| Literature DB >> 28949384 |
June Seok Heo1, Seung Gwan Lee2, Hyun Ok Kim3.
Abstract
Mesenchymal stem cells (MSCs) differentiate into multiple lineages and are a promising source of cells for clinical use. Previously, we found that the gene distal‑less homeobox 5 (DLX5) is specifically expressed in MSCs with osteogenic potential. Understanding the mechanism of osteogenesis is necessary for successful bone regeneration using MSCs. The aim of this study was to examine the function of theEntities:
Mesh:
Substances:
Year: 2017 PMID: 28949384 PMCID: PMC5627883 DOI: 10.3892/ijmm.2017.3142
Source DB: PubMed Journal: Int J Mol Med ISSN: 1107-3756 Impact factor: 4.101
Primer sequences.
| Gene name | Primer sequences (5′-3′) | Annealing temperature (°C) | Product size (bp) |
|---|---|---|---|
| Forward: CGAGGTCCTGAGCGAGTTCGAG | |||
| Reverse: TGGCAGTAAAAGGCGTGATACC | 60 | 838 | |
| Forward: GACCAGTCTTACCCCTCCTACC | |||
| Reverse: CTGCCTGGCTCTTCTTACTGAG | 58 | 190 | |
| Forward: ACCATCCGTCTCAGGAATCG | |||
| Reverse: ACCTTCTCTGTAATGCGGCC | 60 | 384 | |
| Forward: GTGGTCTCCTCTGACTTCAACA | |||
| Reverse: CTCTTCCTCTTGTGCTCTTGCT | 62 | 210 | |
| Forward: CCAACGTCATCCTGAAGAAATAC | |||
| Reverse: GCTTGTAGGATCTTGTTCATTGG | 60 | 271 | |
| Forward: GCCGGGCAAGGCTGACCTGAAG | |||
| Reverse: TTCTGGTGGTCGGTGTAGTCGT | 62 | 605 | |
| Forward: TCTCTCCGTAATGGAAGACC | |||
| Reverse: GCATTATGAGACATCCCCAC | 55 | 474 | |
| Forward: CCAAGAAGTCGGTGGACAAGAA | |||
| Reverse: TCATTGTCACTGGTCAGCTCCA | 62 | 145 | |
| Forward: TAATGGGCTCCTTTCACCTG | |||
| Reverse: CACTGGGCAGACAGTCAGAA | 60 | 161 | |
| Forward: GAGACCCTTCCAAGTAAGTCCA | |||
| Reverse: GATGTCCTCGTCTGTAGCATCA | 62 | 354 | |
| Forward: CACAGAGGTTTCAGTGGTTTGG | |||
| Reverse: GCACCAGTAGCACCATCATTTC | 62 | 191 | |
| Forward: AAGAAGTAGGAGTGGGCTTTGC | |||
| Reverse: CCACCACCAGTTTATCATCCTC | 62 | 381 |
BMP2, bone morphogenetic protein; RUNX2, runt-related transcription factor 2; DLX5, distal-less homeobox 5; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SOX9, sex determining region Y-box 9; PPARG, peroxisome proliferator-activated receptor γ; C/EBPA, CCAAT-enhancer binding protein α.
Figure 1Morphology and differentiation potential of mesenchymal stem cells (MSCs). (A) Phase contrast images of MSCs derived from bone marrow and cord blood (scale bar, 100 µm; magnification, ×200). (B) Differentiation capacity was examined after induction. Osteogenesis was verified by Von Kossa staining (scale bar, 100 µm; magnification, ×200). Chondrogenesis was investigated by safranin O staining (scale bar, 100 µm; magnification, ×200). Adipogenesis was examined by Oil Red O staining (scale bar, 50 µm; magnification, ×400).
Figure 2Time course images of osteogenic differentiation and expression of osteogenesis-related markers. Top panels: images of BM-MSC1 induced by osteogenic medium, and RT-PCR analysis of osteogenesis-associated markers in BM-MSC1. Second row: images of BM-MSC2 differentiated by osteogenic medium, and RT-PCR analysis of osteogenesis-related markers in BM-MSC2. Third row: images of CB-MSC1 induced by osteogenic medium, and RT-PCR analysis of osteogenesis-associated markers in CB-MSC1. Lower panels: images of CB-MSC2 induced by osteogenic medium, and RT-PCR analysis of osteogenesis-related markers in CB-MSC2. Osteogenesis was evaluated by Von Kossa staining (scale bar, 100 µm; magnification, ×200).
Figure 3Changes in mesenchymal stem cells (MSCs) following knockdown of distal-less homeobox 5 (DLX5). (A) Phase contrast images before and after silencing of DLX5 (scale bar, 200 µm; magnification, ×100). (B) RT-PCR analysis of osteogenesis-, adipogenesis- and chondrogenesis-associated genes in the control and DLX5 siRNA-transfected MSCs. Decreased osteogenic differentiation of MSCs following knockdown of DLX5. (C) Inhibition of DLX5 expression prevents osteogenesis of MSCs. The differentiation capacity of MSCs was analyzed after induction. (a) Osteogenesis assessed by Von Kossa staining. (b) Chondrogenesis assessed by safranin O staining. (c) Adipogenesis assessed by Oil Red O staining (scale bar, 100 µm). Relative mRNA expression levels of differentiation-associated markers in the control and DLX5-siRNA-transfected MSCs after (D) osteogenic induction, (E) chondrogenic induction, and (F) adipogenic induction. *P<0.05.
Figure 4Effect of tanshinone IIA on osteogenesis. (A) Mesenchymal stem cells (MSCs) treated with tanshinone IIA were photographed after 3 days (scale bar, 200 µm; magnification, ×100). (B) Cell viability was determined by trypan blue staining. The cell viability of the tanshinone IIA-treated MSCs was >90%. (C) Induction of osteogenesis-associated genes by tanshinone IIA treatment. Treatment only with 6 µM tanshinone IIA induced BMP2, distal-less homeobox 5 (DLX5) and osterix genes.
Figure 5Changes in mesenchymal stem cells (MSCs) following tanshinone IIA treatment. (A) RT-PCR analysis of osteogenesis-, chondrogenesis- and adipogenesis-associated genes in the control and tanshinone IIA-induced MSCs. Increased osteogenic differentiation of MSCs by tanshinone IIA. (B) Induction of distal-less homeobox 5 (DLX5) expression enhanced osteogenesis of DLX5 not-expressing MSCs. The differentiation capacity of the cells was analyzed after induction. (a) Osteogenesis assessed by Von Kossa staining (scale bar, 50 µm). (b) Chondrogenesis assessed by safranin O staining (scale bar, 100 µm). (c) Adipogenesis assessed by Oil Red O staining (scale bar, 50 µm). (C) Calcium concentrations were measured in triplicate using a Calcium LiquiColor test. Relative mRNA expression levels of differentiation-associated markers in the control and DLX5-induced MSCs after (D) osteogenic induction, (E) chondrogenic induction, and (F) adipogenic induction. *P<0.05 and **P<0.01.
Figure 6Model summarizing osteogenesis in mesenchymal stem cells (MSCs). Distal-less homeobox 5 (DLX5) and DLX5 inducer, tanshinone IIA, promote the differentiation of MSCs into osteoblasts by upregulating osteogenesis-related genes.