Literature DB >> 28959354

Partial Purification and Characterization of the Recombinant Benzaldehyde Dehydrogenase from Rhodococcus ruber UKMP-5M.

Arezoo Tavakoli1, Ainon Hamzah2.   

Abstract

BACKGROUND: Benzaldehyde dehydrogenase (BZDH) is encoded by the xylC that catalyzes the conversion of benzaldehyde into benzoate in many pathways such as toluene degradation.
OBJECTIVES: In this study, the xylC gene from Rhodococcus ruber UKMP-5M was expressed in Escherichia coli, purified, and characterized.
MATERIALS AND METHODS: The xylC was amplified and cloned in E. coli. The recombinant plasmid pGEMT-xylC was digested by NdeI and HindIII to construct plasmid pET28b-xylC and transformed in E. coli BL21 (DE3). Expression of the recombinant protein was induced by 1 mM isopropyl β-D-thiogalactoside (IPTG) at 37°C. The BZDH was purified by ion exchange chromatography, in which the product was an NAD-dependent enzyme using benzaldehyde as a substrate for enzyme characterization. The end metabolite was identified via gas chromatography mass spectrometry (GC-MS).
RESULTS: The recombinant BZDH is 27 kDa, purified by ion exchange chromatography. The activity of BZDH was 9.4 U.μL-1 The optimum pH and temperature were 8.5 and 25ºC, respectively. The Michaelis constant (Km) and maximum velocity (Vmax) were 4.2 mM and 19.7 U.mL-1, respectively. The metabolite of BZDH was benzene carboxylic acid as determined by GC-MS analysis.
CONCLUSIONS: BZDH has the ability to degrade benzaldehyde to less toxic compounds. The BZDH is a critical enzyme for the degradation of aromatic hydrocarbons in Rhodococcus sp. The BZDH from R. ruber UKMP-5M is showed similar function with other aldehyde dehydrogenases.

Entities:  

Keywords:  Benzaldehyde dehydrogenase; Purification; Rhodococcus ruber UKMP-5M

Year:  2017        PMID: 28959354      PMCID: PMC5582255          DOI: 10.15171/ijb.1344

Source DB:  PubMed          Journal:  Iran J Biotechnol        ISSN: 1728-3043            Impact factor:   1.671


1. Background

Rhodococcus ruber UKMP-5M is a hydrocarbon degrading bacteria through catabolic pathway crude oil and toluene (1). The toluene degradation pathway consists of two steps. The first is an upper pathway induced by toluene, which catalyzes the conversion of aromatic hydrocarbons to their carboxylic acid derivatives. The second is the lower pathway induced by benzoic acid (the alternative pathway); the product that is supplied by the upper pathway (2). Benzaldehyde dehydrogenase (BZDH) is an important enzyme involved in the upper pathway of toluene and xylene degradation. This enzyme is a member of aldehyde dehydrogenases, which detoxifies benzaldehyde to carboxylic acid compounds via irreversible oxidation reaction (3). Two types of BZDH are determined: type I induced by benzoylformate and involved in the mandelate pathway (4) and the type II induced by benzaldehyde involved in toluene and xylene degradation pathway (5). Type II of BZDH has been reported by many bacteria such as Pseudomonas putida (2), Acientobacter calcoaceticus (4), Rhodococcus rhodochrous OFS (6) and Pseudoxanthomonas spadix (7). The BZDH in P. putida mt-2 is encoded by the TOL plasmid (pWW0) to catalyze various mono aromatic alcohols and aldehydes (8). More catalytic efficiency with broad substrate specificity for BZDH has been shown in A. calcoaceticus (3,8). This paper describes the expression, purification, and characterization of BZDH from R. ruber UKMP-5M.

2. Objectives

Purification and characterization of BZDH from Rhodococcus ruber UKMP-5M was studied.

3. Materials and Methods

3.1. Cloning of the xylC Gene for BZDH

The total DNA of bacteria was extracted using Wizard genomic DNA-purification kit (Promega, Madison, USA). The xylC gene was amplified in an automated thermal cycler (Bio-Rad, California USA) using specific primers designed based on genome sequences from R. ruber UKMP-5M. Restriction enzyme recognition sites were underlined in the sequences. The forward oligonucleotide containing an NdeI site (CAꞌTATG) and reverse oligonucleotide with a HindIII site (AꞌAGCTT). Forward (xylC): 5'CATATGATGTCTCCTTCACCGGTTCCACCCCGG 3' Reverse (xylC): 5'AAGCTTTCAGAAGGGGTAACCGGGCACGTCGC 3' The purified DNA (~0.8 kb) was ligated into pGEM®-T Easy vector (Promega, Madison, USA) and transformed into competent cells of E. coli DH5α using a heat shock method at 42ºC for 50 s. The transformed E. coli was cultured on LB agar containing ampicillin (Sigma, Saint Louis USA) (50 µg.mL-1), 50 mg.mL-1 5-bromo-4-chloro-3-indoyl-b-D-galactopyranoside (X-Gal) (Promega, Madison, USA) and 100 mM isopropyl b-D-1-thiogalacto pyranoside (IPTG) (Sigma -Aldrich, Taufkirchen, Germany) for 16 h. The positive transformants were screened from white colonies by PCR. The plasmid pGEMT-xylC was extracted via QIAprep Miniprep kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions and analyzed using 1% agarose gel. Subsequently, the size and accuracy of plasmid pGEMT-xylC was determined by a supercoiled ladder (Promega, Madison, USA) as standard and PCR. The xylC fragments from pGEMT-xylC and pET 28b (Novagen, Madison, USA) were excised using the NdeI and HindIII restriction enzymes and recovered from agarose gel. The purified xylC was inserted into linearized pET 28b using T4 DNA ligase for 16 h at 16°C. The cloned was transformed into E. coli DH5α using heat shock method and the transformed cells were cultured onto LB agar containing kanamycin (50 mg.mL-1). The recombinant plasmid pET28b-xylC was extracted from positive transformants and screened by PCR‏. The nucleotide sequences of the plasmids pGEMT-xylC and pET28b-xylC were determined by DNA sequencing using xylC, M13 and T7 primers (universal primers). The sequencing data were analyzed by VecScreen, BLASTP, and BLASTN (9).

3.2. Expression of BZDH

The plasmid pET28b-xylC was transformed into E. coli BL21 (DE3). A pre-culture from the transformant was prepared in LB broth and incubated at 37ºC to reach optical density OD550 ~ 0.5. The standard inoculums (10%) were diluted to minimal salt medium (MSM) (10) induced by 0.5-2 mM benzaldehyde. The culture was incubated at 30°C, 150 rpm for 3 days and OD550 was measured. The control was run in parallel condition with E. coli BL21 (DE3) without recombinant plasmid. The pre-culture was prepared by inoculating a single colony of E. coli BL21 (DE3) into 10 mL LB broth containing 50 mg.mL-1 kanamycin and shaken at 37°C, 250 rpm for 16 h. The cells were centrifuged at 4ºC, 4000 rpm for 15 min and the supernatant was discarded. The resuspended pellet was diluted 5-fold (50 mL) and incubated to adjust an OD550 0.6. Culture (1 mL) was collected as an uninduced sample (control) and the culture was induced by adding IPTG (0.01-1 mM) at 37°C after 1, 2, 4, 6 and 16 h of incubation. The harvested cells were dissolved in lysis buffer (50 mM NaH2PO4 with 300 mM NaCl) (pH 8.0) and 1 μg.mL-1 lysozyme and 0.1 mM phenylmethyl sulfonyl fluoride (PMSF) (Sigma-Aldrich, Taufkirchen, Germany) added to the mixture and incubated in ice for 30 min. The cells were disrupted by sonicator (Sonics-vibra cell, Ontario, Canada) at 20 s pulses with 5 min rest for 30 min. The crude lysate was centrifuged at 12000 ×g for 60 min at 4°C. The supernatant and the pellet were separated and 15 mL of each sample loaded into 12% sodium dodecyl sulphate-polyacrylamide gel and run at 150 V. Expression was confirmed through western blot when the protein was transferred from the gel onto a nitrocellulose membrane at a constant voltage of 15 V for 45 min using Trans-Blot SD semi-dry electrophoretic transfer cell (Bio-rad, California USA). The target protein was determined after reaction with a monoclonal antibody.

3.3. Purification of BZDH

The BZDH was overexpressed in a 3L batch in optimal condition. The inclusion bodies were formed after high expression of target protein. Thus, some treatments such as use of lysozyme and sonication were applied to reduce the viscosity of the suspension followed by centrifugation at 12000 ×g for 60 min at 4ºC. The supernatant (25 mL) contained the desired protein and filtered with 0.22 mm membrane filter before start of purification. Purification was carried out by AKTA prime (No 1314455 Sweden; GE Healthcare, Uppsala, Sweden) using ion exchange chromatography according to the manuals’ instructions. In the first step, machine and column were washed stepwise with buffer A (wash buffer) containing 20 mM Tris or bis-tris (pH 6-8) with flow rate of 1 mL.min-1 and filtered sample was injected into the Hi Trap DEAE column (i.d × 0.7 × 2.5 cm) with flow rate of 0.8 mL.min-1 The enzyme was eluted with a linear gradient of NaCl (1 M) in buffer B (elution buffer) containing buffer A with 1 M NaCl. The machine and column were re-equilibrated with buffer A in the last step. The collected fractions from bound and unbound proteins were analyzed using SDS-PAGE and western blot. The protein was concentrated by a vivaspin or Amicon (Millipore, Hannover, Germany) protein column to maximum volume of 3 mL and the concentration of purified BZDH was measured using bicinchoninic acid (BCA) method at OD562 (11). Protein degradation during purification was reduced by adding dithiothreitol (DTT) or 2-mercaptoethanol (2-ME) into buffers at a low concentration of 0.5 mM.

3.4. Characterization of Purified BZDH

In BZDH reaction, nicotineamide adenine dinucleotide (β-NAD) was converted to a reduced form of NADH. All assay measurements were performed in triplicate.

3.4.1. Enzyme Assay

The mixture was prepared as follows: buffer (50 mM glycin-NaOH) 20 mL; H2O 119.15 ml and substrate (benzaldehyde) at final concentration of 0.85 mM; b-NAD (5 mM) 40 mL. The reaction was started after that 20 mL of purified BZDH was added and the reaction was monitored for 10 min with 1 min intervals at 25°C at 340 nm. The activity of enzyme was calculated by general equation based on unit.mL-1. One-unit enzyme activity is the amount of enzyme that catalyzes the conversion of 1.0 mM of substrate to the expected product per min at a standard assay condition (12).

3.4.2. Determination of Optimal pH and Temperature

The optimum pH was prepared in the standard assay conditions described before, except the following buffer systems from 6-11 were used: 50 mM K2HPO4 (pH 6-8), 50 mM Tris buffer (pH 8-10), and 50 mM NaHCO3 (pH 10-11) at 0.5 intervals. The mixture was incubated for 3 min at 25ºC and OD340 was measured. At optimal pH, the temperature was adjusted to 4, 20, 25, 37, 40, 50, 60, 70 and 80°C and enzyme assays were carried out. The reaction was stopped after 3 min and the absorbance was measured at OD340 .

3.4.3. The Kinetic Study of the Enzyme

The effect of substrate concentration on enzyme activity was evaluated by maximum velocity (Vmax) and Michaelis constant (Km) by varying concentration of benzaldehyde at the range of 0.005-4 mM to a total adjusted volume of 200 mL. The mixture incubated for 3 min at 25°C and OD340 was measured. Km and Vmax were calculated from Lineweaver-Burk plots.

3.4.4. Gas Chromatography-Mass Spectrometry (GC-MS) Analysis

The mixture was pre-incubated for 5 min and reaction was stopped by adding 300 mL of 0.1 M HCl. The protein was separated by Vivspin 500 (Sartorius, Gottingen, Germany) and 300 mL diethyl ether was added to residual liquid. The upper layer (1 mL) of volatile phase was injected into the injection port of the GC device.

4. Results

Rhodococcus ruber UKMP-5M was isolated from oil-contaminated soils in Malaysia. The xylC gene was amplified at 64°C and the resulting product was ~ 0.8 kb (Fig. 1A). The recombinant plasmid pGEMT-xylC was constructed, successfully transformed into E. coli DH5α and extracted from the positive transformants (Fig. 1B). The inserted fragment xylC was excised with double digestion using NdeI and HindIII (Fig. 1C). The xylC fragment was ligated into pET 28b at 15ºC to form the recombinant plasmid pET 28b-xylC, which was 6.2 kb, consisting of pET 28b (5.4 kb) and xylC (792 bp) (Fig. 1D). The highest growth of transformant E. coli BL21 containing pET 28b-xylC was determined when the cells incubated in 0.5 mM benzaldehyde for 24 h.
Figure 1
Agarose gel electrophoresis analysis of xylC. (A) DNA amplifi cation; Lane 1: 1 kb DNA Ladder, Lane 2, 3: PCR product before and after DNA purification, (B) Analysis of pGEMT-xylC. Lane 1: DNA Super-coiled ladder, Lane 2-3: Extracted pGEMT-xylC, (C) Double digestion of pGEMT-xylC. Lane 1: 1 kb DNA Ladder, Lane 2: DNA fragment xylC after being cleaved with NdeI and HindIII, (D) Analysis of pET 28b-xylC; Lane 1: DNA Supercoiled ladder, Lane 2: Extracted pET 28b-xylC. The transformed E. coli BL21 (DE3) was induced with 1 mM IPTG at 37ºC, which BZDH was successfully expressed for 2, 4, 6, and 16 h (Figs. 2A, B). The expression reached its highest level at 4 h post induction. A residual amount of BZDH was shown in pellet after SDS-PAGE, because of inclusion bodies formation. Using higher concentration of lysozyme in lysis buffer, high speed and long-time centrifugation reduced the protein aggregation. A BZDH protein has an approximate molecular weight of 27 kDa. The purified BZDH showed a single band on SDS-PAGE and the result was confirmed by western blot (Figs. 2C, D). The total concentration of BZDH was 1.18 mg.mL-1 as determined by BCA method. The results of BZDH purification from R. ruber UKMP-5M by anion exchange chromatography is summarized in Table 1, showing that the BZDH protein was purified at 14 folds with 85% yield.
Table 1

Summary of BZDH purification method from R. ruber UKMP-5M.

Purification stage Volume (mL) Total activity (Unit) Total protein (mg) Specific activity (U.mg -1 ) Yields (%) Purification folds
Cell-free extract304541892.41001
Ion exchange chromatography10389.411.8338514
Analysis of BZDH before and after purification. (A) SDS-PAGE after BZDH expression: Lanes 1-4: Cell free soluble extract (Supernatants) at 2, 4, 6, 16 h, Lane 5: Molecular weight marker (7-175 kDa), Lane 6-9: Insoluble extract induced at 2, 4, 6 and 16 h. The small amount of BZDH was determined in pellet because of inclusion bodies, Lane 10: Uninduced sample as negative controls. (B) Western blot after BZDH expression: Lanes 1-4: Cell free soluble extract (Supernatants) at 2, 4, 6 and 16 h, Lane 5: Molecular weight marker (7-175 kDa), Lanes 6-9: Insoluble extract (pellets) at 2, 4, 6 and 16 h. (C) SDS-PAGE after BZDH purification; Lanes 1: Molecular weight marker (7-175 kDa), Lanes 2: purified benzaldehyde dehydrogenase. (D)Western blot after BZDH purification: Lane 1: Molecular mass marker, Lane 2: purified benzaldehyde dehydrogenase. Optimum BZDH activity was at 9 min with the highest activity of 9.4 U.mL-1. The effect of different pHs on BZDH activity exhibited the highest level at pH 8.5 (Fig. 3A). The optimum temperature for BZDH was 25°C (Fig. 3B). Enzymatic activity decreased when the incubation temperature reached 50ºC (50% reduction in maximum activity). Vmax for the BZDH was 19.72 U.mL-1 and Km was 4.2 mM. The BZDH utilized benzaldehyde and the product was benzene carboxylic acid at a retention time of 12.5 min as determined by GC-MS.
Figure 3
effect of physical parameters on BZDH activity; (A) effect of diff erent pH on BZDH activity. The following buff ers were used: (■) 50 mM K2HPO4 (pH 6-8), (●) 50 mM Tris-buff er (pH 8-10), (▲) 50 mM NaHCO3 (pH 10 -11). The incubation time was 3 min.(B) effect of diff erent temperature on BZDH activity. Enzyme was assayed using 50 mM Tris-buff er at pH 8.5. The incubation time was 3 min.

5. Discussion

The BZDH encoded by xylC was involved in the bioconversion of benzaldehyde to benzene compounds (4)‏. The sequence analysis showed the similarity of xylC from R. ruber UKMP-5M with R. aetherivorans I24 (99%), NAD-dependent aldehyde dehydrogenase Saccharomonospora cyanea NA-134 (91%) and NAD-aldehyde dehydrogenase Rhodococcus sp. P14 (91%). However, the xylC from R. ruber UKMP-5M (264 amino acids) was shorter than many other xylC genes in other bacteria such A. calcoaceticus (484 aa) (13) and R. erythroplis (454 aa) (14). As a result, the molecular weight of BZDH in R. ruber UKMP-5M (27 kDa) that was less than similar mass in Pseudomonas sp strain DJ77 55 kDa (15), P. putida CSV86 (14) and P. putida sp (16) were 57 kDa. The BZDH sequence from R. ruber UKMP-5M was homologous with half of terminal part (C-terminal) of the other aldehyde dehydrogenases. However, another aldehyde dehydrogenase (Sequence ID spQ29491.1 ALDH2) was estimated at about 240 amino acids. The enzyme activity of BZDH was 9.4 U.mL-1 nearby to BZDH activity from P. putida MT53 (9.7 U.mL-1) (17). The optimal pH for the activity of BZDH from R. ruber UKMP-5M was 8.5, close to other studies by Pseudomonas fluorescens strain A.3.12 and Pseudomonas stutzeri ST-201 was 8.5 (18), Antirrhinum majus 8.0, (5) P. putida 9.0 (19), 9.3 for A. baylyi (20) and P. putida MT53 (16), 9.5 for A. calcoaceticus (21) and 9.6 for P. putida CSV86 (2). The stringent pH requirement for BZDH activity at the range of 8.0-10 suggests that the BZDH is highly specific with respect to hydrogen ion concentration (16,19). The optimum temperature for BZDH activity from R. ruber UKMP-5M and P. stutzeri ST-201 (18) was 25°C. The activity of BZDH was not stable for a long period and BZDH from R. ruber UKMP-5M, P. putida pWW0 MT53 and A. calcoaceticus (17) were losing 50% of enzyme activity at 50ºC within a period of one to 5 min. The Km value of BZDH from R. ruber UKMP-5M (4.2 mM) was much higher to what was reported earlier. The Km value for BZDH was 460 µM for P. putida (16), 1.4 µM for P. putida CSV86 (2), 2.5 mM for P. putida pWW0 (19), 0.63 mM for A. calcoaceticus, 0.79 mM for P. putida (17) and 7 mM reported for P. stutzeri ST-201 (18), indicate a different variation in specificity for BZDH, even within the same genus. The high Km value for BZDH from R. ruber UKMP-5M could be explained by a limited number of active sites when compared with other aldehyde dehydrogenases. As a result, the enzyme showed low affinity for benzaldehyde as a substrate, which requires to have greater concentration of substrate to achieve Vmax and the enzyme activity was highly dependent on substrate. It is possible that BZDH from R. ruber UKMP-5M has a preference for other substituted of benzaldehyde than benzaldehyde, which also showed in other BZDHs (21). The BZDH from R. ruber UKMP-5M showed lower Vmax compared to similar BZDH in P. putida (104 U.mL-1), A. calcoaceticus (63.5 U.mL-1) (17) and 48 U.mL-1 for P. putida (19), which lead to the low rate of catalysis. The high Km value and low Vmax for BZDH from R. ruber UKMP-5M suggest that this enzyme may be active in high concentration of benzaldehyde, although it is slow in catalytic reaction and may be applicable for biodegradation in high contaminated area with hydrocarbons. The BZDH from R. ruber UKMP-5M is able to convert benzaldehyde to benzene derivatives. The products of BZDH in P. putida CSV86 was benzoic acid (22), benzoate and its derivatives (16,2) as determined by GC-MS. The achievements of this paper show that benzaldehyde dehydrogenase is a NAD-dependent enzyme, important for hydrocarbon degradation through R. ruber UKMP-5M. The enzyme revealed similar characteristics to other aldehyde dehydrogenase even though it has smaller mass than others. However, it is apparent that benzaldehyde dehydrogenase has a catalytic mechanism differing from classical mechanisms, resulting in low affinity and slow catalysis for benzaldehyde. In spite of this fact, it could be possible that the other enzymes of R. ruber UKMP-5M interfere in hydrocarbon biodegradation. The previous studies indicated that although aldehyde dehydrogenases are similar to each other in terms of many properties, they are different with respect to features such as cofactor, substrate specifities, or genetic regulation. The results presented in this paper provide a starting point for a detailed molecular comparison of isolated BZDH R. ruber UKMP-5M with other BZDH.

Acknowledgments

The work was supported by grant number STGL-003-2007 and 02-01-02-SF0408.
  15 in total

1.  Substrate-specificity of benzyl alcohol dehydrogenase and benzaldehyde dehydrogenase encoded by TOL plasmid pWW0. Metabolic and mechanistic implications.

Authors:  J P Shaw; F Schwager; S Harayama
Journal:  Biochem J       Date:  1992-05-01       Impact factor: 3.857

2.  Metabolism of benzyl alcohol via catechol ortho-pathway in methylnaphthalene-degrading Pseudomonas putida CSV86.

Authors:  A Basu; S S Dixit; P S Phale
Journal:  Appl Microbiol Biotechnol       Date:  2003-04-10       Impact factor: 4.813

3.  Purification and characterization of benzyl alcohol- and benzaldehyde- dehydrogenase from Pseudomonas putida CSV86.

Authors:  Rahul Shrivastava; Aditya Basu; Prashant S Phale
Journal:  Arch Microbiol       Date:  2011-03-30       Impact factor: 2.552

4.  Benzyl alcohol dehydrogenase and benzaldehyde dehydrogenase II from Acinetobacter calcoaceticus. Substrate specificities and inhibition studies.

Authors:  R W MacKintosh; C A Fewson
Journal:  Biochem J       Date:  1988-10-15       Impact factor: 3.857

Review 5.  Human aldehyde dehydrogenase gene family.

Authors:  A Yoshida; A Rzhetsky; L C Hsu; C Chang
Journal:  Eur J Biochem       Date:  1998-02-01

6.  Molecular characterization of benzyl alcohol dehydrogenase and benzaldehyde dehydrogenase II of Acinetobacter calcoaceticus.

Authors:  D J Gillooly; A G Robertson; C A Fewson
Journal:  Biochem J       Date:  1998-03-15       Impact factor: 3.857

7.  Isolation and characterization of a benzoylformate decarboxylase and a NAD+/NADP+-dependent benzaldehyde dehydrogenase involved in D-phenylglycine metabolism in Pseudomonas stutzeri ST-201.

Authors:  Choedchai Saehuan; Theerasak Rojanarata; Suthep Wiyakrutta; Michael J McLeish; Vithaya Meevootisom
Journal:  Biochim Biophys Acta       Date:  2007-08-25

8.  Comparison of benzyl alcohol dehydrogenases and benzaldehyde dehydrogenases from the benzyl alcohol and mandelate pathways in Acinetobacter calcoaceticus and from the TOL-plasmid-encoded toluene pathway in Pseudomonas putida. N-terminal amino acid sequences, amino acid compositions and immunological cross-reactions.

Authors:  R M Chalmers; J N Keen; C A Fewson
Journal:  Biochem J       Date:  1991-01-01       Impact factor: 3.857

9.  Benzyl alcohol dehydrogenase and benzaldehyde dehydrogenase II from Acinetobacter calcoaceticus. Purification and preliminary characterization.

Authors:  R W MacKintosh; C A Fewson
Journal:  Biochem J       Date:  1988-03-15       Impact factor: 3.857

10.  Overlapping substrate specificities of benzaldehyde dehydrogenase (the xylC gene product) and 2-hydroxymuconic semialdehyde dehydrogenase (the xylG gene product) encoded by TOL plasmid pWW0 of Pseudomonas putida.

Authors:  J Inoue; J P Shaw; M Rekik; S Harayama
Journal:  J Bacteriol       Date:  1995-03       Impact factor: 3.490

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.