Literature DB >> 28944857

A novel FBN1 mutation causes autosomal dominant Marfan syndrome.

Ying Xiao1, Xiaoqi Liu2, Xiaoxin Guo2, Liping Liu1, Linxin Jiang2, Qi Wang1, Bo Gong2.   

Abstract

Marfan syndrome (MFS) is an inherited and systemic disorder. It has been reported that mutations in the fibrillin‑1 gene (FBN1) account for ~90% of autosomal dominant cases of MFS. This study was conducted to screen mutations of FBN1 in a Chinese family with autosomal dominant MFS; four individuals including two patients with MFS were recruited. The family members underwent complete physical, cardiovascular and ophthalmologic examinations. Genomic DNA samples were collected from the family along with 383 unrelated healthy subjects. FBN1 coding regions were amplified by polymerase chain reaction and analyzed by direct sequencing. SIFT and PolyPhen‑2 were used to predict the possible structural and functional alterations of the protein. A novel heterozygous mutation c.1708 T>G (p.C570G) in exon 14 was identified, which led to a substitution of cysteine by glycine at codon 570 (p.C570G). The mutation was identified as being associated with the MFS phenotype in the affected members of this family. However, the unaffected family members and the 383 normal controls lacked the mutation. Multiple sequence alignment of the human FBN1 protein revealed that this novel mutation occurred within a highly conserved region of the FBN1 protein across different species and may induce structural alterations in this functional domain. The spectrum of MFS‑associated mutations in the FBN1 gene has been enriched from this study; this may improve understanding of the molecular pathogenesis and clinical diagnosis of MFS.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28944857      PMCID: PMC5865861          DOI: 10.3892/mmr.2017.7544

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Marfan syndrome (MFS) is an autosomal dominant hereditary disease comprising a disorder of fibrous connective tissue involving the ocular, skeletal and cardiovascular systems (1). According to the Ghent criteria, patients with malfunctions of at least two organ systems could be diagnosed with MFS (2). Aortic root dilatation/dissection and lens dislocation were two cardinal manifestations to establish an unequivocal diagnosis of MFS in patients with positive family history. Due to the large clinical variability of MFS, and several other connective tissue disorders with comparable clinical features, distinguishing MFS from those similar syndromes is still challenging. Increasing evidence indicates that heredity holds a key role in the development of MFS. It has been reported that MFS generally results from mutations in the human fibrillin-1 (FBN1) gene (3,4). At present, >3,000 mutations have been identified in relation to MFS. Most mutations are specific to a family with MFS, whereas ~10% of FBN1 mutations are shared by different families (5). Located at chromosome 15q-21.1 with 65 exons, the FBN1 gene encodes a secreted 350 kDa glycoprotein (6). Human FBN1 protein shares conserved sequences with other species. FBN1 protein constitutes extracellular microfibrils and controls the stability, as well as the microfibril assembly. Mutations within the FBN1 gene may disrupt microfibril formation, leading to abnormalities of fibrillin and eventually weakening the connective tissue (7). In the present study, the entire coding region of FBN1 was analyzed, and a novel mutation in exon 14 of FBN1 was identified in all affected members. The newly identified FBN1 mutation in a Chinese family with MFS further emphasizes the important role of FBN1 in the mechanism of MFS development. The present study not only expanded the mutation spectrum of FBN1 resulting in MFS development in a Chinese family, but is also likely to aid understanding of the molecular pathogenesis and clinical diagnosis of FBN1-associated MFS.

Materials and methods

Subjects

A family with MFS was recruited from the Shandong Provincial Hospital Affiliated to Shandong University (Jinan, China) (Fig. 1). This study was conducted in accordance to the tenets of The Declaration of Helsinki and was approved by the Institutional Review Boards of the Hospital of University of Electronic Science and Technology of China and Sichuan Provincial People's Hospital (Chengdu, China), and the Shandong Provincial Hospital Affiliated to Shandong University. A total of 383 ethnically matched, unrelated and normal healthy individuals were recruited from the Hospital of University of Electronic Science and Technology of China & Sichuan Provincial People's Hospital (255 males and 128 females; mean age at recruitment 55.26±8.78 years). These control individuals had no medical history associated with any related diseases. Written informed consent was obtained from all participants prior to the study.
Figure 1.

Pedigree of the family with Marfan syndrome. Solid symbols indicate affected patients, open symbols indicate unaffected subjects and arrow indicates the proband in this family. Squares represent males and circles represent females.

Clinical diagnosis

Two of the family members were diagnosed with MFS according to the revised Ghent criteria (2). Non-consanguineous marriages were found in the family; clinical information of the affected family members is summarized in Table I. All members of this family underwent complete physical, cardiovascular and ophthalmologic examinations. Unrelated healthy individuals also underwent the same examinations.
Table I.

Clinical details of the patients with Marfan syndrome in the family.

CharacteristicProband (I:1)Proband's daughter (II:2)
Age (years)448
GenderMF
Ectopialentis++
Myopia++
Strabismus+, exotropia+, exotropia
Glaucoma
Retinal detachment+
Height (cm)184134
Arm span (cm)186137
AS/H1.011.02
Overgrowth of the long bones++
Arachnodactyly++
Scoliosis
Pectus excavatum
Pectus carinatum+
Flatfeet++
Mitral valve prolapse
Aortic aneurysm+ (ruptured 5 years ago then formed aortic dissection; Bentall surgery was performed at that time)
Aortic root dimension (mm)25.0 (artificial vessel diameter)29.1

M, male; F, female; AS, arm span; H, Height.

Mutation screening

Genomic DNA samples were extracted from peripheral blood using a Blood DNA extraction kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The whole coding region of FBN1 (NM_000138.4) was amplified by polymerase chain reaction (PCR) with 35 cycles (30 sec at 95°C for initial denaturation, 30 sec for annealing at different temperatures as shown in Table II, and 30 sec at 72°C for extension), using a GeneAmp® PCR system 9700 (Applied Biosystems; Thermo Scientific Inc.). Sequencing primers of all the exons were designed using Primer 5.0 (Premier Biosoft International, Palo Alto, CA, USA; Table II). Amplified PCR products were purified and sequenced directly (BigDye Terminators Sequencing kit) with an Automated Genetic Analysis system 3130 (both from Applied Biosystems; Thermo Fisher Scientific, Inc.). Comparative amino acid sequence analysis of the human FBN1 protein was performed across different species using HomoloGene (https://www.ncbi.nlm.nih.gov/homologene/?term=FBN1). The potentially damaging effects of the mutation on the structure and function of FBN1 was predicted using SIFT (http://sift.jcvi.org) and PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/).
Table II.

Primers used for mutation screening of the FBN1 gene.

Primer namePrimer sequence (5′-3′)Product size (bp)Annealing temperature (°C)
FBN11&2FTCGGGGATTTGTCTCTGTGT434  59
FBN11&2RGCCCGTTGTTCTGGATCTTG
FBN13FACCAACCCAGCATTGAGTCT308  60
FBN13RTTCTAAGGCTCCCCATGCAA
FBN14FTTGTGAGGGACCTGAGAACC296  59
FBN14RTTGCAGGAAAGAGGAAAGCC
FBN15FCAACTCCTGTGAGCTGTTGC278  60
FBN15RAAACATGCTGTGTCCCAGGT
FBN16FGTCCTTCCAGAGGACCACAA228  60
FBN16RCAGCTTTAGGTACCAGCATGTC
FBN17FGCATGATGGTTCCTGCTTTT380  60
FBN17RGCAGTCAGCGAAATTGTGAA
FBN18FTTCCAAATATTGTGATGGACAAA448  60
FBN18RACAGGGTTTTTCTGGTCCAA
FBN19FGCTGTTTCCAGGGACATGAT441  60
FBN19RTTTATGGGAGGCAAAACGTC
FBN110FAGCCCCAGTGTGAAGTATGG396  60
FBN110RTTCCCTGGACGTCATCTCTT
FBN111FTGACTTCTGTGGGCCTATGA300  59
FBN111RTTAACTTGAACAATGCAAGAAAAA
FBN112FTTGTCACCAGACGACCTTTG383  60
FBN112RCCACCAAGTTTGGGGTAAGTT
FBN113FAAAAGGAACCCAGAAAGTCTTAGAA295  60
FBN113RCTTCCGGCATGGGTTATTTA
FBN114FGGAGGGAGGGGGAAATAAA244  60
FBN114RACTGCAATGGAAGGAGAGGA
FBN115FGATCTTATTTGGATGAAAGTTAGCC400  59
FBN115RAGTCAGGTTTCCCAAACCAA
FBN116FTTCCCCATTTTCAAGGGTTA294  61
FBN116RCGTTTGTTACCATTGGGCTTT
FBN117FGGGGGTTCTCATCTGTTTGA242  60
FBN117RCAGTACGAGGGCATCTCCAT
FBN118FACCAAGGGCAGGATCTACCT188  60
FBN118RACCCACAAGAAAGCCTGATG
FBN119FCCTGTAGCTCCTAAGGTCATTACA300  60
FBN119RCTCCCAGCAATGAAAGAAGG
FBN120FCAAAGTTTGGGCCCTTTTTA226  59
FBN120RTGGCATTCCAAAAGATAGCA
FBN121FGGCCCAAGACTAGATTTTAGCA243  60
FBN121RTTTTGCAGGAAAAGCTGACA
FBN122FAATGTCAGCTTTTCCTGCAA368  59
FBN122RTGAAATACTAGGCTTCCCCTTT
FBN123FTGTCAGAACTGCAAAGTCTGG204  60
FBN123RGACAGCTTTATCCAGTCCGAGT
FBN124FTGCTATTCAGGCACCCTAGA400  59
FBN124RTGGAGTGTGTGTCTGTACCTGA
FBN125FAACAGAGTGTTGGCAGTTTGG373  60
FBN125RCTGAGATCATGAAAATGCATCC
FBN126&27FGACCTCCTGACTGCTTGCTC494  60
FBN126&27RCAAAGCTTCATGGAATCCTTCT
FBN128&29FGAGTGCTTGGTCTGGTGGAG564  61
FBN128&29RAGCGATGAAAACAAAACTCAGA
FBN130FGGGACAGACATCCAAACCAT249  62
FBN130RCAAAGCCTGGGCCCTAAAC
FBN131FCTCACTGAACAGTGGAACCAA280  59
FBN131RGCTCTCTTTGGAATGCTGGT280  59
FBN132FGAATCTTTCTATCACTGACCCAAAC
FBN132RTCGAGGGGAAAGTACTCAATG325  59
FBN133&34FCATTTGTGCTGAGCCTTTTTC495  60
FBN133&34RGAATGCCTGGCTTCTCTGAC
FBN135FTGCTGCACTGGAAAGTTGAT231  60
FBN135RAGTGGCTTCCCCATCAGTTA
FBN136FTGCCCAGATTGGTGTTAGAT400  59
FBN136RCAGGTCTGAGAAAAGGTATCTGTG
FBN137&38FAGATTGGGCCCTGTTCTTTT819  60
FBN137&38RTTGGGAATAAGGTCCCCTCT
FBN139&40FTCAGACGGGCAGAGTAACAA496  59
FBN139&40RCCATATTCTGGTTTTGCAGGT
FBN141FAGGCCATTCCAAAATGTGAA249  60
FBN141RTTGTGAGCTCTCTTCCTCTTTGT
FBN142FATTTCCCACATGGCATCAC300  60
FBN142RTGCTTCCTTCGCTAAGACTGA
FBN143FCTATCCTCCCATCCCACCTT273  60
FBN143RCAGGGTGTTTGCACAGTTTG
FBN144FCACAGGGATCATGTGCTGTC315  60
FBN144RTCCACACCATGCCCTTTACT
FBN145FGGCTTTGTTGACTGGACACC218  62
FBN145RGTAGGCATGTCCAGCCTGTG
FBN146FGAGCTAGGATTACTCCTGAGAATGA398  59
FBN146RTCATGTTCAGATTGCCAAAGA
FBN147FGGCCTGGTGAACCCTAAAAT247  60
FBN147RTTCCTTTGCTGATGCACAAT
FBN148FTGCTGGGATTATGACATCTTTG292  60
FBN148RTTTTCCTCCAGGTTTCCAGA
FBN149FCCAGTGGGAACCTCTTCCTT205  60
FBN149RGACACCCGACACTCCTCATT
FBN150FTGATGTCTCCATCGTGTTTTG208  61
FBN150RATTGAAAGCCCAAAGCCTTC
FBN151FGGAAAGCAACTGAAGGGTGT263590
FBN151RGCCTACAGTCTTACTTACATCATGG
FBN152&53FGGAGAAGCTTGTAATGAATTGCT594  60
FBN152&53RAACTTATTTCAGTGCCATCTTGG
FBN154FTTTGGACACATTCCTGGTTTC207  60
FBN154RCAACCAATTGTTCCCAGGAT
FBN155FCCTTTTGTTGCTGTCCATGAT249  60
FBN155RAGGGAAGCTTTGAGGGACAT
FBN156FTCATACTCAACAGAGCAGAAGGA363  59
FBN156RCAAGAACTCAGAGCCCAGGT
FBN157FAAGGAACAAAGGGAGGGAAG392  60
FBN157RCAGTCATTACGGCATCTCCA
FBN158FCTGACATCCCCTTTGCCATA277  61
FBN158RTCCCTGCAAGTATTTTTGGAC
FBN159&60FCACTGAAGTGACCCCCTACA600  60
FBN159&60RTGAGGGGCAATGGTCAAT
FBN161&62FTGTTGGCTTGACTCAAATGC600  61
FBN161&62RCCTCCACAAGGATTCACCAG
FBN163FTGGTGGCTCTGCTTCTTTTT178  60
FBN163RGCCATGCATCTTGAGAGTGA
FBN164FAAGTGGCCAGATCCAATGTC334  60
FBN164RACCATGACCAGGAAGAGCAC
FBN165FCATCTATGCTCCCCTTCTGC243  60
FBN165RTTCCACCACAGGAGACATCA
FBN166FGCAGCATAAGGCAGAAAATTG583  60
FBN166RTGATTCTGATTGGGGGAAAA

FBN1, fibrillin-1; F, forward; R, reverse; bp, base pair.

Results

Clinical findings

The parents and two daughters of a family from Shandong, China, were included in the present study (Fig. 1). Other relatives of this family were not willing to be tested and so additional clinical details were unattainable. Two affected patients (I:1 and II:2) exhibited similar clinical symptoms, including ectopialentis, myopia and strabismus (Fig. 2 and Table I). The left eye of the proband (I:1) underwent refractive lensectomy and vitrectomy combined with silicone oil tamponade after retinal detachment 2 years prior to the current study; following retinal re-attachment, silicone oil was removed 3 months later. The two patients both had the same facial and skeletal features, including arachnodactyly, flat feet and dilation of the aortic root (Fig. 3 and Table I). The proband had pectus carinatum and aortic aneurysm. The patient received Bentall surgery and underwent aortic arch replacement 5 years prior to the current study, as their aortic aneurysm ruptured and formed aortic dissection (Fig. 4). The other two members of the family had no features of MFS.
Figure 2.

Slitlamp photograph of the proband (I:1) and his daughter (II:2) in the family with MFS. (A) Left eye of the proband had ectopialentis. (B) Lensectomy and vitrectomy combined with silicone oil tamponade was performed for the right eye of the proband following retinal reattachment and silicone oil removed 3 months later. (C and D) Ectopialentis of the proband's daughter (II:2). (C) Lens nasal deviation occurred in her left eye and (D) nasal-inferior dislocation in her right eye. OS, oculus sinister (left eye); OD, oculus dexter (right eye).

Figure 3.

Arachnodactyly of the proband (I:1) and the affected daughter (II:2). (A) Proband (left) and his daughter (right) had (B) long fingers and (B) flat feet.

Figure 4.

CTA of the aortic vessels of the proband. (A) CTA confirmed the formation of aortic dissection. (B) CTA image of the artificial vessel of the proband after Bentall surgery. CTA, computed tomography angiogram.

Mutation screening of FBN1

Direct sequencing of the whole coding region of FBN1 detected a novel missense mutation c.1708 T>G (p.C570G), situated at nucleotide 570 in exon 14 of the coding region (Fig. 5A). This heterozygous mutation was detected in the two affected patients (I:1 and II:2) but was not found in the unaffected mother and daughter (I:2 and II:1) of the family and in the 383 ethnically matched healthy subjects. Therefore, c.1708 T>G (p.C570G) cosegregated to the patients with MFS in this family. Multiple sequencing alignment of human FBN1 protein with various species revealed that the novel mutation occurred within a highly conserved region of the calcium binding epidermal growth factor-like (cbEGF) domain (Fig. 5C). This mutation is a T>G transition, converting cysteine to glycine at amino acid 570 (p.C570G). This amino acid substitution in the FBN1 protein was predicted to be damaging by SIFT and PolyPhen-2.
Figure 5.

Representative chromatogram of FBN1 sequence. (A) FBN1 has different functional regions and the p.C570G mutation occurs in the calcium binding EGF-like domain. (B) Normal sequence from an unaffected individual (I:2) (upper sequence), and a heterozygous T to G substitution at codon 570 from affected subjects (I:1 and II:2) (lower sequence). (C) Orthologous protein sequence alignment of FBN1 from different species, the mutated residue showing conservation of cysteine at codon 570 was shaded in red. EGF, epidermal growth factor; FBN1, fibrillin-1.

Discussion

It has been reported that MFS is mainly caused by mutations in the FBN1 gene, which was the first gene identified to cause MFS (8). Of all the identified mutations in the FBN1 gene, 38.6% result in a truncated FBN1 protein and 60.3% represent missense mutations across different ethnic groups (9). FBN1 mutations may cause abnormalities in the formation of microfibrils and fibrillin. As a result, connective tissues weaken (10). A novel FBN1 heterozygous missense mutation, c.1708 T>G (p.C570G) was identified within a Chinese family associated with MFS in the present study. FBN1 is an important component of microfibrils and is expressed in many human tissues, including in zonules, the cardiovascular system, cartilage, tendon and cornea. The protein serves a role in the formation of zonules and is secreted from ciliary bodies of non-pigmented cells (11). FBN1 protein is composed of repeated modules, including cbEGF and transforming growth factor-1 binding protein-like domains, and is responsible for maintaining microfibers in an ordered arrangement (12,13). The majority of identified missense mutations in FBN1 are localized in cbEGF (14). The mutated monomer of FBN1 could interfere with the polymerization of fibrillin and microfiber aggregation (15). FBN1 mutations within cbEGF modules may disrupt the stability of elastic fibers and render FBN1 susceptible to proteolysis. As a result, the transforming growth factor-β signaling activity that affects extracellular matrix formation may malfunction (4,16). In the present study, a novel c.1708 T>G (p.C570G) heterozygous missense mutation of the FBN1 gene was reported in a Chinese family with MFS. Three similar missense mutations: c.1709G>A (p.C570Y) (17), c.1709G>C (p.C570S) (18) and c.1709G>C (p.C570R) (19) have been reported in sporadic cases; however, clinical data in these studies were not obtained. In this pedigree, c.1708 T>G (p.C570G) in FBN1 was detected in the two patients with MFS (I:1 and II:2). The proband (I:1) initially came to Shandong Provincial Hospital to see an ophthalmologist and was found to suffer from ectopialentis, myopia and strabismus in both eyes. The proband and the affected daughter (II:2) had similar facial and skeletal features of MFS, including arachnodactyly, flat feet and dilation of aortic root. In addition, pectus carinatum, aortic dissection and retinal detachment were also detected in the proband. These findings suggested that the clinical manifestations of the patient with MFS became more evident with age. This mutation was not included in the Exome Aggregation Consortium dataset; c.1708 T>G (p.C570G) of FBN1 was not detected in the mother (I:2) and another daughter (II:1) of this family, or in the 383 unrelated normal controls during the mutation screening in the present study. This indicated that c.1708 T>G (p.C570G) of FBN1 cosegregated with affected MFS patients and may serve an important role in the pathogenesis of MFS development in this pedigree. The p.C570G mutation of FBN1 identified in this family with MFS resulted in a substitution of a highly conserved cysteine residue for glycine in a cbEGF domain of FBN1. This mutation is predicted to abolish one disulfide bond and thus affect the sixth conserved cysteine (C6) of the cbEGF domain; disulfide bonds are essential for the correct EGF-like domain structure. SIFT and PolyPhen-2 predictions indicated that this mutation is critical to protein function, supporting a possible pathogenic effect of this mutation. Evidence has revealed that most FBN1 mutations are clustered in exons 24–32, a hot spot region associated with classic and severe forms of MFS (17,20); mutations in exons 12–15 encoding cbEGF-like domains (C3-C6) cause a mild phenotype of MFS with possible late cardiovascular involvement (21). Evidence from the present study consistently indicated that the identified heterozygous mutation, c.1708T>G, is located at exon 14 and that this cysteine substitution detected in the proband resulted in pectus carinatum and aortic dissection. These two factors correlated with increasing age. However, evident symptoms were not detected in the young affected daughter (II:2), even though significant dilation of the aortic root was identified. Nevertheless, further functional analyses are required to confirm the role of FBN1 and its underlying mechanisms in MFS. In conclusion, a novel heterozygous mutation, c.1708 T>G (p.C570G), in the FBN1 gene was identified in a Chinese family associated with MFS. The results from the present study enrich the spectrum of MFS-associated mutations of FBN1 and may aid presymptomatic molecular diagnosis of undetermined cases of MFS.
  21 in total

Review 1.  Marfan's syndrome.

Authors:  Daniel P Judge; Harry C Dietz
Journal:  Lancet       Date:  2005-12-03       Impact factor: 79.321

2.  Marfan syndrome caused by a recurrent de novo missense mutation in the fibrillin gene.

Authors:  H C Dietz; G R Cutting; R E Pyeritz; C L Maslen; L Y Sakai; G M Corson; E G Puffenberger; A Hamosh; E J Nanthakumar; S M Curristin
Journal:  Nature       Date:  1991-07-25       Impact factor: 49.962

3.  Evaluating Japanese patients with the Marfan syndrome using high-throughput microarray-based mutational analysis of fibrillin-1 gene.

Authors:  Naomi Ogawa; Yasushi Imai; Yuji Takahashi; Kan Nawata; Kazuo Hara; Hiroshi Nishimura; Masayoshi Kato; Norifumi Takeda; Takahide Kohro; Hiroyuki Morita; Tsuyoshi Taketani; Tetsuro Morota; Tsutomu Yamazaki; Jun Goto; Shoji Tsuji; Shinichi Takamoto; Ryozo Nagai; Yasunobu Hirata
Journal:  Am J Cardiol       Date:  2011-09-10       Impact factor: 2.778

4.  Applying massive parallel sequencing to molecular diagnosis of Marfan and Loeys-Dietz syndromes.

Authors:  Machteld Baetens; Lut Van Laer; Kim De Leeneer; Jan Hellemans; Joachim De Schrijver; Hendrik Van De Voorde; Marjolijn Renard; Hal Dietz; Ronald V Lacro; Björn Menten; Wim Van Criekinge; Julie De Backer; Anne De Paepe; Bart Loeys; Paul J Coucke
Journal:  Hum Mutat       Date:  2011-07-20       Impact factor: 4.878

5.  Critical appraisal of the revised Ghent criteria for diagnosis of Marfan syndrome.

Authors:  T Radonic; P de Witte; M Groenink; R A C M de Bruin-Bon; J Timmermans; A J H Scholte; M P van den Berg; M J H Baars; J P van Tintelen; M Kempers; A H Zwinderman; B J M Mulder
Journal:  Clin Genet       Date:  2011-03-31       Impact factor: 4.438

6.  Cysteine substitutions in epidermal growth factor-like domains of fibrillin-1: distinct effects on biochemical and clinical phenotypes.

Authors:  I Schrijver; W Liu; T Brenn; H Furthmayr; U Francke
Journal:  Am J Hum Genet       Date:  1999-10       Impact factor: 11.025

7.  Classic, atypically severe and neonatal Marfan syndrome: twelve mutations and genotype-phenotype correlations in FBN1 exons 24-40.

Authors:  F Tiecke; S Katzke; P Booms; P N Robinson; L Neumann; M Godfrey; K R Mathews; M Scheuner; G K Hinkel; R E Brenner; H H Hövels-Gürich; C Hagemeier; J Fuchs; F Skovby; T Rosenberg
Journal:  Eur J Hum Genet       Date:  2001-01       Impact factor: 4.246

8.  Four novel FBN1 mutations: significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome.

Authors:  H C Dietz; I McIntosh; L Y Sakai; G M Corson; S C Chalberg; R E Pyeritz; C A Francomano
Journal:  Genomics       Date:  1993-08       Impact factor: 5.736

9.  Effect of mutation type and location on clinical outcome in 1,013 probands with Marfan syndrome or related phenotypes and FBN1 mutations: an international study.

Authors:  L Faivre; G Collod-Beroud; B L Loeys; A Child; C Binquet; E Gautier; B Callewaert; E Arbustini; K Mayer; M Arslan-Kirchner; A Kiotsekoglou; P Comeglio; N Marziliano; H C Dietz; D Halliday; C Beroud; C Bonithon-Kopp; M Claustres; C Muti; H Plauchu; P N Robinson; L C Adès; A Biggin; B Benetts; M Brett; K J Holman; J De Backer; P Coucke; U Francke; A De Paepe; G Jondeau; C Boileau
Journal:  Am J Hum Genet       Date:  2007-07-25       Impact factor: 11.025

10.  Is ectopia lentis in some cases a mild phenotypic expression of Marfan syndrome? Need for a long-term follow-up.

Authors:  Guglielmina Pepe; Ilaria Lapini; Lucia Evangelisti; Monica Attanasio; Betti Giusti; Laura Lucarini; Rossella Fattori; Giannantonio Pellicanò; Mario Scrivanti; Maria Cristina Porciani; Rosanna Abbate; Gian Franco Gensini
Journal:  Mol Vis       Date:  2007-11-29       Impact factor: 2.367

View more
  4 in total

1.  Mutation screening in the FBN1 gene responsible for Marfan syndrome and related disorder in Chinese families.

Authors:  Bo Gong; Lan Yang; Qingwei Wang; Zimeng Ye; Xiaoxin Guo; Chen Yang; Fang Hao; Yi Shi; Yi Huang; Chao Qu; Zhenglin Yang
Journal:  Mol Genet Genomic Med       Date:  2019-03-05       Impact factor: 2.183

2.  Treatment With Methotrexate Associated With Lipid Core Nanoparticles Prevents Aortic Dilation in a Murine Model of Marfan Syndrome.

Authors:  Maria Carolina Guido; Natalia de Menezes Lopes; Camila Inagaki Albuquerque; Elaine Rufo Tavares; Leonardo Jensen; Priscila de Oliveira Carvalho; Thauany Martins Tavoni; Ricardo Ribeiro Dias; Lygia da Veiga Pereira; Francisco Rafael Martins Laurindo; Raul Cavalcante Maranhão
Journal:  Front Cardiovasc Med       Date:  2022-06-10

3.  Two Novel Pathogenic FBN1 Variations and Their Phenotypic Relationship of Marfan Syndrome.

Authors:  Sinem Yalcintepe; Selma Demir; Emine Ikbal Atli; Murat Deveci; Engin Atli; Hakan Gurkan
Journal:  Glob Med Genet       Date:  2020-08-20

4.  Exome Sequencing Identifies a Novel FBN1 Variant in a Pakistani Family with Marfan Syndrome That Includes Left Ventricle Diastolic Dysfunction.

Authors:  Nadia Farooqi; Louise A Metherell; Isabelle Schrauwen; Anushree Acharya; Qayum Khan; Liz M Nouel Saied; Yasir Ali; Hamed A El-Serehy; Fazal Jalil; Suzanne M Leal
Journal:  Genes (Basel)       Date:  2021-11-28       Impact factor: 4.096

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.