Jun Kim1, Se-Young Choung1. 1. Department of Life and Nanopharmaceutical Sciences, Graduate School, Kyung Hee University, Kyungheedae-ro, Dongdaemun-gu, Seoul, Korea.
Abstract
PURPOSE: Rat pups treated with sodium selenite are typically used as an in vivo model to mimic age-related nuclear cataract. Reactive oxygen species (ROS) production, lipid peroxidation, reduction of antioxidant enzymes, crystalline proteolysis, and apoptosis are considered factors that contribute to pathogenesis of age-related nuclear cataract. In the present study, we investigated whether Pinus densiflora bark extract has potential to prevent cataract formation and elucidated the underlying mechanism. METHODS: Sprague Dawley rats were divided into six groups (n=10). Group 1 rat pups (the control) were treated with only normal saline. The rat pups in groups 2 to 6 were given a subcutaneous injection with sodium selenite (18 μmol/kg bodyweight) on postnatal (P) day 10. Group 3 rat pups (the positive control) were given gastric intubation with curcumin (80 mg/kg bodyweight) on P9, P10, and P11. The rat pups in groups 4 to 6 were given gastric intubation with P. densiflora bark extract 40 mg/kg, 80 mg/kg, and 120 mg/kg, respectively, on P9, P10, and P11. RESULTS: This study showed that P. densiflora bark extract dose-dependently prevented cataract formation. Water-soluble protein, glutathione, superoxide dismutase, glutathione peroxidase, and catalase activity levels were found to be high, and conversely, water-insoluble protein, malondialdehyde, and Ca2+-ATPase were found to be low in the groups treated with P. densiflora bark extract compared to group 2. Real-time PCR analysis showed αA-crystalline, lens-specific m-calpain (Lp84), lens-specific intermediates (filensin and phakinin), and antiapoptotic factor (Bcl-2) were downregulated, and the apoptotic factors (caspase-3 and Bax) and plasma membrane Ca2+-ATPase (PMCA-1) were upregulated in group 2 compared to group 1. P. densiflora bark extract regulated the imbalance of these genes. The increased cleavage form of caspase-3 was lowered in the groups treated with P. densiflora bark extract. In conclusion, P. densiflora bark extract prevented selenite-induced cataract formation via regulating antioxidant enzymes, inhibiting m-calpain-induced proteolysis, and apoptosis, and thus, maintained the transparency of the lens. CONCLUSIONS: These results suggested that P. densiflora bark extract could be a new agent for preventing age-related nuclear cataract.
PURPOSE:Rat pups treated with sodium selenite are typically used as an in vivo model to mimic age-related nuclear cataract. Reactive oxygen species (ROS) production, lipid peroxidation, reduction of antioxidant enzymes, crystalline proteolysis, and apoptosis are considered factors that contribute to pathogenesis of age-related nuclear cataract. In the present study, we investigated whether Pinus densiflora bark extract has potential to prevent cataract formation and elucidated the underlying mechanism. METHODS:Sprague Dawley rats were divided into six groups (n=10). Group 1 rat pups (the control) were treated with only normal saline. The rat pups in groups 2 to 6 were given a subcutaneous injection with sodium selenite (18 μmol/kg bodyweight) on postnatal (P) day 10. Group 3 rat pups (the positive control) were given gastric intubation with curcumin (80 mg/kg bodyweight) on P9, P10, and P11. The rat pups in groups 4 to 6 were given gastric intubation with P. densiflora bark extract 40 mg/kg, 80 mg/kg, and 120 mg/kg, respectively, on P9, P10, and P11. RESULTS: This study showed that P. densiflora bark extract dose-dependently prevented cataract formation. Water-soluble protein, glutathione, superoxide dismutase, glutathione peroxidase, and catalase activity levels were found to be high, and conversely, water-insoluble protein, malondialdehyde, and Ca2+-ATPase were found to be low in the groups treated with P. densiflora bark extract compared to group 2. Real-time PCR analysis showed αA-crystalline, lens-specific m-calpain (Lp84), lens-specific intermediates (filensin and phakinin), and antiapoptotic factor (Bcl-2) were downregulated, and the apoptotic factors (caspase-3 and Bax) and plasma membrane Ca2+-ATPase (PMCA-1) were upregulated in group 2 compared to group 1. P. densiflora bark extract regulated the imbalance of these genes. The increased cleavage form of caspase-3 was lowered in the groups treated with P. densiflora bark extract. In conclusion, P. densiflora bark extract prevented selenite-induced cataract formation via regulating antioxidant enzymes, inhibiting m-calpain-induced proteolysis, and apoptosis, and thus, maintained the transparency of the lens. CONCLUSIONS: These results suggested that P. densiflora bark extract could be a new agent for preventing age-related nuclear cataract.
The eye is susceptible to oxidative damage due to intense light exposure, robust metabolic activity, high oxygen levels, and tension [1]. With aging, accumulation of oxidized lens components and decline of antioxidant systems contribute to the eye becoming prooxidant [2]. A prooxidant state has been considered the major factor of severe ocular diseases, such as cataract, macular degeneration, diabetic retinopathy, and retinitis pigmentosa [3]. Among these diseases, cataract is the primary cause of visual loss and the major cause of visual impairment in the elderly [4]. The treatment of cataract involves surgical removal of the old lens and implantation of a new artificial intraocular lens. Even though the surgery is known for being cost-effective while also increasing quality of life and productivity in patients, it is still suboptimal in developing countries, and a large backlog of cataract cases continues to grow [5]. The postoperative vision outcomes can also have high complication rates, including posterior capsule opacification, detached retina, cystoid macular edema, and double vision [6]. In the case of the elderly, underlying diseases, such as renal dysfunction and diabetes, should be considered before or after cataract surgery [7,8]. To decrease the burden of surgery, preventive interventions of lens opacification are continually sought.Age-related cataract is characterized by reactive oxygen species (ROS) production, reduction of endogenous antioxidants, lipid peroxidation, biochemical changes in crystalline, abnormal cross-linked proteins, activation of m-calpain, apoptosis of lens epithelial cells, etc [3,9]. In the aging process, intracellular ROS production damages not only membrane transport proteins, lipids, and other intermediates but also mitochondrial DNA. This damage leads to mitochondrial dysfunction, cell apoptosis, consequent ROS production, and decline of cellular antioxidant capacity [10,11]. The activity of Ca2+-ATPase, a transport protein in the cell membrane, is decreased by oxidative stress, followed by calcium accumulation and the activation of m-calpain. The increased calpain activity causes proteolysis, coprecipitation, and insolubilization of crystallines, which then leads to cataract light scattering [12]. An overdose of sodium selenite induces oxidative damage causing cataract formation in rat pups. The seleniterat model partially mimics age-related nuclear cataract and has several similarities to humancataract, e.g., decline of Ca2+-ATPase activity, antioxidant enzymes and water-soluble proteins, calpain activation, proteolysis of crystalline, and disruption of the cytoskeleton [13,14]. Although the selenitecataract model is not the same as humancataract, this model is still a useful in vivo model for initial screening of potential anticataract agents.Korean red pine (Pinus densiflora) is widely distributed in Asian countries, such as Korea, Japan, and China. Various parts of P. densiflora, including the cortices, cones, bark, pollen, and needles, have been used as traditional medicine in many diseases. Among them, the bark of P. densiflora has been used to relieve cough, chest pain, abscess, small pox, melena, and dysentery. According to Boncho Gangmok, a Korean key reference book for the study of Eastern medicine, P. densiflora is effective in hemostasis and anti-inflammation. Recently, many studies have found new effects of P. densiflora bark in several diseases. Similar to the French maritime pine bark extract (commercially called Pycnogenol), the Korean red pine bark extract contains similar amounts of procyanidins and polyphenols (catechin and taxifolin) according to high-performance liquid chromatography (HPLC) analyses [15-17]. Procyanidins and polyphenols are well known antioxidants [18,19]. Many studies indicated that the French maritime pine bark extract has protective effects against oxidative stress through scavenging of free radicals and increasing synthesis of antioxidative enzymes [20]. However, few studies have investigated antioxidant and preventive effects of P. densiflora and French maritime pine bark extract in ocular diseases. Both pine bark extracts have been little studied for preventive effects on age-related cataract. To verify the efficacy of P. densiflora bark extract on cataract formation, we used curcumin as the positive control. Previous studies have indicated that curcumin has antioxidant effects and other pharmacological properties. Curcumin also has therapeutic and preventive effects in ocular diseases, such as age-related cataract, age-related macular degeneration, diabetic retinopathy, and glaucoma [21,22]. Using the selenite-induced cataract model, we investigated the effects of P. densiflora bark extract on lens opacification, the antioxidant system, lipid peroxidation, and regulation of mRNA expression in the lens.
Methods
Materials and chemicals
Pinus densiflora bark was collected from 30-year-old Pinus densiflora Sieb. and Zucc. in Samcheok (Gangwon-do, Republic of Korea), sliced, and crushed into a fine powder. Then, extraction was performed using 60% EtOH in 50 °C for 3 h. The extraction step was repeated at least twice. After the filtrate was evaporated under low pressure, the extract was spray-dried. To remove the nonpolar materials, 3 h filtration with alcohol was performed at 30 °C. The filtrate was dried in 50 °C for 3 h to obtain the Pinus Densiflora bark powder. The content of taxifolin, procyanidin B1 and (+)-catechin were determined by HPLC, as described previously [17]. Curcumin (≥90%) was obtained from Carl Roth GmbH + Co. (Karlsruhe, Germany). Sodium selenite (Na2SeO3, ≥98%) was obtained from Sigma-Aldrich (St. Louis, MO). All other chemicals and reagents used in the experiment were of analytical grade.
Animals
Sprague-Dawley (SD) rat pups, aged 6 days, were obtained from DBL (Cheongju, Republic of Korea). Sixty rat pups weighing 16–19 g were housed along with their mothers in normal cages and maintained at 25±1 °C with a 12 h:12 h light-dark cycle. The mothers were fed a standard laboratory animal diet and water ad libitum. The experiments involving handling the animals were conducted in strict accordance with ARVO guidelines, and the protocol was approved by the Institutional Animal Care and Use Committee guideline of Kyung Hee university (KHUASP(SE)-16–071).
Design
The rat pups were randomly divided into six groups (10 rat pups in each group) as follows.Group 1: control animals treated with only normal saline.Group 2: animals treated with sodium selenite (18 μmol/kg bodyweight).Group 3: animals treated with sodium selenite and curcumin (80 mg dry extract/kg bodyweight).Group 4: animals treated with sodium selenite and P. densiflora bark extract (40 mg dry extract/kg bodyweight).Group 5: animals treated with sodium selenite and P. densiflora bark extract (80 mg dry extract/kg bodyweight).Group 6: animals treated with sodium selenite and P. densiflora bark extract (120 mg dry extract/kg bodyweight).Group 2 to 6 animals were given subcutaneous (SC) injection of 18 μmol/kg sodium selenite on P10. Group 1 animals were given an equivalent amount of normal saline, SC. Groups 3 to 6 were given gastric intubation of each sample from P9 to P11 while groups 1 and 2 were given normal saline. On P16, cataract formation was evaluated with an ophthalmoscope, and lens opacification was observed with and without a white-light lamp. The rat pups were sacrificed by cervical dislocation, and the eye lenses were obtained with the posterior approach on P30. Dosage was determined according to Manikandan et al. [23]. Curcumin prevented cataractogenesis at a concentration of more than 75 mg/kg bodyweight [23]. The 80 mg/kg bodyweight was selected as the dosage for the curcumin and P. densiflora bark extract.
Evaluation of cataract staging:
Cataract staging was evaluated on P16 and determined based on a scale of 0 to 6 according to Hiraoka et al. [24], as follows:stage 0: normal transplant lensstage 1: initial sign of nuclear opacity, little light scattering is observed with a white-light lampstage 2: little light scattering with the naked eye, slight nuclear opacity, including swollen fibers or posterior sub-capsular scattering with a white-light lampstage 3: diffuse nuclear opacity with the naked eyestage 4: partial nuclear opacity with the naked eyestage 5: dense opacity that does not involve the lens cortexstage 6: mature dense opacity.
Lens homogenate preparation and protein estimation:
One of both eyes was used to measure proteins, glutathione (GSH) and malondialdehyde (MDA) levels, and antioxidant enzymes. The resected lens tissues were rinsed with ice-cold PBS (1X; 135 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, pH 7.4), blotted, weighted. The lens tissues were homogenized (10% w/v) in ice-cold PBS (pH 7.4) and centrifuged at 12,000 × g for 20 min at 4 °C. The supernatant contained water-soluble proteins and enzymes. The pellet was dissolved in sodium hydroxide and rehomogenized. Then, the pellet was centrifuged at 12,000 × g for 20 min at 4 °C. The supernatant contained water-insoluble proteins. Water soluble and insoluble proteins were measured with the Pierce BCA protein assay kit from Thermo Fisher Scientific Co. (catalog#23225, Fair Lawn, NJ). The results were expressed as nanograms of protein per milligrams of lens tissue a using standard concentration of BSA (BSA; 25–2,000 mM).
Estimation of Ca2+-ATPase activity
Ca2+-ATPase activity was determined in the supernatant that contained water-soluble proteins. Ca2+-ATPase activity was estimated with the Ca2+-ATPase ELISA kit from MyBioSource (catalog#: MBS728130, San Diego, CA) according to manufacturer’s protocol. The Ca2+-ATPase activity was expressed as micromoles of Pi liberate per milligrams of lens protein per hour using a standard concentration of Ca2+-ATPase (0–10 ng/ml).
GSH and MDA levels in lens:
Glutathione and malondialdehyde levels were determined in water-soluble proteins. Total glutathione levels were estimated with the GSH ELISA kit from Elabscience (catalog#: E-EL-0026, Bethesda, MD) according to the manufacturer’s protocol. The GSH concentration was expressed as nanomoles of GSH per milligrams of tissue using standard concentrations of GSH (0.005–0.325 mM). Malondialdehyde levels were estimated with the MDA ELISA kit from Elabscience according to the manufacturer’s protocol (catalog #: E-EL-0060). The MDA concentration was expressed as nanomoles of MDA per grams of tissue using standard concentrations of MDA (0.434–0.1388 μM). GSH and MDA standard curves were drawn using Curve expert professional software (v.2.3.0, Starkville, MS).
Antioxidant enzyme activity in the lens:
Enzyme activities were measured in the supernatant which contained water-soluble proteins. Superoxide Dismutase (SOD) activity was estimated with the SOD assay kit from Cayman Chemical Co (catalog #: 706,002, Ann Arbor, MI). The SOD activity was expressed as units per milligrams of tissue using standard concentrations of SOD (0–0.05 U/ml). One unit is defined as the amount of enzyme needed to exhibit 50% dismutation of the superoxide radical. Glutathione peroxidase (GPx) activity was estimated with the GSH-PX assay kit from Elabscience (catalog #: BC0096). The GPx activity was expressed as the enzyme unit per minute per gram of tissue, where one unit of GPx is defined as 1 g tissue makes the concentration of glutathione in the reaction system decrease 1 μmol of H2O2 per minute at pH 4.5 at 25 °C. Catalase (CAT) activity was estimated with the CAT Colorimetric assay kit from BioVision (catalog #: K773–100, Exton, PA). The CAT activity was expressed as milliunits per gram of tissue, where one unit of catalase is the amount of catalase that decomposes 1 μmol of H2O2 per minute at pH 4.5 at 25 °C. All assay kits were performed according to the manufacturer’s protocol.
RNA extraction and quantitative real-time PCR:
Total RNA was harvested from the eye lenses using easy-BLUE reagent form iNtRON biotechnology (Seongnam, Republic of Korea) according to the manufacturer’s instruction. cDNA was synthesized from RNA using a first-strand cDNA synthesis kit from TaKaRa (Tokyo, Japan). After cDNA was synthesized, quantitative real-time PCR was performed with SYBR Premix Ex Taq from TakaRa using an ABI Step One PlusTM Real-Time PCR system (Applied Biosystems, Foster city, CA). The mixtures were incubated for an initial duration at 95 °C for 10 min, followed by 60 cycles of 95 °C for 5 s, and Tm temperature for 30 s and 72 °C for 30 s. All gene expression levels were normalized to glyceraldehyde 3-phosphated dehydrogenase (GAPDH). The data were calculated using the 2-Δ(ΔCt) method [25]. The primer sequences are shown in Table 1.
Table 1
Details of primers used for quantitative real-time PCR.
No.
Gene
NCBI ID
Sequence (Forward/Reverse; 5’-3’)
TM (°C)/Cycle
1
αA-crystalline
NM_012534.2
TGGCAAACACAACGAGAGGCA
GCCAGCATCCAAGCCAGACT
60/60
2
Filensin
NM_031555.1
CCCTGGAACAAGCTATTAAGCATG
TTCCGGAGGTTTTCGATCTG
58/60
3
Phakinin
NM_001277434.1
CTCCAGGCTGAGACAGAATCTTTA
TCATGCCAGTGCTTGGCAT
58/60
4
PMCA-1
NM_053311.1
CGCCATCTTCTGCACAATT
CAGCCATTGTTCTATTGAAAGTTC
55/60
5
Lp82
NM_017117.1
GTGTTTCCGGCGGGCACCCA
CGCCGCCAATAAATAAAGCGCG
63.5/60
6
Caspase-3
NM_012922.2
GGTTCATCCAGTCACTTTGC
CCAGGGAGAAGGACTCAAAT
57/60
7
Bax
NM_017059.2
CGATGAACTGGACAACAACA
AGCAAAGTAGAAAAGGGCAA
54/60
8
Bcl-2
NM_016993.1
GGGATGCCTTTGTGGAACTA
CTCACTTGTGGCCCAGGTAT
58/60
8
GAPDH
NM_017008.4
GCCAGCCTCGTCTCATAGACA
AGAGAAGGCAGCCCTGGTAAC
61/60
Immunoblot analysis
The resected lenses were homogenized in lysis buffer (20 mM Tris-HCL (pH 7.4), 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.5 M EDTA (pH 8.0), 0.32 mM sucrose, protease inhibitor cocktail, 1 mM NaF, 1 mM Na3VO4). Total tissue lysates were dispersed ultrasonically for 30 min and centrifuged 16,000 × g at 4 °C for 15 min. The proteins were separated with 12.5% PAGE (PAGE) and then transferred to a nitrocellulose membrane. The primary antibodies of caspase-3 (Cell Signaling Technology, Danvers, MA) were used at a dilution of 1:1,000 and incubated at 4 °C overnight. After incubation, the membranes were incubated with horseradish peroxidase (HRP)–labeled anti-rabbit second antibodies for 2 h at 1:5,000 in blocking solution. Expression levels were quantified by band density, followed by normalization to the beta-actin (Santa Cruz Biotechnology, Santa Cruz, CA) control. The bound antibody was visualized using a LAS3000 Luminescent image analyzer (Fuji Film, Tokyo, Japan). Expression levels of band intensity were quantified by image Lab statistical software (Bio-Rad, Richmond, CA).
Statistical analyses
The results were expressed as the mean ± standard deviation (SD). The results were statistically analyzed with a Student t test, Mann–Whitney U test, and one-way ANOVA (ANOVA) using Tukey’s honestly significant difference test. Statistically significant differences were assessed with SPSS (Chicago, IL). A p value of less than 0.05 was considered statistically significant.
Results
Effect of P. densiflora bark extract on cataract formation and classification of cataractous lensesBefore identifying the underlying mechanism of age-related nuclear cataract, we first confirmed the protective effect of P. densiflora bark extract on selenite-induced cataract formation. All the rat eyes were evaluated and classified based on a scale 0 to 6 on P16 (Table 2). All ten rat pups in group 2 (selenite only) exhibited mature opacification in the lenses (mean 4.7, median 5, p<0.001 compared to group 1). Administration of P. densiflora bark extract prevented the development of opacification in the lens dose-dependently compared to group 2 (groups 4 to 6, mean 3.9, 2.8, 2.2, median 4, 3, 2, p<0.05, p<0.05, p<0.001, respectively). The lens opacification observed in the curcumin-treated group (group 3), which served as the positive control, was between that observed in groups 4 and 5 according to the mean (3.6) and the median (3). Figure 1 shows a representative image of each group. The degree of opacification in the lens was determined using a white-light lamp in groups 5 and 6 (Figure 1B). With the light lamp, dark rings were observed near the equator of the lens, which cannot be found with the naked eye. In comparison with the healthy eye lens, the dark parts in the lens may be light scattering and increased as the stage progressed. These data suggest that P. densiflora bark extract has a preventive effect on selenite-induced cataract formation in Sprague Dawley rats.
Table 2
Classification of morphological cataractous lenses.
Groups (n=10)
Number of lenses with different degree of opacification
Median (range)
Mean
Stage 0
Stage 1
Stage 2
Stage 3
Stage 4
Stage 5
Stage 6
Group 1
10
-
-
-
-
-
-
0(0)
0
Group 2
-
-
-
-
3
7
-
5(1)
4.7###
Group 3
-
-
1
3
5
1
-
4(3)
3.6**
Group 4
-
-
1
2
4
3
-
4(3)
3.9*
Group 5
-
1
3
3
3
-
-
3(3)
2.8*
Group 6
-
3
4
2
1
-
-
2(3)
2.2***¥¥
Degree of lens opacification was observed and determined based on a scale 0 to 6 according to [24] on PN day 16. Group 1: normal control, Group 2: selenite-treated, Group 3: Selenite/Curcumin-treated (80 mg/kg), Group 4 to 6: Selenite/P.D bark extract-treated (40, 80, 120 mg/kg, respectively) animals. The Mann–Whitney U-test was performed for pair wise comparisons. ###p<0.001 significant different from group 1. *p<0.05, **p<0.01, ***p<0.001 significant different from group 2. ¥¥p<0.01, significant different from group3.
Figure 1
Effect of Pinus densiflora bark extract on morphological changes in lenses of 16-day-old rats. Anterior views were taken (A) without a white-light lamp and (B) with a white-light lamp. Lenses of group 1 were totally clear (stage 0), those of group 2 developed stage 5 cataract, and those of groups 3 and 4 developed stage 4 cataract. Lenses of groups 5 and 6 were protected by P. densiflora bark extract (stages 3 and 2 each). Group 1: normal control, Group 2: selenite-treated, Group 3: selenite/curcumin-treated (80 mg/kg), Groups 4 to 6: selenite/P. densiflora bark extract-treated (40, 80, and 120 mg/kg, respectively) animals.
Degree of lens opacification was observed and determined based on a scale 0 to 6 according to [24] on PN day 16. Group 1: normal control, Group 2: selenite-treated, Group 3: Selenite/Curcumin-treated (80 mg/kg), Group 4 to 6: Selenite/P.D bark extract-treated (40, 80, 120 mg/kg, respectively) animals. The Mann–Whitney U-test was performed for pair wise comparisons. ###p<0.001 significant different from group 1. *p<0.05, **p<0.01, ***p<0.001 significant different from group 2. ¥¥p<0.01, significant different from group3.Effect of Pinus densiflora bark extract on morphological changes in lenses of 16-day-old rats. Anterior views were taken (A) without a white-light lamp and (B) with a white-light lamp. Lenses of group 1 were totally clear (stage 0), those of group 2 developed stage 5 cataract, and those of groups 3 and 4 developed stage 4 cataract. Lenses of groups 5 and 6 were protected by P. densiflora bark extract (stages 3 and 2 each). Group 1: normal control, Group 2: selenite-treated, Group 3: selenite/curcumin-treated (80 mg/kg), Groups 4 to 6: selenite/P. densiflora bark extract-treated (40, 80, and 120 mg/kg, respectively) animals.
Effect of P. densiflora bark extract on lens crystalline and intermediate filaments
The transparency of the lens is determined by crystalline proteins and lens-specific intermediate filaments. The α-crystalline, a predominant protein in the lens, makes up almost 50% of the water-soluble fraction of the lens. Having higher solubility, stability, and chaperone function, α-crystalline serves to prevent protein misfolding and aggregation in the lens. Oxidative stress by selenium can impose abnormal changes on the conformation and chaperone functionality of α-crystalline [23,26]. Filensin and phakinin, two beaded filaments of the lens intermediate, play an essential role in the maintenance of transparency by forming a complex with α-crystalline. In a previous report, these two filament transcripts are degraded in selenite-induced cataract [27]. In this study, an analysis of lens αA-crystalline and filaments mRNA revealed a substantial loss of transcripts in the selenite-induced groups (Figure 2). Restoration of the mRNA levels in group 5 (80 mg/kg P. densiflora bark extract) may indicate that P. densiflora bark extract protected selenite-induced abnormal changes in the lens crystalline and intermediate filaments.
Figure 2
mRNA expression of αA-crystalline, filensin, and phakinin. mRNA levels were analyzed with comparative real-time PCR and normalized to GAPDH. Each value represents mean ± standard deviation (SD) of three independent experiments (n=7). #p<0.05, ##p<0.01 statistically significant different from group 1. *p<0.05 statistically significant different from group 2. αA-CRY: αA-crystalline. Group 1: normal control, Group 2: selenite-treated, Group 3: selenite/curcumin-treated (80 mg/kg), Groups 4 to 6: selenite/Pinus densiflora bark extract-treated (40, 80, and 120 mg/kg, respectively) animals.
mRNA expression of αA-crystalline, filensin, and phakinin. mRNA levels were analyzed with comparative real-time PCR and normalized to GAPDH. Each value represents mean ± standard deviation (SD) of three independent experiments (n=7). #p<0.05, ##p<0.01 statistically significant different from group 1. *p<0.05 statistically significant different from group 2. αA-CRY: αA-crystalline. Group 1: normal control, Group 2: selenite-treated, Group 3: selenite/curcumin-treated (80 mg/kg), Groups 4 to 6: selenite/Pinus densiflora bark extract-treated (40, 80, and 120 mg/kg, respectively) animals.
Effect of P. densiflora bark extract on glutathione, malondialdehyde, and antioxidant enzymes
ROS-induced oxidative stress is one of the major causes in the pathogenesis of cataract. To identify antioxidant effects of P. densiflora bark extract on selenite-induced cataract, we analyzed GSH, MDA, and antioxidant enzymes activities (GSH, SOD. GPx, and CAT). The GSH level and antioxidant activities were reduced and the MDA level was increased significantly in group 2 (selenite only) compared to the normal control. Administration of P. densiflora bark extract (40, 80, and 120 mg/kg) dose-dependently provided protection from decreases in the GSH level (37%, 72%, and 91%, respectively), SOD (74%, 80%, and 88%, respectively), GPx (47%, 70%, and 90%, respectively), and CAT (27%, 51%, and 88%, respectively). P. densiflora bark also suppressed lipid peroxidation (MDA; 27%, 73%, and 89%, respectively). Results are shown in Table 3. We observed that P. densiflora bark extracts boosted antioxidant enzymes and inhibited lipid peroxidation.
Table 3
Effect of P.D bark on the MDA, GSH, SOD, GPx and CAT levels of the lenses in rats.
Group
Parameters in lens
GSH
MDA
SOD
GPx
CAT
(nmol/mg Tissue)
(nmol/g Tissue)
(U/mg Tissue)
(U/min/g Tissue)
(mU/g Tissue)
Group 1
0.44±0.02
42.4±5.1
0.262±0.015
14.28±1.11
0.72±0.22
Group 2
0.26±0.06###
103.2±21.8###
0.184±0.011###
8.43±1.88###
0.34±0.14##
Group 3
0.36±0.04#
78.2±24.5###
0.241±0.012#***
12.48±3.94*
0.50±0.20
Group 4
0.33±0.08#
86.7±25.4###
0.242±0.013#***
11.19±2.45
0.41±0.14##
Group 5
0.39±0.05**
58.9±13.3***
0.246±0.009***
12.50±2.00*
0.50±0.16
Group 6
0.41±0.06***¥
48.8±8.7***¥¥
0.255±0.010***
13.71±0.81***
0.63±0.14*
Levels of GSH and MDA and activities of SOD, GPx and CAT in the cataractous lenses of experimental groups. Each value represents mean ± SD of eight animals and three independent experiments. #p<0.05, ##p<0.01, ###p<0.001 significant different from group 1. *p<0.05, **p<0.01, ***p<0.001 significant different from group 2. ¥p<0.05, ¥¥p<0.01 significant different from group 3. Group 1: normal control, Group 2: selenite-treated, Group 3: Selenite/Curcumin-treated (80 mg/kg), Group 4 to 6: Selenite/P.D bark extract-treated (40, 80, 120 mg/kg, respectively) animals.
Levels of GSH and MDA and activities of SOD, GPx and CAT in the cataractous lenses of experimental groups. Each value represents mean ± SD of eight animals and three independent experiments. #p<0.05, ##p<0.01, ###p<0.001 significant different from group 1. *p<0.05, **p<0.01, ***p<0.001 significant different from group 2. ¥p<0.05, ¥¥p<0.01 significant different from group 3. Group 1: normal control, Group 2: selenite-treated, Group 3: Selenite/Curcumin-treated (80 mg/kg), Group 4 to 6: Selenite/P.D bark extract-treated (40, 80, 120 mg/kg, respectively) animals.
P.
densiflora bark extracts inhibits calpain-induced proteolysis and lens protein insolubilization
Calcium homeostasis is well maintained by a balance between inward and outward movements of calcium ions. Calcium levels become high in most cataracts due to the decline in Ca2+-ATPase activity. The elevated calcium level leads to the activation of lenticular calpain Lp82, which, in turn, proteolyzes lens soluble proteins, including several types of crystallines. The conversion of water-soluble to insoluble proteins is caused by aggregation and coprecipitation of crystallines. Low water-soluble and high water-insoluble protein levels are factors that can indicate cataract formation [28]. In this study, water-insoluble protein levels were increased, and water-soluble protein levels were decreased in group 2 (Figure 3A,B). P. densiflora bark extract dose-dependently prevented both protein levels from changing significantly. In group 2, Ca2+ ATPase activity and mRNA expression of PMCA-1 were found to be higher compared to the normal control group (Figure 3C,D). Several studies revealed that the Ca2+ ATPase activity and mRNA transcript level of PMCA-1 increase during cataractogenesis due to a compensatory mechanism, which possibly occurred because of increased calcium levels in lenticular cells [29,30]. The increased levels of Ca2+ ATPase activity and gene expression recovered significantly upon treatment with P. densiflora bark extract in rat pups. The gene expression of lenticular calpain Lp82 was decreased in selenite-induced cataractous lenses. We observed that P. densiflora bark extract treatment significantly increased Lp82 expression compared to group 2 (Figure 3D). These results suggest that P. densiflora bark extract protects against selenite-induced lens protein proteolysis, aggregation, and insolubilization.
Figure 3
Inhibitory effect of P. densiflora bark extract on calpain-induced proteolysis and lens protein insolubilization. A: Water-soluble and (B) -insoluble protein levels and (C) activity of Ca2+-ATPase were measured in the cataractous lenses of the experimental groups. The data were presented as the mean ± standard deviation (SD) of three independent experiments (n=7). D: mRNA expression of PMCA-1 and Lp82 was analyzed with comparative real-time PCR (normalized to GAPDH). Each value represents mean ± SD of three independent experiments (n=4). #p<0.05, ###p<0.001 statistically significant different from group 1. *p<0.05, **p<0.01, ***p<0.001 statistically significant different from group 2. ¥p<0.05 statistically significant different from group 3. Group 1: normal control, Group 2: negative control, Group 3: curcumin treated (80 mg/kg), Groups 4 to 6: P. densiflora bark extract treated (40, 80, and 120 mg/kg, respectively) animals.
Inhibitory effect of P. densiflora bark extract on calpain-induced proteolysis and lens protein insolubilization. A: Water-soluble and (B) -insoluble protein levels and (C) activity of Ca2+-ATPase were measured in the cataractous lenses of the experimental groups. The data were presented as the mean ± standard deviation (SD) of three independent experiments (n=7). D: mRNA expression of PMCA-1 and Lp82 was analyzed with comparative real-time PCR (normalized to GAPDH). Each value represents mean ± SD of three independent experiments (n=4). #p<0.05, ###p<0.001 statistically significant different from group 1. *p<0.05, **p<0.01, ***p<0.001 statistically significant different from group 2. ¥p<0.05 statistically significant different from group 3. Group 1: normal control, Group 2: negative control, Group 3: curcumin treated (80 mg/kg), Groups 4 to 6: P. densiflora bark extract treated (40, 80, and 120 mg/kg, respectively) animals.
Inhibition of apoptosis in selenite-induced cataractous lenses by P. densiflora bark extract
We hypothesized that selenite increases ROS and lipid peroxidation, causes continual intracellular damages, and results in lens cell apoptosis. The loss of lens epithelial cells leads to imbalance in normal lens homeostasis. In this study, apoptosis-related genes (caspase-3 and Bax) were significantly upregulated, while an antiapoptotic gene (Bcl-2) was significantly downregulated in the selenite-induced cataract model (Figure 4A). These imbalances in the expression of these genes were counteracted by treatment with P. densiflora bark extract. Then, we performed western blot analysis to clarify the regulatory effect of P. densiflora bark extract on selenite-induced apoptosis. Caspase-3 activation causes structural and regulatory component proteolysis in cells, resulting in apoptosis [31]. The cleaved form of caspase-3 is commonly used as an apoptotic factor in many studies. Selenitecataract (group 2) exhibited increased levels of cleaved caspase-3 compared to normal control. In contrast, the group treated with P. densiflora bark extract exhibited significantly lower levels of both proteins than group 2 (Figure 4B). Together, these data suggest that P. densiflora bark extract inhibits apoptosis in selenite-induced cataractous lenses.
Figure 4
P. densiflora bark extract inhibited selenite-induced apoptosis in rat pup lenses. A: The levels of caspase-3, Bcl-2, and Bax mRNA were normalized to the GAPDH mRNA level. B: western blotting analysis indicated protein expression of caspase-3 (35 kDa) and the cleaved form of caspase-3 (17 kDa). The protein levels were quantified with band density. The results are presented as the mean ± standard deviation (SD) of three independent experiments (n=4). #p<0.05, ##p<0.01, ###p<0.001 statistically significant different from group 1. *p<0.05, **p<0.01, ***p<0.001 statistically significant different from group 2. Cas-3: caspase-3. Group 1: normal control, Group 2: selenite-treated, Group 3: selenite/curcumin-treated (80 mg/kg), Groups 4 to 6: selenite/P. densiflora bark extract-treated (40, 80, and 120 mg/kg, respectively) animals.
P. densiflora bark extract inhibited selenite-induced apoptosis in rat pup lenses. A: The levels of caspase-3, Bcl-2, and Bax mRNA were normalized to the GAPDH mRNA level. B: western blotting analysis indicated protein expression of caspase-3 (35 kDa) and the cleaved form of caspase-3 (17 kDa). The protein levels were quantified with band density. The results are presented as the mean ± standard deviation (SD) of three independent experiments (n=4). #p<0.05, ##p<0.01, ###p<0.001 statistically significant different from group 1. *p<0.05, **p<0.01, ***p<0.001 statistically significant different from group 2. Cas-3: caspase-3. Group 1: normal control, Group 2: selenite-treated, Group 3: selenite/curcumin-treated (80 mg/kg), Groups 4 to 6: selenite/P. densiflora bark extract-treated (40, 80, and 120 mg/kg, respectively) animals.
Discussion
Pycnogenol, a standardized extract of French maritime pine bark, is composed of flavonoids, procyanidins, and phenolic acids. The mixture of the components has shown greater pharmacological effects than its purified components, such as cardiovascular benefits, antihypertensive effects, alleviation of allergies and asthma, reduction of thromboxane, and antidiabetic effects [18,20,32]. However, a recent study showed that the Korean red pine (P. densiflora) bark extract is also composed of flavonoids and phenolic acids, and has considerable antioxidant effects [33]. Several studies discovered antiadipogenic and anti-inflammatory effects of P. densiflora bark extract, but further studies are required to validate the effectiveness [34,35]. French maritime and Korean red pine bark extract have been studied in many diseases but rarely in ocular diseases. The role of pine bark extract in age-related cataract is still unclear. That being said, other antioxidant substances can be used to prevent oxidative stress–related ocular diseases, such as diabetic retinopathy, age-related macular degeneration, glaucoma, and cataract [10,36]. In the present study, we investigated and evaluated the anticataract effects of Korean red pine bark extract within the selenitecataract model.The sodium selenite-induced cataract model is a convenient and rapid model for studying mechanisms of age-related nuclear cataract. Oxidative stress and apoptosis have been considered the major underlying pathways in the initiation and progression of cataracts. Overdose of sodium selenite induces ROS generation, damage of membrane Ca2+-ATPase, calpain-mediated proteolysis, insolubilization of crystallines, degradation of cytoskeletal elements, and decline of antioxidant enzymes [29]. Intracellular ROS overproduction can change the redox set point of lens epithelial cells quickly, causing the cells to become an oxidizing environment. Due to this environment, ROS easily oxidize DNA, membrane pump systems, lipids, and proteins, followed by loss of lens epithelial cells by apoptotic mechanisms via caspase-3 activation and regulation of Bcl-2 and Bax [37,38]. Caspase-3 has been investigated to play a significant role in regulating apoptosis. Activated caspase-3 leads to the cleavage of several cytoplasmic and nuclear substrates [39]. The relative equipoise of Bcl-2 and Bax is an important determinant of apoptosis in mammalian cells [26]. In the present study, the mRNA expression levels of caspase-3 and Bax were found to be high in the selenite-treated group but remained at near-normal levels in the P. densiflora–treated group. The mRNA expression level of Bcl-2, an antiapoptotic factor, was also maintained at near-normal levels in the group treated with P. densiflora bark extract.The effect of P. densiflora bark extract on cataract formation was evaluated through the observation of the lenses. Cataract staging was determined with the naked eye and with a white lamp. Stages 3 to 6 can be easily characterized with the naked eye according to [24]. However, stages 2 and 3 needed light to determine the degree of opacification. Using a white lamp, we can distinguish the differences between the two stages. Morphological examinations and cataract staging showed that lens opacification was decreased dose-dependently by treatment with P. densiflora bark extract. Further chemical estimations were also performed to investigate intracellular mechanisms.ROS are generated in the lens continuously by exposure to solar ultraviolet light and cellular metabolism [40]. To protect from oxidative stress, the eye lens has high concentrations of antioxidant components, such as ascorbic acid, GSH, and several other antioxidant enzymes [41]. In this study, GSH, MDA, SOD, GPx, and CAT were measured to investigate the antioxidant effect of P. densiflora bark extract. MDA results from lipid peroxidation and is usually considered a biomarker for evaluating the level of oxidative stress [42]. GSH levels and enzyme activities of SOD, GPx, and CAT were found to be low in the selenite-induced group, while the MDA level was higher than that of the normal control group. The levels of MDA and GSH and the activities of SOD and GPx showed similar levels to those found by Ferlemi et al. [43]. Antioxidant enzyme activities were maintained at near-normal levels, and MDA levels were also dose-dependently decreased in the P. densiflora bark extract groups. We can now assume that P. densiflora bark extract enhanced SOD, GPx, and CAT activities and inhibited lipid peroxidation and GSH depletion by scavenging ROS directly.Ca2+-ATPase activity was significantly decreased after subcutaneous injection of sodium selenite; however, it increased at near-normal levels after 72 h of the injection. Elevation of Ca2+-ATPase activity and mRNA transcript levels were also observed in the Upjohn Pharmaceuticals Limited rat which is the hereditary cataract model [44]. Administration of P. densiflora bark extract normalized Ca2+-ATPase activity and gene expression of PMCA-1 by protecting proteins from sulfhydryl oxidation, and thus prevented calpain-mediated proteolysis. Consequently, the insoluble protein levels of the groups treated with P. densiflora bark extract were decreased in a dose-dependent manner. Lp82 calpain, found only in the rodent rat lens, provides information for understanding the role of calpain-3 in the human lens. In the selenitecataract model, Lp82 calpain is activated by an influx of Ca2+ ions, thus resulting in proteolysis of crystalline. After the progression of cataracts, autolysis of Lp82 calpain occurs, and the gene expression level is lowered compared to that of the normal control [30]. Administration of P. densiflora bark extract normalizes Lp82 gene expression and can indicate that calpain of the group treated with P. densiflora bark extract may be less activated than that of the selenite-treated group.The results for the lens morphology, protein contents of the lens, GSH, MDA, antioxidant enzyme activities, and gene expression in the selenite-treated groups are in accordance with several studies of the selenitecataract in vivo [27,28,43]. The mechanism of pathogenesis in age-related cataract includes oxidative stress–induced proteolysis of crystalline and apoptosis pathway. There are two approaches to preventing cataract formation: (1) the prevention of ROS production and (2) the inhibition of calpain-induced proteolysis. The results for GSH, MDA, and antioxidant enzyme activities showed that P. densiflora bark extract boosts antioxidant potential and blocks the burst of ROS production. Early blocking of ROS production could inhibit the onset of cataract formation and maintain normal status in antioxidant enzyme activities. P. densiflora bark extract also inhibited calpain-induced proteolysis through regulation of Ca2+-ATPase activity, PMCA-1, and Lp82 gene expression. The decreased tendency of proteolysis was also observed in the water-soluble and -insoluble protein contents. Therefore, P. densiflora bark extract inhibited selenite-induced apoptosis in rat lenses in two ways.In conclusion, the results of this study appear to suggest the effectiveness of P. densiflora bark extract in preventing cataract formation by modulating antioxidant enzymes, Ca2+-ATPase activity, gene expression of αA-crystalline, intermediate filament (filensin and phakinin), plasma membranes Ca2+-ATPase, and lens-specific calpain and apoptosis-related genes. P. densiflora bark extract possibly acts as a scavenger of free radicals, protects against oxidative stress, and inhibits calpain-induced proteolysis. The results suggest that P. densiflora bark extract could be an anticataract agent; however, further investigation is needed for application in humancataract.
Authors: Segewkal H Heruye; Leonce N Maffofou Nkenyi; Neetu U Singh; Dariush Yalzadeh; Kalu K Ngele; Ya-Fatou Njie-Mbye; Sunny E Ohia; Catherine A Opere Journal: Pharmaceuticals (Basel) Date: 2020-01-16