-12 and M-13, the M-123 pre-immune serum or an antibody to Smad2/3 failed to shift the mobility of the complex (Figure 4A). A similar complex was observed employing IVT MAZ-1 (Figure 4A) and its formation was inhibited by anti-MAZ M-13 and M-123 antibodies, but not by anti-MAZ M-2 or anti-Smad2/3 antibodies or by pre-immune sera (Figure 4A). The M-12 antibody also failed to affect the formation of this complex (Figure 4A), suggesting that it does not work properly in EMSA assays. Together, these data indicate that MAZ-1 and MAZ-2s are able to interact with the MYB-E2F probe.
Figure 4.
Myb-sp contains various MAZ isoforms. (A) EMSA analysis of complex formation employing the radiolabeled MYB-E2F probe and a control reticulocyte lysate (Mock), or in vitro translated MAZ-2s or MAZ-1. Reaction mixtures were incubated in the absence (none) or in the presence of the indicated anti-MAZ antibodies, the M-123 pre-immune serum (Pre-123) and an anti-HA or an anti-Smad2/3 antibody. The free probe is not shown. (B) EMSA analysis of complex formation employing the radiolabeled MYB-E2F probe and nuclear extracts from DG-75 cells. Reaction mixtures were incubated in the absence (none) or in the presence of the indicated anti-MAZ antibodies; the M-13, M-123 and M-12 pre-immune sera (Pre-13, Pre-123 and Pre-12, respectively); and an anti-HA or an anti-DP1 antibody. The free probe is not shown.
Myb-sp contains various MAZ isoforms. (A) EMSA analysis of complex formation employing the radiolabeled MYB-E2F probe and a control reticulocyte lysate (Mock), or in vitro translated MAZ-2s or MAZ-1. Reaction mixtures were incubated in the absence (none) or in the presence of the indicated anti-MAZ antibodies, the M-123 pre-immune serum (Pre-123) and an anti-HA or an anti-Smad2/3 antibody. The free probe is not shown. (B) EMSA analysis of complex formation employing the radiolabeled MYB-E2F probe and nuclear extracts from DG-75 cells. Reaction mixtures were incubated in the absence (none) or in the presence of the indicated anti-MAZ antibodies; the M-13, M-123 and M-12 pre-immune sera (Pre-13, Pre-123 and Pre-12, respectively); and an anti-HA or an anti-DP1 antibody. The free probe is not shown.To determine if endogenous MAZ proteins are present in Myb-sp, we used these anti-MAZ antibodies and the MYB-E2F probe with nuclear extracts from DG-75 cells. M-13 and M-2 antibodies inhibited formation of the slower- and the faster-migrating portion of complex V, respectively, and the combination of both antibodies completely eliminated complex V (Figure 4B). Formation of this complex was ablated also by the M-123 antibody (Figure 4B). As expected, the formation of E2F-containing complexes (I–IV) was inhibited by an anti-DP1 antibody, but not by any of the anti-MAZ antibodies or their pre-immune sera (Figure 4B). The M-12 and anti-HA antibodies and any of the MAZ pre-immune sera failed to interfere with the formation of any of these complexes (Figure 4B). These results indicate that endogenous MAZ proteins are components of Myb-sp.
MAZ binding to the MYB-E2F site overcomes its repression by RB family members and activates the MYB promoter
As we had suggested that binding of Myb-sp to the MYB-E2F site prevented MYB promoter repression by RB family members (5), we now investigated whether MAZ factors, as Myb-sp components, might overcome transcriptional repression by pRB or p130. RB-deficient Saos-2 cells were transfected with luciferase reporter plasmids (2xMYB-BG-LUC) containing a TATA box and two copies of the wild-type (WT) MYB-E2F site (Figure 5A). We also employed previously reported (5) mutant derivatives of this site that bind only E2F, only Myb-sp (Sp) or no factor (Null). Forced expression of MAZ-1, MAZ-2 and MAZ-2s transactivated the WT and Sp reporter, but not the E2F or the Null derivatives (Figure 5B). In contrast, forced expression of E2F1/DP1 transactivated the E2F reporter, but not the Sp mutant (Figure 5B). Forced pRB or p130expression markedly reduced the activity of the WT and E2F reporters, but not that of the construct driven only by the Sp derivative (Figure 5C–E). Finally, RB- and p130-mediated repression of the WT reporter, but not that of the E2F derivative, was overcome by progressively increasing amounts of either MAZ-2s or MAZ-1 (Figure 5C–E). Since MAZ-2s activated transcription more poorly than MAZ-1 or MAZ-2, we compared their levels in cells transfected with plasmids encoding these isoforms together with WT and Sp reporter vectors. While all MAZ isoforms were expressed at similar levels, MAZ-2s showed less activation capacity than MAZ-1 or MAZ-2 (Supplementary Figure S3).
Figure 5.
MAZ proteins bind the MYB-E2F element in vivo and overcome RB-mediated transcriptional repression through this element. (A) Schematic representation of the luciferase reporter plasmids used, 2xE2F/MAZ-Luc. Two copies of the WT E2F site from the MYB promoter or its mutant derivatives that interact only with E2F (E2F), only with MAZ (Sp) or with none of them (Null) were cloned immediately upstream from the ß-globin TATA box in pBG-Luc. (B) The indicated 2xE2F/MAZ-Luc plasmids (1 μg) were cotransfected with pRL-null (1 μg) in asynchronously growing Saos-2 cells in the presence of plasmids encoding MAZ-1 (0.1 μg), MAZ-2 (0.1 μg), MAZ-2s (0.1 μg), DP1 (50 ng) plus E2F1 (50 ng) or empty vector (0.1 μg). Forty hours later, cell extracts were prepared and firefly and renilla luciferase assays were performed. Firefly luciferase values were normalized for renilla activity. Luciferase activity is shown relative to that in the presence of the empty vector (mean ± SEM; n = 4). **P < 0.01, ***P < 0.001 and ****P < 0.0001 versus Null; one-way ANOVA with Bonferroni post-test. (C–E) The indicated 2xE2F/MAZ-Luc (1 μg) plasmids were cotransfected with pRL-null (1 μg) in asynchronously growing Saos-2 cells in the presence of 0.1 μg of empty vector (−), or plasmids encoding either (C and D) pRB (0.1 μg) or (E) p130, together with (C) MAZ-2s (0.1 or 0.5 μg), (D) MAZ-1 (0.1 or 0.5 μg) or MAZ-1 (0.5 μg), as indicated. Forty hours later, cell extracts were prepared and firefly and renilla luciferase assays were performed. Firefly luciferase values were normalized for renilla activity. Luciferase activity is shown relative to that in the presence of the empty vector (mean ± SEM; n = 5). (C and D) *P < 0.05 and ****P < 0.0001 versus empty; ####P < 0.0001 versus RB; one-way ANOVA with Bonferroni post-test.
MAZ proteins bind the MYB-E2F element in vivo and overcome RB-mediated transcriptional repression through this element. (A) Schematic representation of the luciferase reporter plasmids used, 2xE2F/MAZ-Luc. Two copies of the WT E2F site from the MYB promoter or its mutant derivatives that interact only with E2F (E2F), only with MAZ (Sp) or with none of them (Null) were cloned immediately upstream from the ß-globin TATA box in pBG-Luc. (B) The indicated 2xE2F/MAZ-Luc plasmids (1 μg) were cotransfected with pRL-null (1 μg) in asynchronously growing Saos-2 cells in the presence of plasmids encoding MAZ-1 (0.1 μg), MAZ-2 (0.1 μg), MAZ-2s (0.1 μg), DP1 (50 ng) plus E2F1 (50 ng) or empty vector (0.1 μg). Forty hours later, cell extracts were prepared and firefly and renilla luciferase assays were performed. Firefly luciferase values were normalized for renilla activity. Luciferase activity is shown relative to that in the presence of the empty vector (mean ± SEM; n = 4). **P < 0.01, ***P < 0.001 and ****P < 0.0001 versus Null; one-way ANOVA with Bonferroni post-test. (C–E) The indicated 2xE2F/MAZ-Luc (1 μg) plasmids were cotransfected with pRL-null (1 μg) in asynchronously growing Saos-2 cells in the presence of 0.1 μg of empty vector (−), or plasmids encoding either (C and D) pRB (0.1 μg) or (E) p130, together with (C) MAZ-2s (0.1 or 0.5 μg), (D) MAZ-1 (0.1 or 0.5 μg) or MAZ-1 (0.5 μg), as indicated. Forty hours later, cell extracts were prepared and firefly and renilla luciferase assays were performed. Firefly luciferase values were normalized for renilla activity. Luciferase activity is shown relative to that in the presence of the empty vector (mean ± SEM; n = 5). (C and D) *P < 0.05 and ****P < 0.0001 versus empty; ####P < 0.0001 versus RB; one-way ANOVA with Bonferroni post-test.To assess the regulation of MYB transcription by MAZ factors on the complete humanMYB promoter, we used a reporter (MYBpr) in which luciferase expression was under the control of the humanMYB promoter (Figure 6A) or derivatives in which its E2F site was mutated to bind only E2F, only MAZ proteins (Sp) or no factor (Null), as previously described (5). Saos-2 cells were cotransfected with these reporter constructs and progressively increasing amounts of MAZ-1 or MAZ-2s expression vectors. Analysis of the luciferase activity in extracts from these cells showed that MAZ-1 and MAZ-2s activated the WT and the Sp versions of the MYB promoter, but not its E2F or Null mutant derivatives (Figure 6B–C). Together, these results suggest that MAZ specifically regulates the MYB promoter in vivo via the MYB-E2F site (E2F/MAZ element).
Figure 6.
MAZ proteins activate the MYB promoter through the E2F/MAZ-binding element. (A) Schematic representation of the luciferase reporter vector driven by the MYB promoter (MYBpr-Luc). The position of the E2F/MAZ combined element (black box) and that of the transcription initiation site (arrow) is indicated. Reporter vectors with a WT E2F/MAZ element (WT) as well as vectors with a mutated site that interacted only with E2F (E2F), only with MAZ (Sp) or with none of them (Null) were also generated. (B and C) The indicated MYBpr-Luc reporter plasmids (10 μg) were cotransfected with pRL-null (1 μg) into Saos-2 cells in the presence of empty vector (0) or increasing amount of plasmids (indicated in μg) encoding (B) MAZ-1 (n = 4) or (C) MAZ-2s (n = 3). Forty hours later, cell extracts were prepared and firefly and renilla luciferase assays were performed. Firefly luciferase values were normalized for renilla activity. Luciferase activity is shown relative to that in the presence of the empty vector (mean ± SEM). *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001 versus Null; one-way ANOVA with Bonferroni post-test.
MAZ proteins activate the MYB promoter through the E2F/MAZ-binding element. (A) Schematic representation of the luciferase reporter vector driven by the MYB promoter (MYBpr-Luc). The position of the E2F/MAZ combined element (black box) and that of the transcription initiation site (arrow) is indicated. Reporter vectors with a WT E2F/MAZ element (WT) as well as vectors with a mutated site that interacted only with E2F (E2F), only with MAZ (Sp) or with none of them (Null) were also generated. (B and C) The indicated MYBpr-Luc reporter plasmids (10 μg) were cotransfected with pRL-null (1 μg) into Saos-2 cells in the presence of empty vector (0) or increasing amount of plasmids (indicated in μg) encoding (B) MAZ-1 (n = 4) or (C) MAZ-2s (n = 3). Forty hours later, cell extracts were prepared and firefly and renilla luciferase assays were performed. Firefly luciferase values were normalized for renilla activity. Luciferase activity is shown relative to that in the presence of the empty vector (mean ± SEM). *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001 versus Null; one-way ANOVA with Bonferroni post-test.
Endogenous MAZ factors bind and activate the MYB promoter in vivo and induce MYB expression
To determine whether MAZ regulates MYBexpression not only in tumor cell lines, but also in healthy primary cells, we assessed its contribution to the regulation of the MYB promoter in primary PBLs. MYB is not expressed in quiescent lymphocytes but its transcription is activated early during the exit from quiescence and remains active thereafter (11,12). Since a previous report had shown inhibition of MYB promoter activity in HEK-293 cells by MAZ through a GC box in the 5′UTR of MYB (29), we engineered an additional reporter vector, MYBpr(+205), extending the MYB promoter with its 5′UTR that includes the GC box (Figure 7A). The transfection efficiency of primary quiescent lymphocytes is extremely low, but under certain conditions it is sufficient to detect the activity of given luciferase reporters (13). The WT and mutant derivative MYBpr(+205) plasmids whose E2F/MAZ element could interact only with E2F, only with MAZ (Sp) or with no factor (Null) were transfected in quiescent PBLs. Cells were then left untreated or activated for 24 h with leucoagglutinin plus interleukin-2 (IL2) to exit from quiescence. The luciferase activity from resting and stimulated cells was measured to assess the respective transactivation capacity of each factor following lymphocyte activation. As shown in Figure 7B, the reporter plasmids that contained a WT E2F/MAZ site or its Sp mutant derivative were activated 3- to 4-fold following cell stimulation, whereas reporter plasmids that contained its E2F or Null derivatives were not activated, thus supporting the notion that MAZ binding to the E2F/MAZ site is required for transcriptional induction of MYB.
Figure 7.
Activation of the MYB promoter during the exit from quiescence requires its MAZ-binding site. (A) Schematic representation of the luciferase reporter vector used, MYBpr(+205)-Luc. A DNA insert encompassing the MYB promoter plus its 5′UTR (a 205-bp DNA fragment) were cloned into pGL2-Basic. Reporter vectors with a WT E2F/MAZ element (WT) as well as vectors with a mutated site that interacted only with E2F (E2F), only with MAZ (Sp) or with none of them (Null) were also generated. The relative positions of the combined E2F/MAZ element (black box), the transcription initiation site (arrow) and the GC box (gray block) are shown. (B) The indicated MYBpr(+205)-Luc reporter plasmids (40 μg) were cotransfected with pRL-SV40 (5 μg) into primary peripheral blood lymphocytes (PBLs). Following transfection, cells were split and either activated for 24 h with leucoagglutinin plus interleukin-2 to exit from quiescence (Activated cells) or left untreated (Resting cells). Firefly and renilla luciferase activities were measured in cell extracts from both activated and untreated cells. Normalized luciferase values for each indicated reporter plasmid are shown relative to untreated cells (mean ± SEM; n = 8). **P < 0.01, ****P < 0.0001 versus Null Activated; two-way Anova with Bonferroni post-test. (C) Anti-Pol II, anti-MAZ M-123 or pre-immune M-123 (Ctl) ChIP analyses of resting lymphocytes (Res) and lymphocytes activated for 2 h (Activ). Different dilutions of input chromatin DNA (1, 0.25 and 0. 1%) or DNA extracted from the indicated immunoprecipitates were analyzed by real-time PCR using oligonucleotides flanking a MYB genomic region encompassing the E2F/MAZ site and the transcription initiation site (MYB), the transcription initiation site of POLR2A or the 3′-UTR of BMP7. Data are shown as enrichment in the amount of chromatin precipitated with each antibody relative to 0.1% input chromatin. Histograms show means ± SEM (n = 3). **P < 0.01, ***P < 0.001 versus Ctl in quiescent cells; two-way ANOVA with Bonferroni post-test.
Activation of the MYB promoter during the exit from quiescence requires its MAZ-binding site. (A) Schematic representation of the luciferase reporter vector used, MYBpr(+205)-Luc. A DNA insert encompassing the MYB promoter plus its 5′UTR (a 205-bp DNA fragment) were cloned into pGL2-Basic. Reporter vectors with a WT E2F/MAZ element (WT) as well as vectors with a mutated site that interacted only with E2F (E2F), only with MAZ (Sp) or with none of them (Null) were also generated. The relative positions of the combined E2F/MAZ element (black box), the transcription initiation site (arrow) and the GC box (gray block) are shown. (B) The indicated MYBpr(+205)-Luc reporter plasmids (40 μg) were cotransfected with pRL-SV40 (5 μg) into primary peripheral blood lymphocytes (PBLs). Following transfection, cells were split and either activated for 24 h with leucoagglutinin plus interleukin-2 to exit from quiescence (Activated cells) or left untreated (Resting cells). Firefly and renilla luciferase activities were measured in cell extracts from both activated and untreated cells. Normalized luciferase values for each indicated reporter plasmid are shown relative to untreated cells (mean ± SEM; n = 8). **P < 0.01, ****P < 0.0001 versus Null Activated; two-way Anova with Bonferroni post-test. (C) Anti-Pol II, anti-MAZ M-123 or pre-immune M-123 (Ctl) ChIP analyses of resting lymphocytes (Res) and lymphocytes activated for 2 h (Activ). Different dilutions of input chromatin DNA (1, 0.25 and 0. 1%) or DNA extracted from the indicated immunoprecipitates were analyzed by real-time PCR using oligonucleotides flanking a MYB genomic region encompassing the E2F/MAZ site and the transcription initiation site (MYB), the transcription initiation site of POLR2A or the 3′-UTR of BMP7. Data are shown as enrichment in the amount of chromatin precipitated with each antibody relative to 0.1% input chromatin. Histograms show means ± SEM (n = 3). **P < 0.01, ***P < 0.001 versus Ctl in quiescent cells; two-way ANOVA with Bonferroni post-test.To determine whether MAZ was associated in vivo with the humanMYB promoter, ChIP assays were performed with anti-MAZ M-123. Transcriptional activation of this locus 2 h after the exit from quiescence was also assessed by ChIP analysis of RNA Polymerase II (Pol II) binding to the MYB locus. The products of PCR reactions performed with DNA eluted from the immunoprecipitates were analyzed by RT-qPCR. ChIP assays confirmed recruitment of both MAZ and Pol II to a MYB promoter region encompassing the E2F/MAZ site and the transcription initiation site in cells activated in 2 h, but not in quiescent cells (Figure 7C). According to the constitutive transcription of the gene encoding Pol II (POLR2A), ChIP analysis showed Pol II binding in quiescent and activated cells to its own promoter (Figure 7C). In contrast, MAZ was not bound to this promoter in any condition (Figure 7C). Importantly, negative control ChIP assays using the M-123 pre-immune serum (Ctl) on these two promoters and using the anti-MAZ and anti-Pol II antibodies on the 3′-UTR of BMP7 excluded the possibility of co-precipitation of non-specific DNA sequences (Figure 7C). These results therefore show that MAZ and Pol II bind the MYB promoter in vivo 2h after the exit from quiescence.Since promoters cloned into reporter vectors might not necessarily be regulated as in their chromosomal context, we sought to determine the contribution of endogenous MAZ proteins to the activation of the MYB gene. To this end, we downregulated MAZ levels in primary cells through lentivirus-mediated expression of MAZ shRNAs. A screen of several MAZ shRNAs in the T-cell line Jurkat identified the high silencing capacity of shMAZ-A and shMAZ-B on MAZ isoforms (Supplementary Figure S6). Because lentiviral transduction of resting primary T lymphocytes is poorly efficient, we stimulated their proliferation with leucoagglutinin and IL2 before infecting them. As previously described (15), IL2 starvation of activated T lymphocytes leads them back into a quiescent state, that can be readily reverted through the addition of fresh stimuli (Figure 8A). To confirm the quiescence of these cells, we assessed the expression levels of CCNG2 mRNA and p130, both markers of G0 whose expression decreases during the exit from quiescence (9,30,31). We found that while their expression was high in IL2-starved cells, it decreased markedly in stimulated lymphocytes (Figure 8B and Supplementary Figure S4). In contrast, the levels of E2F1 mRNA, a gene that is not expressed in quiescent lymphocytes and that is induced at the G1-S transition (32), were low in starved cells and increased 16 h after lymphocyte stimulation (Figure 8C).
Figure 8.
MAZ is required for MYB induction during the exit from quiescence. (A) Experimental timeline. The proliferation of isolated primary PBLs was induced with a combination of leucoagglutinin and IL2 and maintained by the presence of IL2 during 12 days. Cells were then made quiescent by IL2 starvation and induced to re-enter the cell cycle 48 h later by adding leucoagglutinin and IL2. (B) Immunoblot analysis of p130 phospho-S672; p130 total; a combination of pRB phospho-S780, phospho-S795 and phospho-S807/811; pRB total; and TFIIH (loading control) in nuclear extracts from these cells. (C) RT-qPCR analysis of MYB, MAZ and E2F1 mRNA expression in lymphocytes stimulated for the indicated periods of time to re-enter the cell cycle. mRNA amounts were normalized to GUSB expression. Data are shown as means ± SEM (n = 3) relative to 0 h. *P < 0.05, **P < 0.01, ***P < 0.001 versus 0 h; two-way ANOVA with Bonferroni post-test. (D) Immunoblot analysis of phospho-MAZ (S460) and MAZ total levels (employing the MAZ-123 antibody) in nuclear extracts from these cells. (E) Experimental timeline as in (A). Proliferating lymphocytes were transduced with lentivirus expressing GFP and either a control shRNA or MAZ-specific shRNAs sh59 or sh60 2 days before IL2 starvation. (F and G) Lymphocytes transduced with lentivirus expressing shRNAs as indicated were forced to become quiescent by IL2 starvation for 48 h. (E) MAZ knockdown was confirmed by RT-qPCR analysis at this time. mRNA amounts were normalized to GUSB expression (means ± SEM, n = 3). ***P < 0.001, ****P < 0.0001 versus Control; one-way ANOVA with Bonferroni post-test. (F) Transduced, quiescent cells were treated with leucoagglutinin plus IL2 for 1 h to re-enter the cell cycle (Activated) or left untreated (Resting). MYB mRNA levels were determined by RT-qPCR analysis and normalized to GUSB expression (means ± SEM, n = 3). ***P < 0.001 versus Control Activated; ####P < 0.0001 versus Control Resting; two-way ANOVA with Bonferroni post-test.
MAZ is required for MYB induction during the exit from quiescence. (A) Experimental timeline. The proliferation of isolated primary PBLs was induced with a combination of leucoagglutinin and IL2 and maintained by the presence of IL2 during 12 days. Cells were then made quiescent by IL2 starvation and induced to re-enter the cell cycle 48 h later by adding leucoagglutinin and IL2. (B) Immunoblot analysis of p130 phospho-S672; p130 total; a combination of pRB phospho-S780, phospho-S795 and phospho-S807/811; pRB total; and TFIIH (loading control) in nuclear extracts from these cells. (C) RT-qPCR analysis of MYB, MAZ and E2F1 mRNA expression in lymphocytes stimulated for the indicated periods of time to re-enter the cell cycle. mRNA amounts were normalized to GUSBexpression. Data are shown as means ± SEM (n = 3) relative to 0 h. *P < 0.05, **P < 0.01, ***P < 0.001 versus 0 h; two-way ANOVA with Bonferroni post-test. (D) Immunoblot analysis of phospho-MAZ (S460) and MAZ total levels (employing the MAZ-123 antibody) in nuclear extracts from these cells. (E) Experimental timeline as in (A). Proliferating lymphocytes were transduced with lentivirus expressing GFP and either a control shRNA or MAZ-specific shRNAs sh59 or sh60 2 days before IL2 starvation. (F and G) Lymphocytes transduced with lentivirus expressing shRNAs as indicated were forced to become quiescent by IL2 starvation for 48 h. (E) MAZ knockdown was confirmed by RT-qPCR analysis at this time. mRNA amounts were normalized to GUSBexpression (means ± SEM, n = 3). ***P < 0.001, ****P < 0.0001 versus Control; one-way ANOVA with Bonferroni post-test. (F) Transduced, quiescent cells were treated with leucoagglutinin plus IL2 for 1 h to re-enter the cell cycle (Activated) or left untreated (Resting). MYB mRNA levels were determined by RT-qPCR analysis and normalized to GUSBexpression (means ± SEM, n = 3). ***P < 0.001 versus Control Activated; ####P < 0.0001 versus Control Resting; two-way ANOVA with Bonferroni post-test.Under these conditions, MYBexpression increased as early as 1 h after T-cell re-stimulation (Figure 8B). However, RB family members inactivation, as determined by phosphorylation of p130 and pRB, was not observed before 8 h from quiescence exit (Figure 8B). MAZ protein in the nucleus and its mRNA levels were not substantially affected following exit from quiescence (Figure 8C and D). In contrast, the nuclear presence of an ∼50 kDa MAZ form phosphorylated at S460, a modification that enhances MAZ DNA-binding activity (33), increased markedly 1 and 3 h after quiescence exit (Figure 8D). Immunofluorescence analysis of synchronized lymphocytes confirmed augmented phospho-MAZ (S460) signal in the nucleus of cells 3h after quiescence exit relative to unstimulated cells (Supplementary Figure S5).Ten days after the activation of T lymphocytes, we transduced them with lentivirus co-expressing GFP and either shMAZ-A or shMAZ-B (Figure 8E). The transduction efficiency under these conditions varied from 50 to 70% between experiments, as determined by flow-cytometry analysis of GFP expression. These cells were IL2-starved 48 h after transduction to make them quiescent, and re-stimulated 2 days later to induce MYBexpression (Figure 8E). shMAZ-A and shMAZ-B decreased MAZ levels 60 and 50%, respectively (Figure 8F). Of note, MYB induction in these cells was also markedly decreased after 1 h of stimulation relative to control cells (Figure 8G), indicating that MAZ is a critical mediator of MYB induction during the exit from quiescence. Together, our results strongly suggest that the E2F/MAZ element plays a crucial role during MYB activation in cells coming out of quiescence and that MAZ binding to this element might be critical for the early activation of MYB transcription.
DISCUSSION
We hypothesized that the interaction of proteins distinct from E2F with the E2F-binding site in the MYB promoter may prevent its transcriptional repression by E2F-recruited RB family members. Here, we have identified these proteins as members of the MAZ family of transcription factors. We have shown that MAZ proteins bind the MYB-E2F site in vitro and the MYB promoter in vivo and that they are critical not only to overcome transcriptional repression by RB family members, but also to activate transcription and that this regulation is essential for MYB induction during the exit from quiescence.The regulation of MYB transcription is particularly complex because both its initiation and its elongation are critical. Its transcriptional initiation is regulated by several factors, including MYB itself, NF-kB, JUN, PU.1 and E2F (6,19,34–38). Indeed, forced E2F1expression activates MYB transcription through its E2F element (6), thus indicating that this site can contribute to MYB promoter activation. E2F-mediated recruitment of RB family members to transcriptional regulatory regions plays a dominant negative role on gene expression (8,9). Consequently, most E2F-regulated genes are not activated before the G1-S transition, when RB family members are inactivated and released from E2F-bound promoters through their CDKs-mediated hyperphosphorylation. The MYB and MYC genes harbor E2F sites in their regulatory regions and are therefore expected to remain repressed by the E2F/p130-containing DREAM complex; both genes are activated however during the exit from quiescence (11,12,39), much earlier than the CDK-mediated inactivation of the RB family and its release from E2F factors. We have previously reported that two unidentified factors distinct from E2F, Myb-sp and EMYCS, bind respectively the MYB and MYC promoters through elements that overlap their E2F sites and proposed that these factors might help these genes to overcome their repression by RB family members during the exit from quiescence (5,13). EMYCS is unable to interact with the MYB-E2F site and shows an apparent mass of 105 kDa (13), whereas Myb-sp is unable to bind the MYC-E2F element and its apparent mass is 30 kDa. It thus seems that different E2F-regulated promoters are able to overcome RB family-mediated repression in G1 through the occupancy of their E2F sites by distinct proteins. EMYCS identity remains unknown, but we have uncovered now that Myb-sp contains MAZ proteins, also known as serum amyloid A activating factor (SAF) and Pur-1 (40,41).The MAZ family of zinc finger proteins was first identified as a transcription factor in the MYC promoter (24,42). MAZ binds GC-rich sequences, namely GGGAGGG or CCCTCCC, and plays an important role in modulating TATA-less gene transcription (43–47). MAZ is expressed ubiquitously at different levels in different tissues (48) and regulates the expression of a variety of genes besides MYC, including INS (40), CD4 (49), SAA1 (41), HTR2A (45), PNMT (43), FIBG (50), CLCNKA (51), RASH (52) and ADAM10 (53). Persistent high levels of MAZ are linked to various pathophysiological conditions, including amyloidosis, rheumatoid arthritis, atherosclerosis and the terminal phase of chronic myeloid leukemia (54–56). MAZ proteins can play dual roles in transcriptional regulation depending on the target gene; some promoters are activated (45,47,57), while others are repressed (44,46).MAZ also plays a role in transcription termination. In particular, MAZ can repress transcriptional elongation of MYB through its binding to a G-quadruplex structure formed by a GGA repeat region (GC box) located in its 5′UTR (29). It therefore seems that MAZ plays a dual role in MYBexpression regulation by either activating or terminating transcription through its binding to the E2F/MAZ element in the promoter or to the G-quadruplex structure, respectively. Net changes in MYBexpression might therefore be regulated through preferential recruitment of MAZ to the promoter or to the GGA repeat region. The interaction of other transcription factors with MAZ or their binding to their corresponding elements in the MYB gene may potentially increase MAZ affinity for one of its binding sites and therefore promote gene activation or repression. Forced expression of a non-specified MAZ isoform in HEK-293 cells decreased the activity of a transfected MYB regulatory region that included the promoter and its downstream GGA repeat region (29). In contrast, using a similar regulatory region in primary T lymphocytes, we have shown that the E2F/MAZ site in the MYB promoter is required for its activation. Moreover, while MAZ knockdown failed to affect MYB promoter regulation in HEK-293 cells (29), we have shown that MAZ silencing in primary T lymphocytes greatly impaired MYB mRNA induction during the exit from quiescence. The forced expression of a given MAZ isoform in HEK-293 cells might account for the discrepant result observed in MYB regulation. Supporting this hypothesis, MAZ-1 and MAZ-2 have shown opposing effects on the regulation of a reporter vector driven by three tandem copies of the MAZ site in the SAA promoter (25). However, using a reporter driven by two tandem copies of the MYB E2F/MAZ site, we have shown that MAZ-1, MAZ-2 and MAZ-2s activated transcription. Alternatively, our results might suggest that the net effect of MAZ on MYB regulation depends on the cell type or on the cell cycle status (continuously cycling cells versus cells exiting from quiescence), rather than on the MAZ isoform expressed.MAZ-1, MAZ-2 and MAZ-3 have been shown to regulate transcription of various genes (24–26) and we show now that MAZ-1, MAZ-2 and MAZ-2s bind the MYB combined E2F/MAZ site and activate transcription through this element. Moreover, we show that MAZ proteins overcome RB family-mediated transcriptional repression. In addition, we have obtained evidence suggesting the existence of an additional MAZ isoform, MAZ-1s. The use of the MAZ antibody M-13, raised against a peptide from the carboxy-terminal end of MAZ-1 and MAZ-3, in immunoblot assays identified a major protein of ∼50 kDa, the expected size of MAZ-1, in HEK-293T cells transfected with MAZ-1. However, an additional protein of ∼30 kDa was clearly detected also with this antibody in control cells and the signal was even stronger in MAZ-1 transfected cells. Whether this protein is the result of a new alternatively spliced isoform, a cleavage product of MAZ-1 or the product of an internal translation initiation site remains to be elucidated.Our UV cross-linking analysis showed that Myb-sp contained a protein of ∼30 kDa, which is similar to the relative mobility of MAZ-1s and MAZ-2s. Mass spectrometry analysis of this protein revealed six peptides common to all MAZ isoforms and an additional peptide that was present only in MAZ-2 and MAZ-2s. These results might suggest that MAZ-2s is the protein present in Myb-sp, but the inhibition of Myb-sp complex formation in EMSA assays by an antibody to MAZ-1/MAZ-3 (M-13) and the reactivity of this antibody to a short MAZ-1 isoform (or degradation product) of ∼30 kDa, rather support the notion that at least MAZ-1 and MAZ-2 (or their short isoforms) can regulate MYBexpression through the combined E2F/MAZ site.MAZ phosphorylation by various kinases regulates its activity. In particular, its phosphorylation at S460 by casein kinase II (CKII) increases MAZ DNA-binding activity (33). MAZ phosphorylation at T72 by the mitogen-activated protein kinase signaling pathway (58) or at S187 and T386 by protein kinase A (59) also increases MAZ activity. We could not assess MAZ phosphorylation at T72, S187 or T386 during the exit from quiescence, but we have found that MAZ S460 phosphorylation was markedly induced as early as 1 and 3 h after entry in the cell cycle. We therefore propose a model by which phosphorylation-mediated MAZ activation early after the exit from quiescence increases MAZ binding to the MYB promoter, likely through the E2F/MAZ element, alleviating DREAM-mediated repression until the phosphorylation-mediated inactivation of RB family members late in G1.Click here for additional data file.
Authors: Robert L Strausberg; Elise A Feingold; Lynette H Grouse; Jeffery G Derge; Richard D Klausner; Francis S Collins; Lukas Wagner; Carolyn M Shenmen; Gregory D Schuler; Stephen F Altschul; Barry Zeeberg; Kenneth H Buetow; Carl F Schaefer; Narayan K Bhat; Ralph F Hopkins; Heather Jordan; Troy Moore; Steve I Max; Jun Wang; Florence Hsieh; Luda Diatchenko; Kate Marusina; Andrew A Farmer; Gerald M Rubin; Ling Hong; Mark Stapleton; M Bento Soares; Maria F Bonaldo; Tom L Casavant; Todd E Scheetz; Michael J Brownstein; Ted B Usdin; Shiraki Toshiyuki; Piero Carninci; Christa Prange; Sam S Raha; Naomi A Loquellano; Garrick J Peters; Rick D Abramson; Sara J Mullahy; Stephanie A Bosak; Paul J McEwan; Kevin J McKernan; Joel A Malek; Preethi H Gunaratne; Stephen Richards; Kim C Worley; Sarah Hale; Angela M Garcia; Laura J Gay; Stephen W Hulyk; Debbie K Villalon; Donna M Muzny; Erica J Sodergren; Xiuhua Lu; Richard A Gibbs; Jessica Fahey; Erin Helton; Mark Ketteman; Anuradha Madan; Stephanie Rodrigues; Amy Sanchez; Michelle Whiting; Anup Madan; Alice C Young; Yuriy Shevchenko; Gerard G Bouffard; Robert W Blakesley; Jeffrey W Touchman; Eric D Green; Mark C Dickson; Alex C Rodriguez; Jane Grimwood; Jeremy Schmutz; Richard M Myers; Yaron S N Butterfield; Martin I Krzywinski; Ursula Skalska; Duane E Smailus; Angelique Schnerch; Jacqueline E Schein; Steven J M Jones; Marco A Marra Journal: Proc Natl Acad Sci U S A Date: 2002-12-11 Impact factor: 11.205
Authors: Josué Alvaro-Blanco; Lorena Martínez-Gac; Esther Calonge; María Rodríguez-Martínez; Irene Molina-Privado; Juan M Redondo; José Alcamí; Erik K Flemington; Miguel R Campanero Journal: Carcinogenesis Date: 2009-01-06 Impact factor: 4.944
Authors: Juan Antonio Vizcaíno; Attila Csordas; Noemi del-Toro; José A Dianes; Johannes Griss; Ilias Lavidas; Gerhard Mayer; Yasset Perez-Riverol; Florian Reisinger; Tobias Ternent; Qing-Wei Xu; Rui Wang; Henning Hermjakob Journal: Nucleic Acids Res Date: 2015-11-02 Impact factor: 16.971
Authors: Andrea Riba; Attila Oravecz; Matej Durik; Sara Jiménez; Violaine Alunni; Marie Cerciat; Matthieu Jung; Céline Keime; William M Keyes; Nacho Molina Journal: Nat Commun Date: 2022-05-23 Impact factor: 17.694
Authors: Carla Martín-Cortázar; Yuri Chiodo; Raul P Jiménez; Manuel Bernabé; María Luisa Cayuela; Teresa Iglesias; Miguel R Campanero Journal: Haematologica Date: 2019-06-20 Impact factor: 9.941