| Literature DB >> 28955312 |
Federica Valdetara1, Daniela Fracassetti1, Alessia Campanello1, Carlo Costa2, Roberto Foschino1, Concetta Compagno1, Ileana Vigentini1.
Abstract
Dekkera/Brettanomyces bruxellensis, the main spoilage yeast in barrel-aged wine, metabolize hydroxycinnamic acids into off-flavors, namely ethylphenols. Recently, both the enzymes involved in this transformation, the cinnamate decarboxylase (DbCD) and the vinylphenol reductase (DbVPR), have been identified. To counteract microbial proliferation in wine, sulfur dioxide (SO2) is used commonly to stabilize the final product, but limiting its use is advised to preserve human health and boost sustainability in winemaking. In the present study, the influence of SO2 was investigated in relation with pH and ethanol factors on the expression of DbCD and DbVPR genes and volatile phenol production in D. bruxellensis CBS2499 strain under different model wines throughout a response surface methodology (RSM). In order to ensure an exact quantification of DbCD and DbVPR expression, an appropriate housekeeping gene was sought among DbPDC, DbALD, DbEF, DbACT, and DbTUB genes by GeNorm and Normfinder algorithms. The latter gene showed the highest expression stability and it was chosen as the reference housekeeping gene in qPCR assays. Even though SO2 could not be commented as main factor because of its statistical irrelevance on the response of DbCD gene, linear interactions with pH and ethanol concurred to define a significant effect (p < 0.05) on its expression. The DbCD gene was generally downregulated respect to a permissive growth condition (0 mg/L mol. SO2, pH 4.5 and 5% v/v ethanol); the combination of the factor levels that maximizes its expression (0.83-fold change) was calculated at 0.25 mg/L mol. SO2, pH 4.5 and 12.5% (v/v) ethanol. On the contrary, DbVPR expression was not influenced by main factors or by their interactions; however, its expression is maximized (1.80-fold change) at the same conditions calculated for DbCD gene. While no linear interaction between factors influenced the off-flavor synthesis, ethanol and pH produced a significant effect as individual factors. The obtained results can be useful to improve the SO2 management at the grape harvesting and during winemaking in order to minimize the D./B. bruxellensis spoilage.Entities:
Keywords: D./B. bruxellensis; cinnamate decarboxylase gene; gene expression; response surface methodology; vinylphenol reductase gene; volatile phenols
Year: 2017 PMID: 28955312 PMCID: PMC5601905 DOI: 10.3389/fmicb.2017.01727
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Runs of Box–Behnken experimental design, normalized relative expression values of DbCD and DbVPR genes, expressed as fold-change, and quantification of vinyl phenol, vinyl guaiacol, ethyl phenol, and ethyl guaiacol, expressed as ratios between μmoles of product (volatile phenols) on μmoles of relative consumed precursor (coumaric and ferulic acids) for the different trials.
| Conc. (mg/L) | Yield (μM product/μM consumed acid) | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Run | mol. SO2 (mg/L) | pH | Ethanol (v/v) | Ferulic acid | Vinyl phenol | Vinyl guaiacol | Ethyl phenol | Ethyl guaiacol | Vinyl phenol | Vinyl guaiacol | Ethyl phenol | Ethyl guaiacol | |||
| 1 | 0 | 3.5 | 8.75 | 0.49 | 1.22 | 2.35 | 1.64 | 1.09 | 0.036 | 2.45 | 2.29 | 0.25 | 0.01 | 0.55 | 0.58 |
| 2 | 0.25 | 3.5 | 8.75 | 0.45 | 1.33 | 2.39 | 1.92 | 0.71 | 0.029 | 4.15 | 3.46 | 0.16 | 0.01 | 0.94 | 0.93 |
| 3 | 0 | 4.5 | 8.75 | 0.52 | 1.47 | 3.81 | 1.81 | 1.13 | 0 | 2.67 | 1.92 | 0.35 | 0.00 | 0.80 | 0.51 |
| 4 | 0.25 | 4.5 | 8.75 | 0.66 | 1.80 | 4.11 | 2.82 | 0.35 | 0 | 2.54 | 1.57 | 0.12 | 0.00 | 0.83 | 0.53 |
| 5 | 0 | 4 | 5 | 0.30 | 1.47 | 0.86 | 0.42 | 0.40 | 0 | 5.73 | 4.29 | 0.07 | 0.00 | 1.02 | 0.87 |
| 6 | 0.25 | 4 | 5 | 0.14 | 0.80 | 3.86 | 2.66 | 0.10 | 0 | 2.53 | 1.96 | 0.03 | 0.00 | 0.77 | 0.63 |
| 7 | 0 | 4 | 12.5 | 0.24 | 0.67 | 3.43 | 2.43 | 1.87 | 0.075 | 2.16 | 2.00 | 0.53 | 0.02 | 0.60 | 0.60 |
| 8 | 0.25 | 4 | 12.5 | 0.38 | 0.91 | 3.45 | 2.78 | 2.24 | 0.324 | 2.52 | 2.28 | 0.64 | 0.11 | 0.70 | 0.75 |
| 9 | 0.125 | 3.5 | 5 | 0.33 | 0.99 | 0.39 | 0.37 | 0.14 | 0 | 6.45 | 5.18 | 0.02 | 0.00 | 1.08 | 1.04 |
| 10 | 0.125 | 4.5 | 5 | 0.39 | 1.11 | 1.26 | 0.66 | 0.26 | 0 | 5.65 | 3.90 | 0.05 | 0.00 | 1.07 | 0.82 |
| 11 | 0.125 | 3.5 | 12.5 | 0.40 | 0.94 | 2.34 | 2.33 | 1.75 | 0.092 | 2.41 | 2.70 | 0.40 | 0.03 | 0.54 | 0.80 |
| 12 | 0.125 | 4.5 | 12.5 | 0.65 | 0.92 | 4.08 | 2.07 | 1.55 | 0.021 | 2.06 | 1.37 | 0.51 | 0.01 | 0.66 | 0.38 |
| 13 | 0.125 | 4 | 8.75 | 0.21 | 0.85 | 3.16 | 2.13 | 0.59 | 0 | 3.56 | 2.62 | 0.16 | 0.00 | 0.93 | 0.74 |
| 14 | 0.125 | 4 | 8.75 | 0.15 | 0.89 | 2.29 | 1.61 | 0.51 | 0.024 | 2.60 | 2.00 | 0.11 | 0.01 | 0.58 | 0.50 |
| 15 | 0.125 | 4 | 8.75 | 0.18 | 0.72 | 3.17 | 2.06 | 0.76 | 0 | 3.37 | 2.61 | 0.20 | 0.00 | 0.88 | 0.72 |
Primer pairs used for quantitative PCR (qPCRs).
| Oligo name | Sequence (5′ → 3′) | Tm (°C) | Reference |
|---|---|---|---|
| CTATCAAGGTCGGAAACCCA | 57.3 | This study | |
| TCTCTCACCACCAGTAAGGA | 57.3 | This study | |
| TTATTGATAACGGTTCTGGTATGT | 55.9 | ||
| ACCCATACCGACCATGATAC | 57.3 | ||
| CTCCAGTTGTTGACTGCCA | 56.7 | ||
| CATCTTAACCATAGCAGCATCAC | 58.9 | ||
| GTGGTTTGCTTTCCGACTAC | 57.3 | This study | |
| AAACAGCGGACTTGACCTTAC | 57.9 | This study | |
| GTATCTGCTACCAGAAACCAACC | 60.6 | ||
| CCCTCACTAACATACCAGTGGAC | 62.4 | ||
| CACAGACTCGAACGGAAAAC | 57.3 | ||
| CCAGGGCGTACACATTGATA | 57.3 | ||
| CTAAGGGCACTATCAAGGACA | 57.9 | ||
| CTGCAAAGAACCAGCATCA | 54.5 | ||
Candidate genes for their potential as housekeeping genes (HKGs).
| Gene | Acc. SD | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| LSA | LSA | LSB | LSB | HSA | HSA | HSB | HSB | |||
| 19.51 | 19.77 | 20.10 | 20.12 | 19.05 | 18.62 | 18.6 | 18.5 | 0.373 | 0.2398 | |
| 14.2 | 13.98 | 14.04 | 13.94 | 14.46 | 14.65 | 15.06 | 15.13 | 0.564 | 0.1523 | |
| 11.77 | 11.65 | 12.22 | 12.19 | 12.66 | 12.64 | 13.42 | 13.19 | 0.741 | 0.2762 | |
| 16.71 | 16.83 | 16.86 | 16.49 | 16.89 | 17.04 | 17.28 | 17.34 | 0.186 | 0.0929 | |
| 17.58 | 17.23 | 17.27 | 17.53 | 18.17 | 18.13 | 18.01 | 17.75 | 0.186 | 0.1443 | |
Regression equations which fitted to the data of the Box–Behnken experimental design.
| Variable ( | Regression model equation | |
|---|---|---|
| 98.3 | ||
| 87.3 | ||
| Vinyl phenol yield | 94.5 | |
| Vinyl guaiacol yield | 81.2 | |
| Ethyl phenol yield | 71.8 | |
| Ethyl guaiacol yield | 78.2 | |
Statistical analysis (value are expressed as P) of main effect of three variables and their interaction for DbCD and DbVPR expression levels and volatile phenol productions.
| Yield (μM product/μM consumed acid) | ||||||
|---|---|---|---|---|---|---|
| Factor | Vinyl phenol | Vinyl guaiacol | Ethyl phenol | Ethyl guaiacol | ||
| 0.456 | 0.989 | 0.3090 | 0.1805 | 0.5915 | 0.5164 | |
| 0.190 | 0.4067 | 0.5201 | 0.6185 | |||
| 0.146 | 0.0934 | |||||
| 0.1556 | 0.3078 | 0.6576 | 0.6859 | |||
| 0.9146 | 0.3727 | 0.7917 | 0.8387 | |||
| 0.8635 | 0.164 | 0.0710 | 0.1694 | 0.8552 | 0.2733 | |
| 0.593 | 0.4111 | 1.0000 | 0.3294 | 0.2973 | ||
| 0.064 | 0.3810 | 0.0791 | 0.3417 | 0.2277 | ||
| 0.052 | 0.727 | 0.6303 | 0.6456 | 0.7126 | 0.5124 | |