Literature DB >> 28944838

Effect of antioxidant of bamboo leaves on gene expression associated with mouse embryonic fibroblast reproduction and embryonic development.

Feng Yu1, Xiaowei Qian1, Zhanghui Zeng1, Xiaoli Zhao1, Rong Hou2, Zhihe Zhang2, Hongwu Bian1, Ning Han1, Junhui Wang1, Muyuan Zhu1.   

Abstract

Antioxidant of bamboo leaves (AOB) was certified to be a natural antioxidant by the Chinese Ministry of Health in 2003. However, the effects of AOB on animal reproductive and developmental functions remain unclear. The present study aimed to investigate the effects of different concentrations of AOB on mouse embryonic fibroblast (MEF) cells, and to examine the underlying molecular mechanism through which AOB affects the proliferation and apoptosis of MEFs. MEFs prepared from individual embryos were treated with various dosages of AOB. Cell viability and apoptosis were detected by MTT and flow cytometry assays, respectively. Reverse transcription‑quantitative polymerase chain reaction and western blot analyses were used for the detection of mRNA and protein expression. Functional annotation of differentially‑expressed genes was performed according to the Gene Ontology database and Kyoto Encyclopedia of Genes and Genomes pathway analysis. Compared with the control group, ~50% of MEF cells were inhibited following treatment with a 400 µg/ml concentration of AOB. Treatment with 400 µg/ml AOB for 72 h significantly increased the apoptotic rate of MEF cells compared with the control group. Following treatment with AOB, dehydrogenase/reductase 9, phospholipase A2 group IVE and platelet derived growth factor B were downregulated, while 17 other genes were upregulated in MEF cells. Treatment with AOB markedly increased the expression of phosphorylated extracellular signal‑regulated kinase (ERK), β‑catenin, transcription factor SOX‑17, calcium‑binding tyrosine phosphorylation‑regulated protein, and cholesterol side chain cleavage enzyme mitochondrial (P<0.01). Additionally, the ERK pathway inhibitor U0126 and Wnt pathway inhibitor dickkopf‑related protein 1 markedly suppressed the expression of the above genes (P<0.01). AOB may impact the expression of proteins associated with embryonic fibroblast reproduction and embryonic development through activation of the ERK and Wnt signaling pathways, thus influencing cellular processes.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28944838      PMCID: PMC5865880          DOI: 10.3892/mmr.2017.7505

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Antioxidant of bamboo leaves (AOB) was approved as a natural food additive by the Chinese Ministry of Health in 2007. AOB may be used as a food antioxidant, preservative or flavoring in numerous types of foods. AOB has several types of bioactive components including flavonoids, lactones, and phenolic acids, however, it predominantly consists of four representative flavonoids (orientin, isoorientin, vitexin, and isovitexin). AOB is obtained from bamboo leaves and has been a focus of research due to its antioxidative activity (1). However, the dose-dependent toxicity of AOB and its impact on animal reproductive and developmental function remain unclear (2). The working principle of the genechip technique is based on hybridization between target DNA/RNA extracted from cell lines or tissues and complementary short DNA-nucleotide oligomers grafted to the solid surface of the chip (3,4). Genechip has been widely used in functional genomics and investigation of pathogenic mechanisms. Mouse embryonic fibroblasts (MEF) are a type of undifferentiated cell that have the potential for infinite proliferation and totipotential differentiation (5,6). MEFs have been successfully applied in a variety of biological mechanism and toxicological studies (7,8). However, the effects of AOB on the reproductive toxicity of MEFs have not been reported. In the present study, MEF cells were used to detect the impact of different concentrations of AOB on MEF proliferation. Additionally, the gene expression of MEF cells was analyzed to explore the molecular mechanism through which AOB may affect the proliferation and apoptosis of MEFs. The present study aimed to investigate the impact of AOB on the expression of reproduction-associated proteins. These findings may provide a broader understanding of the role of AOB in the activation of the ERK and Wnt signaling pathways.

Materials and methods

Preparation of MEFs

A total of 8 pregnant ICR mice (6 weeks old; weight, 26±5 g) were purchased from Zhejiang Academy of Medical Sciences (MIS20034; Zhejiang, China). All mice had free access to water and food and were maintained at 24°C in a humidity-controlled room with a 12–12 h light-dark cycle. Mice were sacrificed at day 13.5 of gestation by cervical dislocation. The body was placed into aseptic conditions following disinfection by immersion for 3–5 min in 75% ethanol. The uterine horns were dissected, briefly rinsed in PBS 3–5 times, and each embryo was separated from its placenta and embryonic sac. The uterus was cut open along the uterine membrane to remove the embryo that was covered by the membrane envelope, the embryos were washed with PBS and placed into a clean Petri dish. The tissue was finely minced using a sterile razor blade in order to facilitate pipetting. A total of 1 ml 0.05% trypsin/0.02% EDTA was added and cells were dissociated by pipetting up and down thoroughly and incubated for 5–10 min at 37°C. The supernatant was aspirated and the cells were centrifuged at low-speed (300 × g) at 4°C for 5 min; the supernatant was subsequently removed and the cell pellet resuspended in PBS. Cells were counted, plated in MEF medium (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at a density of 35,000 cells/cm2 in 6-well plates and incubated at 37°C with 5% CO2 for 24 h. The medium was replaced with fresh MEF medium and the cells were cultured at 37°C with 5% CO2. Cells were continuously passaged or frozen for future usage when they had reached 90–95% confluence. The protocol of the present study was approved by the Ethics Committee of Zhejiang University (Hangzhou, China; approval no. ZU20150324).

Cell viability (MTT) assay

AOB was provided as a kind gift from Professor Ying Zhang (Zhejiang University). Cells were seeded at 1×105 cells/ml in a 24-well plate with final AOB concentrations of 0, 100, 200, 300, 400, 500 to 800 µg/ml, and cultured at 37°C with 5% CO2 for 72 h. Following incubation, the medium was removed and supplemented with MTT reagent (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Following incubation at 37°C for 4 h, the medium was removed and 100 µl DMSO was added to each well and agitated for 15 min at 37°C. The cell viability percentage was assessed via spectrophotometry at 570 nm using an ELx800 Absorbance Reader (BioTek Instruments, Inc., Winooski, VA, USA). Based on the results of this experiment, a concentration of 400 µg/ml AOB was used for all subsequent experiments.

Flow cytometric analysis for apoptosis quantification

Flow cytometric analysis was used to detect the apoptotic rate of cells processed with a fluorescein isothiocyanate (FITC) Apoptosis Detection kit (BD Biosciences, San Jose, CA, USA). A total of 1×106 cells were harvested and washed twice with cold PBS. Cells were subsequently washed and incubated in buffer containing 5 µl FITC-Annexin V and 5 µl propidium iodide. Apoptosis quantification was performed using an Annexin V-FITC cellular apoptosis assay reagent kit (BD Biosciences), according to the manufacturer's protocol. Cells were subsequently collected using a FACSCalibur flow cytometer and analyzed using CellQuest Software (version 3.3, BD Biosciences).

Microarray gene expression and data analysis

The RNA samples from each group were sent to Genergy Biotechnology Co., Ltd. (Shanghai, China) for Illumina MouseWG-6 v2.0 Expression BeadChip microarray analysis (Illumina, Inc., San Diego, CA, USA). The quantile measure was used to normalize the different arrays and identify differentially-expressed genes. A fold change ≥|2| and P<0.05 was considered to indicate significant differential expression of genes.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Total RNA (1 µg) was reverse-transcribed to cDNA using an AccuPower RT PreMix kit (Bioneer Corporation, Daejeon, Korea), with incubations performed at 37°C for 15 min followed by 85°C for 10 sec. Gene specific primers for the 20 mRNAs and β-actin are summarized in Table I, β-actin served as an internal control for gene expression normalization. PCR amplifications were performed using Takara master mix (Takara Biotechnology Co., Ltd., Dalian, China). For each PCR, 1 µl template cDNA, equivalent to ~100 ng total RNA, was mixed with 12.5 µl 2X SYBR-Green PCR Master mix and 0.4 µM each of the forward and reverse primers in a final volume of 20 µl under the following conditions: Initial enzyme activation at 95°C for 10 min, amplification for 40 cycles (95°C for 30 sec and 60°C for 60 sec), followed by a dissociation curve analysis. The relative RNA level was calculated using the 2ΔΔCq method (9).
Table I.

Primer sequences for reverse transcription-quantitative polymerase chain reaction analysis.

GenePrimer sequence 5′-3′TmLength (bp)
β-actinF: GTGACGTTGACATCCGTAAAGA60.3245
R: GCCGGACTCATCGTACTCC61.6
CabyrF: AGAGGATCACCTTGGGGTACA61.798
R: CGAAGCGACAGATGGTGGTC62.9
Pcsk4F: TTGCTGGGTCTTACAAGCTACT60.4106
R: ACTGGTGAATAGAACAGGGCT60.1
Myl2F: CCCTGAAGTCGAGGAGCTG60.9114
R: CTGCTGCACCTCTAAGCGA61.7
Kng2F: GAAGCGTCTCACTCCCGAAG62.393
R: GAAGAAAACGTCGCGCTACT60.7
CpzF: AGAGGATCACCTTGGGGTACA61.798
R: CGAAGCGACAGATGGTGGTC62.9
B230120H23RikF: CAAACCTCAATGTGTCTCTTTGC60.297
R: AGAGTAAAGCCTATCTCGCTGT60.4
Pla2g4bF: CTTCCCTCATCCTCCTGCTAC61.1145
R: ACAAACTGGGTAAAGGTGATGG60.2
Rap1aF: CCAAAGCGGAGTCTCGCAT62.4125
R: GCCTAGCATCTTGCTTAGCTC60.6
Dhrs9F: TTGCTCCGGTAACAGCAGTG62.4105
R: GTGGTCGCTTGTGTAGAAGGA61.7
PdgfbF: ATGCTGGGAAAGTCATGGAAG60.0201
R: CGTGTTCTGGTCACGAGAGA61.2
Mapk12F: ACCTGCACCCGATTCACAG62.0112
R: TGGCAGCATACTCCTGACCA62.8
Smc3F: TCTGATCCGCTGTACTCTCCT61.660
R: AGGCGGCAATTCAACATCCA62.5
Cxxc4F: GAGAATTTCAAGTCGTGGCGA60.6193
R: CAGGTTTTCCAGTATGTGCTCC60.9
Fzd1F: TTGGTTCGTCATAAGGCATCAC62.894
R: TGTTGGCAAAGGCCATAATATCT61.5
Sfrp1F: GGTTGGGAGAATCGTGACTGC63.0299
R: TAGACACACGTCGCCTCTTCA62.9
Lrp6F: ATGCAGTACATTGGAGAAGGTG60.0138
R: CGTCTCTCGGCTGCCTATTT61.7
Ntrk2F: TGCCCATCATTTCATTCATCCTT60.3232
R: AAAAGCGGTTTCTCACTCTCC60.2
Pla2g4eF: TGGTGTCCTTTATAGCCTCCTG59.2157
R: CATCTCCTGTACCTTCAAGTTGTG59.3
Fgf10F: TGGTGTCCTTTATAGCCTCCTG58.7124
R: CATCTCCTGTACCTTCAAGTTGTG58.7
PdgfraF: TGGTGTCCTTTATAGCCTCCTG61.2136
R: CATCTCCTGTACCTTCAAGTTGTG60.3

Tm, melting temperature; F, forward; R, reverse; Cabyr, calcium-binding tyrosine phosphorylation-regulated protein; Pcsk4, proprotein convertase subtilisin/kexin type 4; Myl2, myosin, light polypeptide 2; Kng2, kininogen 2; Cpz, carboxypeptidase Z; Pla2g4b, phospholipase A2 group IVB; Dhrs9, dehydrogenase/reductase 9; Pdgfb, platelet derived growth factor B; Mapk12, mitogen activated protein kinase 12; Smc3, structural maintenance of chromosomes 3; Cxxc4, CXXC finger protein 4; Fzd1, frizzled class receptor 1; Sfrp1, secreted frizzled related protein 1; Lrp6, LDL receptor related protein 6; Ntrk2, neutrotrophic tyrosine kinase receptor type 2; Pla2g4e, phospholipase A2 group IVE; Fgf10, fibroblast growth factor 10; Pdgfra, platelet derived growth factor receptor α.

Western blot analysis

Total proteins were extracted separately from experimental groups and control using radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Jiangsu, China). A total of 60 µg of protein was separated by 10% SDS-PAGE. The proteins were subsequently transferred to polyvinylidene difluoride membranes and subjected to western blotting. Membranes were blocked in Tris-buffered saline and Tween-20 [150 mM NaCl, 10 mM Tris-HCl (pH 7.5) and 0.1% Tween-20] containing 5% (w/v) milk at room temperature for 1.5 h, and incubated with the primary and secondary antibodies. Membranes were incubated with the primary antibodies overnight at 4°C. the following antibodies were used: Rabbit anti-phosphorylated extracellular signal-regulated kinase (p-ERK; 1:1,000 dilution, cat. no. NKC20314), β-catenin (1:1,000 dilution, cat. no. NKC31478), transcription factor SOX-17 (SOX17; 1:1,000 dilution, cat. no. LUY220473), calcium-binding tyrosine phosphorylation-regulated protein (CABYR; 1:1,000 dilution, cat. no. ZYS01775), cholesterol side-chain cleavage enzyme mitochondrial (P450scc; 1:1,000 dilution, cat. no. JX012004) and β-actin (1:2,000 dilution, cat. no. KC015541) (all from Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Membranes were subsequently incubated with a horseradish peroxidase-labeled goat anti-rabbit secondary antibody (1:5,000 dilution; cat. no. MB005, Beijing Solarbio Science and Technology, Co., Ltd., Beijing, China) at 37°C for 2 h. Protein signals were detected using Electrochemiluminescence Plus Western Blotting Detection system (GE Healthcare Bio-Sciences, Pittsburgh, PA, USA). Target bands were analyzed for gray levels using ImageJ 1.37 (National Institutes of Health, Bethesda, MD, USA).

Bioinformatic analysis

The functional annotation of differentially-expressed genes was performed according to the Gene Ontology (GO) databases (http://www.geneontology.org). The GO category was classified using hypergeometric distribution, and the Benjamini and Hochberg (BH) false discovery rate (FDR) algorithm was used to adjust the resulting P-values. GO enrichment was considered to be significant if the FDR values were ≤0.05. Pathway analysis was used to identify the significant pathways of the differentially-expressed genes according to the Kyoto Encyclopedia of Genes and Genomes (KEGG; www.genome.jp/kegg). Similarly, hypergeometric distribution, followed by BH multiple testing correction, was performed to select the significant pathways, and the threshold of significance was defined as P=0.05.

Statistical analysis

All data were analyzed using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). Experiments were performed in triplicate. Data are expressed as the mean ± standard deviation. One-way analysis of variance was performed to compare the differences among the groups. Pairwise comparisons among multiple sets of data were analyzed using the least significant difference test. P<0.05 was considered to indicate a statistically significant difference.

Results

AOB effectively inhibits MEF cell proliferation

In order to measure the cytotoxic effects of AOB, MEF cells were treated with increasing concentrations of AOB for 72 h. Subsequently, cell viability was measured using an MTT assay. The results of the present study indicated that AOB inhibited the cell growth of MEF cells more effectively at increased concentrations (Fig. 1). The IC50 value of AOB for MEF cells was 429.8 µg/ml. Compared with the control group, ~50% of MEF cells were killed by a 400 µg/ml concentration of AOB. Therefore, the concentration of 400 µg/ml was selected for the follow-up experiments.
Figure 1.

Effects of increasing AOB concentration on mouse embryonic fibroblast cell proliferation. **P<0.01 vs. 0 µg/ml AOB. AOB, antioxidant of bamboo leaves.

Treatment with AOB results in increased apoptosis

In order to address the cytotoxic effects of the selected treatment, 400 µg/ml AOB-treated cells were analyzed for their apoptosis phenotype. According to the results, treatment with 400 µg/ml AOB in MEF cells for 72 h significantly increased the apoptotic population to 14.57±1.06% (P<0.001; Fig. 2), whereas the control group contained an apoptotic population of 5.09±0.26%.
Figure 2.

Apoptosis rates in mouse embryonic fibroblast cells, analyzed using flow cytometry. The images demonstrate the flow cytometric analysis of apoptosis in (A) control and (B) AOB-treated cells. (C) Histograms illustrating apoptosis assay results. Annexin V+PI+ denotes the late-stage apoptotic cells (B2), and Annexin V+PI− denotes the early-stage apoptotic cells (B4). ***P<0.001 vs. control. AOB, antioxidant of bamboo leaves; PI, propidium iodide.

Hierarchical cluster analysis

Hierarchical cluster analysis was performed to allow for the rapid detection of alterations in the levels of gene expression in addition to identification of important genes, as presented in Fig. 3. Pathway analysis was conducted to identify the significant pathways of the differentially-expressed gene sets, according to KEGG. Through a selection process, the differentially-expressed genes were determined to be primarily involved in metabolic pathways (the metabolism of exogenous substances, sugars, amino acids, glutathione and steroid hormones), apoptotic pathways, and those relevant to reproductive function.
Figure 3.

Cluster analysis of differentially-expressed genes. CK.1, blank control group 1; CK.2, blank control group 2; X400.1, 400 µg/ml AOB treated group 1; X400.2, 400 µg/ml AOB treated group 2; AOB, antioxidant of bamboo leaves.

Confirmation of gene expression by RT-qPCR analysis

In order to verify the data obtained by the microarray analysis (data not shown), RT-qPCR analysis was performed on 20 differentially-expressed genes. The results of the RT-qPCR analysis were consistent with those from the microarray analysis. As presented in Fig. 4, treatment with AOB in MEF cells resulted in the downregulation of dehydrogenase/reductase 9, phospholipase A2 group IVE and platelet derived growth factor B, while the other 17 genes were upregulated.
Figure 4.

Reverse transcription-quantitative polymerase chain reaction analysis of differentially-expressed genes. *P<0.05, **P<0.01 vs. 0 µg/ml AOB. AOB, antioxidant of bamboo leaves. Cabyr, calcium-binding tyrosine phosphorylation-regulated protein; Pcsk4, proprotein convertase subtilisin/kexin type 4; Myl2, myosin, light polypeptide 2; Kng2, kininogen v2; Cpz, carboxypeptidase Z; Pla2g4b, phospholipase A2 group IVB; Dhrs9, dehydrogenase/reductase 9; Pdgfb, platelet derived growth factor B; Mapk12, mitogen activated protein kinase 12; Smc3, structural maintenance of chromosomes 3; Cxxc4, CXXC finger protein 4; Fzd1, frizzled class receptor 1; Sfrp1, secreted frizzled related protein 1; Lrp6, LDL receptor related protein 6; Ntrk2, neutrotrophic tyrosine kinase receptor type 2; Pla2g4e, phospholipase A2 group IVE; Fgf10, fibroblast growth factor 10; Pdgfra, platelet derived growth factor receptor α.

Effects of AOB on the mitogen-activated protein kinase (MAPK)/ERK and the proto-oncogene Wnt (Wnt) pathways

As presented in Fig. 5, treatment with AOB notably increased the expression of p-ERK, and the ERK pathway inhibitor U0126 suppressed the expression of p-ERK in AOB-treated MEF cells. Additionally, the expression of β-catenin, SOX17, CABYR and P450scc was increased following treatment with AOB, although it was decreased by treatment with AOB+U0126 and AOB+Dickkopf-related protein 1 (DKK1; a Wnt pathway inhibitor).
Figure 5.

Western blot analysis of the expression level of (A) p-ERK and ERK, (B) β-catenin, and (C) P450, CABYR and SOX17 in mouse embryonic fibroblast cells. 1–1, blank control group; 1–2, AOB group; 1–3, AOB+U0216 group; 1–4, AOB+DKK1 group; AOB, antioxidant of bamboo leaves; p-, phosphorylated; ERK, extracellular signal-regulated kinase; P450, cholesterol side-chain cleavage enzyme mitochondrial; CABYR, calcium-binding tyrosine phosphorylation-regulated protein; SOX17, transcription factor SOX-17.

Discussion

MAPK signaling pathways are involved in mediating cell growth, survival and death processes. Three of the MAPK members are c-Jun N-terminal kinase, p38 and ERK (10–12). ERK is a widely-expressed protein kinase intracellular signaling molecule which is involved in the regulation of meiosis, mitosis, and postmitotic functions in differentiated cells (13). A number of different stimuli, including growth factors, cytokines, viral infection, ligands for heterotrimeric G protein-coupled receptors, transforming agents and carcinogens, may activate the ERK pathway (14). ERK serves a prominent role in the bone morphogenetic protein (BMP) and ERK/MAPK signaling pathways (15). The phosphorylation of ERK activates the BMP pathway by interacting with mothers against decapentaplegic homolog 1, 5 and 8. In addition, p-ERK exerts a function in the process of apoptosis by interacting with son of sevenless homolog and ribosomal protein S6 kinase α-1 (16). In the results of western blot analysis performed in the present study, the expression of p-ERK significantly increased in AOB-treated MEF cells compared with control MEF cells. No notable changes in ERK expression occurred between the experimental and control groups. The results indicated that AOB may promote the phosphorylation of ERK and activate the ERK signaling pathway. Additionally, adding ERK inhibitor U0126 to AOB-treated cells downregulated the expression of p-ERK. The results of the present study demonstrated that AOB may enhance the activation of the ERK pathway, thereby influencing cellular processes. The Wnt/β-catenin pathway facilitates an accumulation of β-catenin in the cytoplasm and its eventual translocation into the nucleus to act as a transcriptional coactivator of transcription factors (17). The results of the present study demonstrated that the expression of β-catenin increased markedly in AOB-treated MEF cells. Dkk1 is an antagonistic inhibitor of the Wnt signaling pathway that acts by isolating the low-density lipoprotein receptor-related protein 6 co-receptor so that it is unable to activate the Wnt signaling pathway (18). DKK1 has been demonstrated to antagonize the Wnt/β-catenin pathway via a reduction in β-catenin expression (18). It was previously observed that treatment with DDK1 led to a decrease in β-catenin expression in AOB-treated MEF cells (19). These previous results suggested that AOB may activate the Wnt signaling pathway by enhancing β-catenin expression, thus influencing cellular processes. CABYR and SOX17 proteins are associated with the morphological and molecular maturational processes of spermatozoa (20). P450scc, encoded by the CYP11A1 gene, is able to convert cholesterol to pregnenolone to initiate steroidogenesis (7,21). In the results of the presents study, the expression of CABYR, SOX17 and P450scc was upregulated in AOB-treated MEF cells, demonstrating that AOB may affect the regulation of reproductive function. In addition, U0126 and DDK1 inhibited the expression of CABYR, SOX17 and P450scc in AOB-treated MEF cells. The results of the present study demonstrated that these proteins were involved in the ERK and Wnt signaling pathways, and that AOB markedly upregulated the expression of CABYR, SOX17 and P450scc. In conclusion, the present study established an MEF cell model to investigate the effects of AOB on the expression of genes associated with murine reproduction and embryonic development. The results of the present study provided evidence that AOB may impact the expression of proteins associated with reproduction. Additionally, the present findings suggested that AOB may enhance the activation of the ERK and Wnt signaling pathways, thereby influencing cellular processes. Elucidating the AOB role on signaling pathways in the MEF cell model may provide useful information for clinical reproduction and embryonic development.
  21 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Nanotopographical control of human embryonic stem cell differentiation into definitive endoderm.

Authors:  Mohammad Hossein Ghanian; Zahra Farzaneh; Jalal Barzin; Mojgan Zandi; Mohammad Kazemi-Ashtiani; Mehdi Alikhani; Morteza Ehsani; Hossein Baharvand
Journal:  J Biomed Mater Res A       Date:  2015-05-27       Impact factor: 4.396

3.  Retroviral infection of murine embryonic stem cell derived embryoid body cells for analysis of hematopoietic differentiation.

Authors:  Emmanuel Bikorimana; Danica Lapid; Hyewon Choi; Richard Dahl
Journal:  J Vis Exp       Date:  2014-10-20       Impact factor: 1.355

4.  [The challenge and opportunity in the post genome-wide association study era].

Authors:  Li Liu; Xiao-Ping Miao; Dong-Xin Lin
Journal:  Zhonghua Yu Fang Yi Xue Za Zhi       Date:  2012-03

5.  Toxicology and safety of antioxidant of bamboo leaves. Part 2: developmental toxicity test in rats with antioxidant of bamboo leaves.

Authors:  Baiyi Lu; Xiaoqin Wu; Jiayi Shi; Yuejie Dong; Ying Zhang
Journal:  Food Chem Toxicol       Date:  2006-06-03       Impact factor: 6.023

6.  Protein kinase inhibitors can control the progression of endometriosis in vitro and in vivo.

Authors:  Charlotte Ngô; Carole Nicco; Mahaut Leconte; Christiane Chéreau; Sylviane Arkwright; Marie-Cécile Vacher-Lavenu; Bernard Weill; Charles Chapron; Frédéric Batteux
Journal:  J Pathol       Date:  2010-10       Impact factor: 7.996

7.  Extracellular signal-regulated kinase (ERK) phosphorylates histone deacetylase 6 (HDAC6) at serine 1035 to stimulate cell migration.

Authors:  Kendra A Williams; Mu Zhang; Shengyan Xiang; Chen Hu; Jheng-Yu Wu; Shengping Zhang; Meagan Ryan; Adrienne D Cox; Channing J Der; Bin Fang; John Koomen; Eric Haura; Gerold Bepler; Santo V Nicosia; Patrick Matthias; Chuangui Wang; Wenlong Bai; Xiaohong Zhang
Journal:  J Biol Chem       Date:  2013-10-02       Impact factor: 5.157

8.  The piggyBac transposon-mediated expression of SV40 T antigen efficiently immortalizes mouse embryonic fibroblasts (MEFs).

Authors:  Ning Wang; Wenwen Zhang; Jing Cui; Hongmei Zhang; Xiang Chen; Ruidong Li; Ningning Wu; Xian Chen; Sheng Wen; Junhui Zhang; Liangjun Yin; Fang Deng; Zhan Liao; Zhonglin Zhang; Qian Zhang; Zhengjian Yan; Wei Liu; Jixing Ye; Youlin Deng; Zhongliang Wang; Min Qiao; Hue H Luu; Rex C Haydon; Lewis L Shi; Houjie Liang; Tong-Chuan He
Journal:  PLoS One       Date:  2014-05-20       Impact factor: 3.240

9.  Hydrogen peroxide mediates hyperglycemia-induced invasive activity via ERK and p38 MAPK in human pancreatic cancer.

Authors:  Wei Li; Zhenhua Ma; Jiguang Ma; Xuqi Li; Qinhong Xu; Wanxing Duan; Xin Chen; Yunfu Lv; Shuang Zhou; Erxi Wu; Qingyong Ma; Xiongwei Huo
Journal:  Oncotarget       Date:  2015-10-13

10.  GDF11/BMP11 activates both smad1/5/8 and smad2/3 signals but shows no significant effect on proliferation and migration of human umbilical vein endothelial cells.

Authors:  Yong-Hui Zhang; Feng Cheng; Xue-Ting Du; Jin-Lai Gao; Xiao-Lin Xiao; Na Li; Shan-Liang Li; De Li Dong
Journal:  Oncotarget       Date:  2016-03-15
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.