| Literature DB >> 28927097 |
Qinghui Yang1,2, Liang Wan1,2, Can Xiao3, Haibo Hu4, Longqiang Wang1,2, Jun Zhao2,5, Zhe Lei1,2, Hong-Tao Zhang1,2.
Abstract
Downregulated microRNA (miR)-124 is common in numerous types of cancer, including non-small cell lung cancer (NSCLC). A previous study by the authors demonstrated that LIM-homeobox domain 2 (LHX2) was upregulated and promoted cell growth in NSCLC. However, whether LHX2 affects the migratory and invasive abilities of NSCLC cells and the association of LHX2 with miR-124 remains unclear. The present study revealed that miR-124 expression was frequently decreased in human NSCLC cells and tissues and negatively correlated with LHX2 expression, which was increased in NSCLC cells and tissues. Furthermore, the transfection of miR-124 mimic significantly inhibited endogenous expression of LHX2 mRNA and protein in A549 and H1299 cells, and miR-124 inhibitor promoted LHX2 expression. Of note, overexpression of miR-124 in A549 and H1299 cells attenuated cellular migratory and invasive abilities, and this was observed in LHX2-silenced A549 and H1299 cells. Knockdown of miR-124 augmented the migratory and invasive abilities in A549 and H1299 cells. The 3'-untranslated region of LHX2 transcript has also been identified to be a putative target of miR-124. Taken together, the results revealed that miR-124 may inhibit migration and invasion by repressing LHX2 expression in NSCLC cells. The findings of the present study suggested that overexpression of miR-124 or silencing of LHX2 may provide a therapeutic strategy for advanced NSCLC.Entities:
Keywords: LIM-homeobox 2; invasion; microRNA-124; migration; non-small cell lung cancer
Year: 2017 PMID: 28927097 PMCID: PMC5587980 DOI: 10.3892/ol.2017.6607
Source DB: PubMed Journal: Oncol Lett ISSN: 1792-1074 Impact factor: 2.967
Comparison of various clinicopathological parameters with LHX2 mRNA and miR-124 expression in 40 NSCLC samples.
| Ratio of expression (T/N) | |||
|---|---|---|---|
| Parameter | n | LHX2 mRNA | miR-124 |
| Age | |||
| ≤65 | 18 | 20.61±7.69 | 0.73±0.19 |
| >65 | 22 | 7.41±2.55 | 0.68±0.22 |
| [ | 0.086 | 0.864 | |
| Sex | |||
| Male | 28 | 13.56±4.96 | 0.67±0.20 |
| Female | 12 | 12.80±5.67 | 6.03±5.23 |
| [ | 0.929 | 0.144 | |
| Smoking status | |||
| No | 20 | 12.13±3.91 | 3.82±3.15 |
| Yes | 20 | 14.54±6.68 | 0.73±0.27 |
| [ | 0.892 | 0.298 | |
| Lymph node metastasis | |||
| No | 20 | 14.13±6.67 | 3.76±3.15 |
| Yes | 20 | 12.54±3.95 | 0.79±0.27 |
| [ | 0.267 | 0.543 | |
| Histology | |||
| Adenocarcinoma | 23 | 10.16±3.71 | 3.38±2.74 |
| Squamous cell carcinoma | 14 | 18.37±8.82 | 0.89±0.37 |
| Others | 3 | 14.17±13.59 | 0.29±0.12 |
| [ | 0.205 | 0.669 | |
Data are presented as the mean ± standard error.
Mann-Whitney U test between two groups.
Kruskall-Wallis test for ≥3 groups. NSCLC, non-small cell lung cancer; T, NSCLC tissues; N, paired noncancerous lung tissues; miR, microRNA; LHX2, LIM-homeobox domain 2.
Primers for reverse transcription or amplification of miR-124 and LHX2 mRNA.
| Primer | Sequence (5′-3′) |
|---|---|
| RT | |
| U6 | CGAGCACAGAATCGCTTCACGAATTTGCGTGTCAT |
| miR-124 | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCATT |
| qPCR | |
| U6, forward | CGAGCACAGAATCGCTTCA |
| U6, reverse | CTCGCTTCGGCAGCACATAT |
| miR-124, forward | GTGCAGGGTCCGAGGTATT |
| miR-124, reverse | GCTAATAAGGCACGCGGTG |
| β-actin, forward | CACAGAGCCTCGCCTTTGCC; |
| β-actin, reverse | ACCCATGCCCACCATCACG |
| LHX2, forward | TTCCAGAACGCCCGAGCCAA |
| LHX2, reverse | GGGGCTAGTCAAGTCTGTC |
miR, microRNA; LHX2, LIM-homeobox domain 2; RT-PCR, reverse transcription polymerase chain reaction; qPCR, quantitative PCR.
Figure 1.High LHX2 and low miR-124 expression levels in human NSCLC cells and tissues. (A) RT-qPCR analysis of LHX2 mRNA levels in HBE and NSCLC cells. LHX2 mRNA expression levels are presented as a relative index normalized against β-actin. Data is presented as the mean ± standard deviation of three replicates. (B) Western blot analysis of LHX2 protein levels in HBE and NSCLC cells. β-actin was used as the loading control. (C) Difference in relative LHX2 mRNA expression levels between 40 paired tumor tissues and adjacent noncancerous tissues. Data were analyzed using the paired t-test and presented as the mean ± standard error. (D) RT-qPCR analysis of miR-124 expression levels in HBE and NSCLC cells. miR-124 expression levels were expressed as a relative index normalized against U6. (E) Relative miR-124 expression levels in 40 paired tumor tissues and adjacent noncancerous tissues. Difference in miR-124 expression level between tumor tissues and adjacent noncancerous tissues was analyzed by paired t-test. Data are presented as the mean ± standard error. (F) Correlation between miR-124 and LHX2 mRNA expression levels in 40 paired NSCLC tissues. × and y axes represent the log10 transformed fold change of tumor/noncancerous tissue mRNA expression ratios of miR-124 and LHX2, respectively. *P<0.05; **P<0.01; ***P<0.001. NSCLC, non-small cell lung cancer; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; LHX2, LIM-homeobox domain 2; miR, microRNA; HBE, human bronchial epithelial; T, tumor; N, noncancerous lung tissues.
Figure 2.miR-124 reduces LHX2 expression level in NSCLC cells by targeting LHX2 3′-UTR. (A) RT-qPCR analysis of miR-124 expression levels in A549 and H1299 cells transfected with miR-124 mimics or miR-NC for 48 h. Scrambled sequences were used as miR-NC, and U6 was used as an internal control. (B) LHX2 mRNA and protein expression levels in A549 and H1299 cells transfected with miR-124 mimics or miR-NC for 48 h. (C) miR-124 expression levels in A549 and H1299 cells transfected with miR-124 inhibitor (anti-miR-124) or negative control (anti-miR-NC). (D) LHX2 mRNA and protein expression levels in A549 and H1299 cells transfected with anti-miR-124 or anti-miR-NC. (E) Schematic diagram showing the cloning of one predicted miR-124 binding site of LHX2 3′-UTR in psiCHECK-2 luciferase constructs. (F) Relative luciferase activities of the wild-type or mutant LHX2 3′-UTR reporter gene in A549 and H1299 cells transfected with miR-124 mimics or miR-NC. Relative Renilla luciferase activity was determined by normalization to firefly luciferase activity. Data is presented as the mean ± standard deviation of three replicates. *P<0.05; **P<0.01; ***P<0.001. 3′-UTR, 3′ untranslated region; miR, microRNA; LHX2, LIM-homeobox domain 2; NSCLC, non-small cell lung cancer; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; NC, negative control.
Figure 3.miR-124 suppresses migration and invasion of NSCLC cells. (A) Transwell assays of A549 cells and H1299 cells transfected with miR-124 or miR-NC. Following transfection with miR-124 or miR-NC for 24 h, A549 and H1299 cells were allowed to invade through an 8 µM pore in Transwell chambers. Migrated and invaded cells were stained and counted in ≥3 microscopic fields (magnification, ×100). (B) Bar charts presenting the number of miR-124 mimics or miR-NC-transfected cells that have undergone migration or invasion. Data are presented as the mean ± standard deviation of three independent fields. (C) Transwell assays for A549 cells and H1299 cells transfected with anti-miR-124 or anti-miR-NC. (D) Bar charts presenting the number of anti-miR-124 or anti-miR-NC-transfected cells that have undergone migration or invasion. ***P<0.001. miR, microRNA; NSCLC, non-small cell lung cancer; NC, negative control.
Figure 4.Knockdown of LHX2 inhibits migration and invasion of NSCLC cells. The levels of LHX2 mRNA and protein in (A) A549 cells and (B) H1299 cells transfected with si-LHX2-1, si-LHX2-2or si-NCfor 48 h. Transwell assays for (C) A549 and (D) H1299 cells transfected with si-LHX2-1, si-LHX2-2 or si-NC. LHX2-silenced A549 and H1299 cells were allowed to migrate and invade through an 8 µM pore in Transwell chambers. Migrated and invaded cells were stained and counted in ≥3 microscopic fields (magnification, ×100). Data in the bar charts are presented as the mean ± standard deviation of three independent fields.***P<0.001. si, short interfering; LHX2, LIM-homeobox domain 2; NSCLC, non-small cell lung cancer; NC negative control.