Literature DB >> 28955952

WTC rat has unique characteristics such as resistant to streptozotocin.

Yoshiaki Nagaki1, Koichi Ito1, Masayoshi Kuwahara1.   

Abstract

Because we found that WTC rats might be resistant to streptozotocin (STZ), we have elucidated the mechanisms of resistant to the diabetogenic effects of STZ in the WTC rats. Dose response to STZ was evaluated with glucose levels. No significant changes in glucose level to STZ administration were observed in WTC rats. Insulin secretion by suppling glucose was preserved in WTC rats even after STZ administration. Although there was no significant difference in gene expression of both GLUT2 and Kir6.2, which were involved in STZ resistance, between WTC rats and Wistar rats, the expression of metallothionein 2a in pancreas and liver to STZ administration of WTC rats was significantly higher than that of Wistar rats. Moreover, alloxan did not induce diabetes in WTC rats as same as STZ. These results suggest that WTC rats might have powerful antioxidant property to protect β cells in pancreas. Because the STZ-resistant property is very close characteristics to human beings, WTC rats will become a useful animal model in diabetic researches.

Entities:  

Keywords:  Alloxan; Diabetes; Metallothionein; Streptozotocin; WTC rat

Year:  2016        PMID: 28955952      PMCID: PMC5613963          DOI: 10.1016/j.bbrep.2016.08.024

Source DB:  PubMed          Journal:  Biochem Biophys Rep        ISSN: 2405-5808


Introduction

Type I diabetes is a chronic metabolic disorder characterized by a loss of pancreatic islet β cell mass, decreased serum insulin, and hyperglycemia. Although the pathogenic mechanisms of this disease have not been fully characterized, genetic, environmental, and autoimmune factors have been postulated. Streptozotocin (STZ)-induced diabetes in mice and rats has been used widely as an animal model to study type I diabetes [1], [2], because STZ causes β cell necrosis and insulin-dependent diabetes mellitus in many species [3]. Although a number of mammalian species are sensitive to STZ, rabbits are highly resistant with little metabolic or histologic evidence of β cell damage [4]. Even in rodents, mice are much less sensitive to the diabetogenic effects of STZ than rats. Moreover, it seems that human islets are likely to be relatively resistant to STZ from considerable evidences in vitro and in vivo studies [5]. WTC rats (control rats for tremor rats derived from Kyoto: Wistar rats), a congenic strain derived from an inbreeding line of tremor rats and bred as an inbred strain without the tm gene. The WTC shows neither neuropathological alteration nor abnormal phenotypes from defects in the CNS [6]. Because, unexpectedly, we found that the WTC rats might be highly resistant to STZ, we have elucidated the mechanisms of resistant to the diabetogenic effects of STZ in the WTC rats.

Materials and methods

Animals and induction of diabetes

All experimental procedures conformed to the animal use guidelines of the Committee for Ethics on Animal Experiments of The University of Tokyo. WTC (the National BioResource Project for the Rat in Japan, Kyoto University) and Wistar rats (Japan SLC, Inc.) were maintained under a controlled conditions at 23 °C with a 12-h light/dark cycle, and given free access to food and water. In 12-week-old male WTC rats and Wistar rats, the STZ (50 and 100 mg/kg) or alloxan (150 mg/kg) were administrated to render diabetic. Glycemia was measured using blood sample obtained from a tail vein 4 days post-injection of these drugs with One Touch Ultra (Johnson and Johnson, Japan) [7].

Measurement of insulin

For plasma insulin concentration measurement, animals were separated to two groups with and without after 4 days 50 mg/kg STZ injection. Each group was further separated to two groups: one group was fasted for overnight, another group was left for 60 min after orally given 2 g/kg glucose after fasted. Then, blood samples were drawn from the inferior vena cava under urethane (1 g/kg i.p.) anesthesia and centrifuged for 2 min, and the plasma was stored at −80 °C until use. Insulin concentrations were measured by a rat insulin ELIZA kit (Shibayagi Co., Japan).

Relative quantity of mRNA

The relative quantity of mRNA was measured for GLUT2 and Kir6.2, which were involved in insulin secretion and STZ-resistance [8], [9], [10], and metallothionein [11] using reverse transcription-polymerase chain reaction (RT-PCR) using TaKaRa PCR Amplification kit (TaKaRa BIO INC.). The target genes’ primers for RT-PCR are shown in Table 1 [11], [12], [13], [14]. Tissue samples for these experiments were collected from pancreas, skeletal muscles and liver. The expression was calculated with Image J and the raw data was normalized with the internal control GAPDH.
Table 1

The primers for RT-PCR.

geneSense primerAntisense primer
GLUT2CAATTTCATCATCGCCCTCTTGCAGCAATTTCGTCAAAAG
Kir6.2CGCATGGTGACAGAGGAATGGTGGAGAGGCACAACTTCGC
Mt1aGGACCCCAACTGCTCCTGCGAGGCACCTTTGCAGACAC
Mt2aCAGCGATCTCTCGTTGATCTCCCTTGTCCGAAGCCTCTTTGC
GAPDHCTCATGACCACAGTCCATGCTTCAGCTCTGGGATGACCTT
The primers for RT-PCR.

Statistical analysis

Results are expressed as mean±standard error of the mean (SEM). Statistical significance was assessed by unpaired t-test. Values were considered statistically significant at p<0.05.

Results

STZ resistance in WTC rats

Wistar rats were uniformly diabetic at doses of either 50 or 100 mg/kg STZ. However, no significant changes were observed in WTC rats (Fig. 1A). Insulin secretion by suppling glucose was significantly increased to almost the same level in Wistar rats and WTC rats. Although STZ injection did not affect insulin secretion both fasting and suppling glucose in Wistar rats, insulin secretion in WTC rats was significantly increased in both conditions (Fig. 1B). From these data, we considered that the WTC rats have unique STZ-resistant characteristics.
Fig. 1

Effects of STZ on glycemia and insulin secretion in Wistar rats and WTC rats. (A) Open bars show Wistar rat (n=6). Closed ones show WTC rat (n=6). *:p<0.05 VS 0 mg/kg. (B) Serum insulin levels were measured with and without STZ treatment in Wistar rats and WTC rats during fasted (open bars) or satiated (closed bars). *: p<0.05.

Effects of STZ on glycemia and insulin secretion in Wistar rats and WTC rats. (A) Open bars show Wistar rat (n=6). Closed ones show WTC rat (n=6). *:p<0.05 VS 0 mg/kg. (B) Serum insulin levels were measured with and without STZ treatment in Wistar rats and WTC rats during fasted (open bars) or satiated (closed bars). *: p<0.05.

GLUT2, Kir6.2 and metallothionein 2a mRNA expression

Because GLUT2 and Kir6.2 are involved in resistance against STZ [8], [9], [10], we examined the gene expression of GLUT2 and Kir6.2 at pancreas by RT-PCR to evaluate STZ-resistance in WTC rats. There was no significant difference in gene expression of both GLUT2 and Kir6.2 between WTC rats and Wistar rats (Fig. 2A and B). While STZ leads β cell death by promoting production of oxidant, we further examined the gene expression of metallothionein which was reported to have not only antioxidant but also anti diabetic function [15]. The expression of metallothionein 2a in pancreas and liver of Wistar rats was significantly decreased by STZ injection, but WTC rats did not show any changes (Fig. 3A-C). Therefore, WTC rats might have powerful antioxidant property to protect β cells in pancreas.
Fig. 2

The gene expressions of possible mechanisms relevance to uptake of STZ or enhanced secretion of insulin for the STZ resistance in WTC rats. (A) GLUT2 and (B) Kir6.2 expressions in Wistar rats (n=6) and WTC rats (n=6) were detected by RT-PCR. GAPDH was used as house keeping gene.

Fig. 3

The gene expressions of antioxidant property in some organs. Metallothionein (MT) 1A and 2A in (A) pancreas, (B) skeletal muscle and (C) liver were detected by RT-PCR. Open bars show their expression before STZ injection (n=4). Closed ones show the expression after STZ injection (n=4). GAPDH was used as house keeping gene. *: p<0.05.

The gene expressions of possible mechanisms relevance to uptake of STZ or enhanced secretion of insulin for the STZ resistance in WTC rats. (A) GLUT2 and (B) Kir6.2 expressions in Wistar rats (n=6) and WTC rats (n=6) were detected by RT-PCR. GAPDH was used as house keeping gene. The gene expressions of antioxidant property in some organs. Metallothionein (MT) 1A and 2A in (A) pancreas, (B) skeletal muscle and (C) liver were detected by RT-PCR. Open bars show their expression before STZ injection (n=4). Closed ones show the expression after STZ injection (n=4). GAPDH was used as house keeping gene. *: p<0.05.

Effect of alloxan on diabetes in WTC rats

To confirm this property of WTC rats, alloxan which is another diabetogenic agent via production of reactive oxygen species was tested [15]. As shown in Fig. 4, alloxan could not induce diabetes in WTC rats as same as STZ.
Fig. 4

Effect of alloxan on glycemia in Wistar rat and WTC rat. Open bars show Wistar rat (n=6). Closed ones show WTC rat (n=4). *: p<0.05 VS control.

Effect of alloxan on glycemia in Wistar rat and WTC rat. Open bars show Wistar rat (n=6). Closed ones show WTC rat (n=4). *: p<0.05 VS control.

Discussion

In this study, we found that WTC rats were highly resistant to STZ, and clearly showed STZ-resistant characteristics in these rats. No significant changes in glucose level to STZ administration were observed in WTC rats. Insulin secretion by suppling glucose was preserved in WTC rats even after STZ administration. Although there was no significant difference in gene expression of both GLUT2 and Kir6.2 between WTC rats and Wistar rats, the expression of metallothionein 2a in pancreas and liver to STZ administration of WTC rats was significantly higher than that of Wistar rats. Moreover, alloxan did not induce diabetes in WTC rats as same as STZ. These results suggest that WTC rats might have powerful antioxidant property to protect β cells in pancreas. Because the STZ-resistant property is very close characteristics to human beings, WTC rats will become a useful animal model in diabetic researches. At first we thought that possible mechanisms for the marked STZ resistance in WTC rats could be impaired uptake of STZ or enhanced secretion of insulin by pancreatic β cells. Expression in the plasma membrane of β cells of the glucose transporter isoform GLUT2 [17], [18], which has a high Km for glucose (17 mM) [19], [20] may be required for the normal functioning of the β cell glucose sensor [17], [18], [19], [20], [21]. Thus a decreased expression of GLUT2 is associated with the β cell dysfunction of rodent models of insulin dependent diabetes mellitus and non-insulin-dependent diabetes mellitus and decreased GLUT2 levels may impair normal glucose uptake and metabolism thereby preventing glucose sensing [22]. Therefore, we evaluated the gene expression of G to know how STZ resistance came out in WTC rat. But there were no significant differences of this gene between Wistar rat and WTC rat. Closure of ATP-sensitive K+ channels (KATP channels) in response to metabolically generated ATP or binding of sulfonylurea drugs stimulates insulin release from pancreatic β cells. The physiological importance of KATP channels in insulin secretion was established >20 years ago [23]. Heterozygous gain-of-function mutations in the KCJN11 gene encoding the Kir6.2 subunit of this channel are found in ∼47% of patients diagnosed with permanent diabetes at <6 months of age. At substimulatory glucose concentrations, K+ efflux through open KATP channels maintains the β cell membrane at a hyperpolarized potential of around −70 mV, which keeps voltage-gated Ca2+ channels closed [24]. Elevation of the blood glucose concentration increases glucose uptake and metabolism by the β cell, producing changes in cytosolic nucleotide concentrations that cause KATP channel closure. This leads to a membrane depolarization that opens voltage-gated Ca2+ channels initiating β cell electrical activity and Ca2+ influx, and the subsequent rise in [Ca2+]i triggers exocytosis of insulin granules. Therefore, we also evaluated the gene expression of Kir6.2. However, we could not find any difference in the expression of this gene between Wistar rats and WTC rats. On the other hand, because STZ leads β cell death by producing oxidative stress, we investigated the gene expression of metallothionein which has not only anti-oxidative but also anti-diabetic function [25]. Because liver and skeletal muscles are glucometabolic tissues, we investigated the gene expression in not only pancreas but also liver and skeletal muscles. In fact, the antioxidant capacity in Wistar rats was weakened by STZ injection, but not in WTC rats. Thus, it seems that the STZ-resistant mechanism in WTC rats may be its own possessed antioxidant ability. Earlier studies have shown that metallothionein has antioxidant effect by absorbing heavy metal, such as cadmium and so on, which makes from hydrogen peroxide to hydroxyl radical [26]. However, while it was shown that STZ-induced diabetes related to nitric oxide, the details of the reactive oxygen species (ROS) that STZ produces were still unknown. STZ and alloxan, cytotoxic glucose analogs, are the most prominent diabetogenic chemicals in diabetes research, although their cytotoxicity is achieved via different pathways [27]. The chemical properties of alloxan is generation of ROS, while DNA alkylation is thought main mechanisms of β cell death with STZ. Even though STZ is also generator of ROS including superoxide and hydroxyl radicals. Therefore, we investigated the response to alloxan, which induced diabetes by producing hydroxyl radical [16], to make it clear whether the course where hydrogen peroxide changes to a hydroxyl radical participates in STZ resistance in WTC rats. Alloxan also did not induce diabetes in WTC rats. These results suggest that the strength of antioxidant ability of production and resolution of hydrogen peroxide affects STZ resistance in WTC rats. WTC rats are sometimes used as a control of WTC-deafness KYOTO (WTC-dfk) rats [28]. WTC-dfk rats have a spontaneous mutation of KCNQ1 gene which produces a slowly activating delayed rectifier potassium current. Mutations of the human KCNQ1 gene are associated with the congenital long-QT syndrome and increases the risk of sudden death from cardiac arrhythmias. Moreover, a multistage genome-wide association study has shown that variants in KCNQ1 are associated with susceptibility to diabetes [29]. WTC and WTC-dfk strains are coisogenic and have an identical genetic background except for the dfk deletion. Therefore, WTC-dfk rats may also have the STZ-resistant characteristics same as WTC rats. Of course further studies will be needed, both of these strains of rats might be useful for diabetes research in the future. Moreover, there are a lot of animal models both type I and type II diabetes including chemically as well as genetically induced models in diabetes research [30]. In these models, there are many studies about diabetes using STZ-induced diabetic rats. Human islets are likely to be relatively resistant to STZ, but, typically, rats are high sensitive to STZ. And so, it is more difficult to discuss the relations between the results of the studies about diabetes using STZ-induced diabetic rats and the studies of treatments of human diabetes. So, WTC rats are expected to give us useful information about research on discoveries of the treatment of human diabetes. In conclusion, WTC rats are STZ resistant for its own strong antioxidant ability and WTC rats are expected to be useful to develop studies about diabetes.

Conflict of interest

None.
  30 in total

Review 1.  Molecular and cellular physiology of GLUT-2, a high-Km facilitated diffusion glucose transporter.

Authors:  B Thorens
Journal:  Int Rev Cytol       Date:  1992

2.  Suppression of endothelin-1-induced cardiac myocyte hypertrophy by PPAR agonists: role of diacylglycerol kinase zeta.

Authors:  Yingsu Huang; Haining Zhang; Zongjun Shao; Kimberley A O'Hara; Melanie A Kopilas; Liping Yu; Thomas Netticadan; Hope D Anderson
Journal:  Cardiovasc Res       Date:  2010-12-23       Impact factor: 10.787

Review 3.  Molecular physiology of glucose transporters.

Authors:  B Thorens; M J Charron; H F Lodish
Journal:  Diabetes Care       Date:  1990-03       Impact factor: 19.112

4.  WTC deafness Kyoto (dfk): a rat model for extensive investigations of Kcnq1 functions.

Authors:  Hiroshi Gohma; Takashi Kuramoto; Mitsuru Kuwamura; Ryoko Okajima; Noriaki Tanimoto; Ken-ichi Yamasaki; Satoshi Nakanishi; Kazuhiro Kitada; Takeru Makiyama; Masaharu Akao; Toru Kita; Masashi Sasa; Tadao Serikawa
Journal:  Physiol Genomics       Date:  2005-12-20       Impact factor: 3.107

5.  [Alloxan radical-induced generation of reactive oxygen species in the reaction system of alloxan with ascorbate].

Authors:  Mika Katoh; Koichi Sakurai; Yukio Fujimoto
Journal:  Yakugaku Zasshi       Date:  2002-10       Impact factor: 0.302

6.  Evaluation of a glucose meter for determining the glycemic responses of foods.

Authors:  Amogh Velangi; Glen Fernandes; Thomas M S Wolever
Journal:  Clin Chim Acta       Date:  2005-03-29       Impact factor: 3.786

7.  The use of animal models in diabetes research.

Authors:  Aileen J F King
Journal:  Br J Pharmacol       Date:  2012-06       Impact factor: 8.739

8.  Alterations of benzodiazepine receptor binding in tremor rats with absence-like seizures.

Authors:  Y Shirasaka; M Ito; H Mikawa; T Serikawa; J Yamada
Journal:  J Neurochem       Date:  1992-06       Impact factor: 5.372

Review 9.  The mechanisms of alloxan- and streptozotocin-induced diabetes.

Authors:  S Lenzen
Journal:  Diabetologia       Date:  2007-12-18       Impact factor: 10.122

10.  Effect of combined treatment with clozapine and metformin on fasting blood glucose, insulin level, and expression of the glucose transporter-2 (GLUT2) in Sprague-Dawley rats.

Authors:  Lan Gao; Gaohua Wang; Hao Liu; Chaohui Yan
Journal:  Shanghai Arch Psychiatry       Date:  2013-06
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.