Literature DB >> 28948171

Identification and Characterization of a Splicing Variant in the 5' UTR of the Human TLR5 Gene.

Thi Xoan Hoang1, Cao Nguyen Duong1, Jae Young Kim1.   

Abstract

Toll-like receptors (TLRs) are essential components of the innate immune system. TLR5 is the receptor for flagellin, the principal protein component of bacterial flagella. The TLR5 gene has 6 exons. In an RT-PCR analysis, we found long TLR5 transcripts, in addition to those of the expected size (short TLR5 transcripts). A sequence analysis revealed that the long TLR5 transcripts contain a new exon of 94 nucleotides located between previously reported exons IV and V in the 5' untranslated region (5' UTR). A real-time PCR analysis of the two alternatively spliced variants in various cell lines showed that the long TLR5 transcripts are abundantly expressed in nonimmune cells. The ratios of long/short transcripts in human nonimmune cell lines, such as A549, T98G, HaCaT, H460, HEK-293, and Caco-2 cells, and primary mesenchymal stem cells were in the range of 1.25 to 4.31. In contrast, those of human monocytic THP-1 and U937 cells and E6.1 T cells and Ramos B cells were around 0.9. These ratios in human monocytic THP-1 cells were decreased by treatment with IFN-γ in a concentration-dependent manner. Based on our findings, we suggest that the newly found long TLR5 transcripts may be involved in the negative regulation of TLR5 expression and function.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28948171      PMCID: PMC5602658          DOI: 10.1155/2017/8727434

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Toll-like receptors (TLRs) are innate immune receptors that consist of an extracellular domain for the recognition of pathogenic components and a cytoplasmic tail with a conserved Toll/IL-1 receptor (TIR) domain for the generation of intracellular signaling [1]. Upon TLR stimulation by pathogenic components, the TIR domain recruits signaling molecules to activate the transcription of diverse genes, including inflammatory and antimicrobial mediators [1]. TLR signaling must be tightly controlled to avoid the overproduction of proinflammatory mediators that would be harmful to the host. As a control mechanism, alternative splicing can be used to modulate the expression and function of TLRs. Members of the TLR signaling pathway are alternatively spliced at a high frequency, producing novel proteins that can change inflammatory outcomes. Alternative splicing has been found in mammalian TLR genes and their homologs in plants and Drosophila [2-4]. Mouse TLR4 has two splicing variants that are inducible by interferon-γ priming as well as LPS stimulation of primary macrophages [5]. Alternative splicing of human TLR has also been reported. Human TLR1, TLR2, TLR3 [6], and TLR9 [7] have two splicing variants, while TLR4 has four splicing variants, all of which change the length of the extracellular domain, but their functional significance has not been examined [5]. Alternative splicing of key TLR signaling components, such as MyD88 and IRAK, has also been reported. A splicing variant of MyD88, termed MyD88s, which lacks the intermediate region between the TIR domain and the death domain, inhibits inflammatory signals that are normally mediated by MyD88 in both mouse [8] and human [9] cells. IRAK also has splicing variants. Two splicing variants of murine IRAK2 are inhibitory [10], and a splicing variant of human IRAK1 is inhibitory [11]. These studies suggest that the splicing of TLR signaling molecules is involved in the resolution of TLR-directed immune responses. In the present study, we identified and characterized a new splicing variant in the 5′ untranslated region (5′ UTR) of the human TLR5 gene.

2. Materials and Methods

2.1. Cell Culture

Human cell lines, including monocytes (THP-1), T cells (E6.1), keratinocytes (HaCaT), and lung epithelial cells (A549), were purchased from ATCC (Manassas, VA, USA). Human umbilical cord mesenchymal stem cells (MSCs) were obtained from PromoCell (Heidelberg, Germany). The human glioblastoma cell line T98G, monocytes (U937), B cells (Ramos), lung epithelial cells (H460), embryonic kidney epithelial cells (HEK-293), and intestinal epithelial cells (Caco-2) were obtained from the Korean Cell Line Bank (Seoul, Korea). E6.1, Ramos, THP-1, and U937 cells were grown in RPMI-1640 media (Welgene Inc., Daegu, Korea) with 10 mM HEPES buffer (Invitrogen Corp., Gibco BRL, Gaithersburg, MD, USA) and β-mercaptoethanol (Invitrogen Corp.). A549 cells and HaCaT cells were grown in DMEM (Welgene Inc.). T98G cells were grown in MEM (Welgene Inc.) supplemented with 1 mM sodium pyruvate solution (Sigma-Aldrich, St. Louis, MO, USA) and MEM Nonessential Amino Acid Solution (Sigma-Aldrich). H460 cells were grown on RPMI-1640 media (Welgene Inc.). HEK-293 cells were grown in DMEM media (Welgene Inc.) with 2 mM L-glutamine (Sigma-Aldrich). Caco-2 cells were grown on DMEM (Welgene Inc.) with 4 mM L-glutamine (Sigma-Aldrich) and 1% nonessential amino acids (Sigma-Aldrich). All media were supplemented with 10% heat-inactivated fetal bovine serum and 1% antibiotic-antimycotic (Invitrogen Corp.). MSCs were grown on MSC growth medium (PromoCell) with 1% antibiotic-antimycotic (Invitrogen Corp.) and 5 μg/ml Plasmocin (InvivoGen, San Diego, CA, USA). The cells were maintained at 37°C in a 5% CO2 humidified incubator. To examine TLR5 alternative splicing, THP-1 cells (1 × 105 cells/ml) were treated with IFN-γ (Invitrogen Corp.) for 0–24 h.

2.2. Primers

To detect TLR5 alternative splicing, specific primers for RT-PCR were designed to bind to exons I and VI (Figure 1(a), dotted arrows) or exons IV and V (Figure 1(a), solid arrows). To quantify splicing variants of TLR5, specific primers were designed for real-time quantitative PCR (RT-qPCR). The primers that recognize the new exon (designated V in Figure 4) were used to detect long TLR5 transcripts (solid arrows). Short TLR5 transcripts were detected by primers recognizing the boundary between exons IV and V (dashed arrows). The primers for the TLR5 reference that recognize exon VII are represented as dotted arrows. The primer sequences are listed in Table 1.
Figure 1

The exon structure of the human TLR5 gene and detection of TLR5 splice variants in human monocytic THP-1 cell line. (a) Human TLR5 contains seven exons (depicted as boxes). Exons IV+ are alternative (marked by shading). (b) PCR was performed with primers designed to exons I and VI (dotted arrows), or (c) exon IV and exon V (solid arrows). The amplified products were visualized by gel electrophoresis. IV+ designates the newly discovered exon.

Figure 4

Ratios of long TLR5 transcripts to short TLR5 transcripts in several different cell lines. Expression of long TLR5 transcripts was quantified by RT-qPCR using primers recognizing exon V (primer pairs were represented by solid arrows), while expression of short TLR5 transcripts was quantified using primers recognizing the boundary between exons IV and VI (primer pairs were represented by dashed arrows). Exon VII was used as a reference gene (primer pairs were represented by dotted arrows). The expression level of short TLR5 transcripts was arbitrarily set to 1. ∗ indicates p < 0.05 as compared with THP-1.

Table 1

Primer sequences.

NameA/SPrimer sequence (5′ → 3′)Product size (bp)
Detection primer long TLR5AGAGGCGTCCCAGAGTCTC565
SCCTCGTTGTCCTAGCAGAAG

Detection primer short TLR5AGACTTCCCTACTCTCATCTGCT300
SCTTATTCTAGGGGCAGAGGGT

Quantification primer TLR5 referenceACTTCCTGCTCCTTTGATGGC114
STCCTGATATAGTTGAAGCTCAGC

Quantification primer long TLR5AGAGACAGAGTATCAGCGCCTTTG134
STTGGTGAATCAGGAGAAAGGACTT

Quantification primer short TLR5AGACTTCCCTACTCTCATCTGCTC185
SGGACTTTTTGTTTTCCTGTCTCCA

GAPDHAACAGCCTCAAGATCATCAGCAAT513
SAGGAAATGAGCTTGACAAAGTGG

2.3. Relative Quantification of Alternative Splicing Variants by Real-Time Quantitative PCR

Total RNA was extracted using the Qiagen RNeasy Kit (Hilden, Germany) according to the manufacturer's instructions. An SD2000 microspectrophotometer (Bioprince, Atlanta, GA, USA) was used to determine RNA concentrations. The cDNA was constructed from 2.5 μg of total RNA using MMLV Reverse Transcriptase (GeneAll, Seoul, Korea) and an Oligo(dT) primer (Invitrogen Corp.) at 50°C for 1 h. The cDNA was amplified by PCR, and the PCR products were stained with Loading Star solution (Dynebio, Seongnam, Korea) and separated on 1.5% agarose gels. RT-qPCR was conducted using the iQ5 multicolor RT-PCR detection system (Bio-Rad, Hercules, CA, USA) with the iQ SYBR Green Supermix (Bio-Rad). DNA amplification was performed using the primer sequences listed in Table 1, which were designed to specifically identify each of the alternative splicing variants. Relative quantification of TLR5 transcripts generated by alternative splicing was performed according to previously established methods [12]. Briefly, in order to determine the relative proportions of TLR5 transcripts, a “never-spliced” exon of TLR5 was used as an internal reference, instead of a classical housekeeping gene, with a portion common to the long and short TLR5 transcripts, that is, exon VII. The real proportions of TLR5 transcripts were determined according to the principle that the sum of both the long and the short TLR5 transcripts equals the level of expression of a “never-spliced” TLR5 exon. Therefore, the sum of the ratios of the long TLR5 transcripts to exon VII (denoted [long]) and the short TLR5 transcripts to exon VII expression ratio (denoted by [short]) must equal 1.0.

2.4. DNA Sequencing and Comparative Analysis

TLR5 PCR products were sequenced by Cosmo Genetech (Seoul, Korea) using the Applied Biosystems 3730 xl DNA Analyzer (Thermo Fisher Scientific Corp., Waltham, MA, USA). BioEdit version 7.2.5, created by Tom Hall (Ibis Biosciences, Carlsbad, CA, USA), was used to assemble the sequencing results. For the identification of amplified DNA fragments, DNA sequences were aligned against the National Center for Biotechnology Information (NCBI) database (NCBI reference sequence: NM_003268.5).

2.5. Statistical Analysis

Data were analyzed by one-way analysis of variance (ANOVA) followed by post hoc comparisons with either the Tukey HSD (honestly significant difference test) for groups of data with equal variances or, alternatively, the Games–Howell test for unequal variances using SPSS 12.0 for Windows. Values are expressed as means ± standard deviation (SD). Statistical significance was defined as p < 0.05.

3. Results

3.1. Identification of Human TLR5 Splicing Variants

The human TLR5 gene comprises 6 exons and the coding sequence is in exon VI [13]. In our RT-PCR experiment using primers complementary to exon I and exon VI of TLR5, we observed two main bands on the agarose gel. Unexpectedly, a longer product (about 680 bp) was detected in addition to the product of the expected size (about 580 bp), suggesting an alternative splicing variant with an additional exon (Figure 1(b)). To confirm this, a new set of nested PCR primers was designed to amplify the region spanning exons IV through V (Figures 1(a) and 1(c), solid arrows) and two PCR products were detected (Figure 1(c)). A sequence analysis of these products revealed that the longer product contains an additional 94 bp between exon IV and exon V, and its sequences are exactly the same as sequences deposited in the NCBI database (NM_003268.5) (Figure 2). Therefore, our results indicate that human TLR5 has seven exons and a newly found exon lies between previously reported exons IV and V in the 5′ UTR.
Figure 2

Alignment of sequences of two TLR5 splicing variants with TLR5 sequence from NCBI. Two PCR product bands of the amplification from exon IV to exon VI were collected and sequenced with automated sequencing methods by Applied Biosystems 3730xl DNA Analyzer. These two sequences were then compared to the NCBI TLR5 sequence (NCBI reference sequence: NM_003268.5) by using BioEdit software version 7.2.5. The detailed sequences are listed in Table 2.

3.2. Expression of Human TLR5 Splicing Variants in Different Cell Lines

To determine whether two main PCR products can be generated in other human cell lines, we performed an RT-PCR analysis of TLR5 expression in various human cell lines using the same PCR primers used in Figure 1(c). As shown in Figure 3, long TLR5 transcripts were observed in all eleven cell types examined. Short TLR5 transcripts were clearly detected in immune cells, such as THP-1, E6.1, U937, and Ramos cells, but were weakly detected in nonimmune cells, such as HaCaT, MSC, T98G, H460, HEK-293, and Caco-2 cells.
Figure 3

Expression of TLR5 splicing variants in different cell lines. Eleven cell lines were cultured at specific conditions. Cells were collected and 2.5 μg mRNA was used for RT-PCR; 3 μl of each cDNA was used for PCR with alternative splicing detecting primer (35 cycles, 60°C annealing temperature). GAPDH was used as control.

We determined the precise ratio of long TLR5 transcripts to short TLR5 transcripts (long/short TLR5 transcripts) in each cell line by RT-qPCR, as described in the Materials and Methods. The ratios of long TLR5 transcripts to short TLR5 transcripts in human immune cells, such as THP-1, U937, E6.1, and Ramos cells, were around 0.9, and those in nonimmune cells were 1.25 to 4.31 (Figure 4, Table 3).
Table 3

Relative quantities of TLR5f to TLR5sh isoform in various human cell lines.

Cell lines
THP-1E6.1U937RamosA549HaCaTT98GMSCH460HEK293Caco-2
 [short]Q0.500.480.310.250.460.170.230.390.420.290.41
α 1.2
[short]0.60.510.320.260.560.200.280.470.500.350.49

 [long]Q0.490.480.290.230.640.800.500.670.610.440.89
β 1.07
[long]0.540.560.340.270.700.870.550.720.670.480.97

Sum1.141.070.660.531.261.070.831.191.170.831.46

Ratio
Long/short 0.94 0.95 0.92 0.98 1.25 4.31 1.94 1.57 1.43 1.38 1.98

[short]Q and [long]Q are the proportions of each transcript over exon VI, calculated by the 2−ΔCT formula. [short] and [long] are the “real” expression proportions. α and β are the calculated correction factors. The ratios presented here, being expressed over exon IV+, show the ratio of short or long alternative variants. The expression level of short TLR5 transcripts was arbitrarily set to 1.

3.3. Regulation of Human TLR5 Alternative Splicing by IFN-γ

Since IFN-γ is an important activator of macrophages and downregulates TLR5 expression [14], we investigated whether IFN-γ influences TLR5 alternative splicing. THP-1 cells were stimulated with 10 ng/ml IFN-γ for 0–24 h and collected for RT-QPCR analysis. The ratio of long/short TLR5 transcripts began to decline at 3 h, reached 60% of normal ratio at 6 h, and then returned to normal at 24 h after IFN-γ treatment (Figure 5(a)). The ratios of long/short TLR5 transcripts decreased by treatment with IFN-γ in a concentration-dependent manner and were reduced by approximately 50% compared to normal levels at a concentration of 50 ng/ml (Figure 5(b)).
Figure 5

The relative expression of long/short TLR5 transcripts of THP-1 cells upon stimulation with IFN-γ. Total RNA was extracted from cells and cDNA was obtained from 2.5 μg total RNA. Quantitative real-time PCR was performed and ΔCt calculation with an internal reference (“never-spliced” exon of TLR5 gene) was used to normalize data. (a) Cells were stimulated with 10 ng/ml IFN-γ for various time points. (b) Cells were stimulated for 6 hours with various concentrations of IFN-γ. Bar graphs show relative gene expression ± SD. p < 0.05, p < 0.01, n = 3.

4. Discussion

In this study, we found a new splicing variant of human TLR5 with an extra exon; it included 94 nucleotides and was located between previously reported exons IV and V in the 5′ UTR. Since genetic variants of TLR5 have been clinically associated with disease outcomes such as obesity, type 2 diabetes, and colorectal cancer [15], it is important to determine the functional role of alternative splicing variants of TLR5. Based on the sequences in the NCBI database, human TLRs have a small number of exons (2–6 exons). The coding regions of TLR3 and TLR4 consist of more than two exons, while those of other TLRs consist of only the last exon (TLR1, TLR2, TLR5, TLR6, and TLR10) or the last exon plus a small portion of the second last exon (TLR7, TLR8, and TLR9). Therefore, TLR5 is not expected to produce variable proteins, while TLR3 and TLR4 are predicted to express a variable protein. In fact, human TLR4 has four reported splicing variants with different extracellular leucine-rich repeat lengths, but their functional significance has not been evaluated [5]. Although the functional significance of alternative splicing at the 5′ UTR of TLR genes remains to be elucidated, it is a common feature of mouse and human TLR genes [5], suggesting that alternative splicing of TLR genes plays an important role in the precise control of immune activation [16]. Since alternative splicing of the 5′ UTR influences mRNA stability and translation and thus alters the amount of protein translated [17, 18], differential expression levels of alternative splicing variants of TLR5 in various cell types, especially between immune and nonimmune cells, observed in our study may reflect intrinsic differences of TLR5 protein expression and function between cell types. The preferential expression of long TLR5 transcripts in nonimmune cells compared to immune cells suggests that the long TLR5 transcripts are selectively induced in nonimmune cells and may function differentially from the short TLR5 transcripts. IFN-γ-induced reduction in the expression of the long TLR5 transcripts of human monocytes also suggests a different function from that of the short TLR5 transcripts in activated macrophages. In summary, we identified a new splicing variant of human TLR5. The expression patterns of the splicing variants were different in distinct cell types. Based on our finding that long TLR5 transcripts were predominantly expressed in nonimmune cells and were significantly reduced by treatment with the proinflammatory cytokine IFN-γ, we cautiously speculate that the newly detected long TLR5 transcripts may be involved in the negative regulation of the expression and function of TLR5. To confirm this, further studies of the protein expression patterns in different cell types and functional analyses of splicing variants using HEK-293 cells transfected with cloned splicing variants are required.
Table 2

TLR5 splicing variant sequences.

Sequence (5′ → 3′)
Upper band TTGACTTCCGTTCTCTCATCTGCTCCAGCCCCCTGACCTTATAGTTGCCCAGCTTTCCTGGCAATTGACTTTGCCCATCAATACACAGGATTTAGCATCCAGGGAAGATGTCGGAGCCTCAGATGTTAATTTTCTAATTGAGAATGTTGGCGCTGTCCGAACCTGGAGACAGAGTATCAGCGCCTTTGCTTGCTGCTGTTTTTGCTGTTTTTTGATGCTGGGAACCACCACCTAAAGATAGTAAAGAAAACACAGGAAGCTTTCCGGAAAACAAAAAGTCCTTTCTCCTGATTCACCAAAAAATAAAATACTGACTACCATCACTGTGATGAGATTCCTATAGTCTCAGGAACTGAAGTCTTTAAACAACCAGGGACCCTCTGCCCCTTAGAATAAGA

Lower band TGACTTCCCTATCTCATCTGCTCCAGCCCCCTGACCTTATAGTTGCCCAGCTTTCCTGGCAATTGACTTTGCCCATCAATACACAGGATTTAGCATCCAGGGAAGATGTCGGAGCCTCAGATGTTAATTTTCTAATTGAGAATGTTGGCGCTGTCCGAACCTGGAGACAGGAAAACAAAAAGTCCTTTCTCCTGATTCACCAAAAAATAAAATACTGACTACCATCACTGTGATGAGATTCCTATAGTCTCAGGAACTGAAGTCTTTAAACAACCAGGGAACCTCCGCCCCTAGAATATAGGAA
  18 in total

1.  Three novel mammalian toll-like receptors: gene structure, expression, and evolution.

Authors:  X Du; A Poltorak; Y Wei; B Beutler
Journal:  Eur Cytokine Netw       Date:  2000-09       Impact factor: 2.737

2.  Alternative splicing of transcripts encoding Toll-like plant resistance proteins - what's the functional relevance to innate immunity?

Authors:  Tina Jordan; Sebastian Schornack; Thomas Lahaye
Journal:  Trends Plant Sci       Date:  2002-09       Impact factor: 18.313

Review 3.  TLR signaling.

Authors:  Taro Kawai; Shizuo Akira
Journal:  Semin Immunol       Date:  2007-02-01       Impact factor: 11.130

4.  Differences in the translation efficiency and mRNA stability mediated by 5'-UTR splice variants of human SP-A1 and SP-A2 genes.

Authors:  Guirong Wang; Xiaoxuan Guo; Joanna Floros
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2005-05-13       Impact factor: 5.464

5.  A novel splice variant of interleukin-1 receptor (IL-1R)-associated kinase 1 plays a negative regulatory role in Toll/IL-1R-induced inflammatory signaling.

Authors:  Navin Rao; Steven Nguyen; Karen Ngo; Wai-Ping Fung-Leung
Journal:  Mol Cell Biol       Date:  2005-08       Impact factor: 4.272

6.  Transcriptional regulation of the human toll-like receptor 2 gene in monocytes and macrophages.

Authors:  Viola Haehnel; Lucia Schwarzfischer; Matthew J Fenton; Michael Rehli
Journal:  J Immunol       Date:  2002-06-01       Impact factor: 5.422

7.  Genetic variants of toll-like receptor 2 and 5, helicobacter pylori infection, and risk of gastric cancer and its precursors in a chinese population.

Authors:  Hong-Mei Zeng; Kai-Feng Pan; Yang Zhang; Lian Zhang; Jun-Ling Ma; Tong Zhou; Hui-Juan Su; Wen-Qing Li; Ji-You Li; Markus Gerhard; Meinhard Classen; Wei-Cheng You
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2011-10-12       Impact factor: 4.254

8.  Soluble forms of Toll-like receptor (TLR)2 capable of modulating TLR2 signaling are present in human plasma and breast milk.

Authors:  Emmanuel LeBouder; Julia E Rey-Nores; Neil K Rushmere; Martin Grigorov; Stephen D Lawn; Michael Affolter; George E Griffin; Pascual Ferrara; Eduardo J Schiffrin; B Paul Morgan; Mario O Labéta
Journal:  J Immunol       Date:  2003-12-15       Impact factor: 5.422

Review 9.  Linking genetic variation in human Toll-like receptor 5 genes to the gut microbiome's potential to cause inflammation.

Authors:  Cynthia A Leifer; Cameron McConkey; Sha Li; Benoit Chassaing; Andrew T Gewirtz; Ruth E Ley
Journal:  Immunol Lett       Date:  2014-10-02       Impact factor: 3.685

10.  Alternate transcription of the Toll-like receptor signaling cascade.

Authors:  Christine A Wells; Alistair M Chalk; Alistair Forrest; Darrin Taylor; Nic Waddell; Kate Schroder; S Roy Himes; Geoffrey Faulkner; Sandra Lo; Takeya Kasukawa; Hideya Kawaji; Chikatoshi Kai; Jun Kawai; Shintaro Katayama; Piero Carninci; Yoshihide Hayashizaki; David A Hume; Sean M Grimmond
Journal:  Genome Biol       Date:  2006-02-17       Impact factor: 13.583

View more
  2 in total

1.  Exploring the Papillomaviral Proteome to Identify Potential Candidates for a Chimeric Vaccine against Cervix Papilloma Using Immunomics and Computational Structural Vaccinology.

Authors:  Satyavani Kaliamurthi; Gurudeeban Selvaraj; Sathishkumar Chinnasamy; Qiankun Wang; Asma Sindhoo Nangraj; William Cs Cho; Keren Gu; Dong-Qing Wei
Journal:  Viruses       Date:  2019-01-15       Impact factor: 5.048

2.  Alternative splicing of ceramide synthase 2 alters levels of specific ceramides and modulates cancer cell proliferation and migration in Luminal B breast cancer subtype.

Authors:  Trishna Pani; Kajal Rajput; Animesh Kar; Harsh Sharma; Rituparna Basak; Nihal Medatwal; Sandhini Saha; Gagan Dev; Sharwan Kumar; Siddhi Gupta; Arnab Mukhopadhyay; Dipankar Malakar; Tushar Kanti Maiti; Aneeshkumar G Arimbasseri; S V S Deo; Ravi Datta Sharma; Avinash Bajaj; Ujjaini Dasgupta
Journal:  Cell Death Dis       Date:  2021-02-10       Impact factor: 8.469

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.