Literature DB >> 28924516

Characterization and transferability of microsatellites for the Kangaroo Paw, Anigozanthos manglesii (Haemodoraceae).

Bronwyn M Ayre1,2, Janet M Anthony1,2, David G Roberts2,3, Richard J N Allcock4,5, Siegfried L Krauss1,2.   

Abstract

PREMISE OF THE STUDY: Microsatellites were developed for the future assessment of population genetic structure, mating system, and dispersal of the perennial kangaroo paw, Anigozanthos manglesii (Haemodoraceae), and related species. METHODS AND
RESULTS: Using a Personal Genome Machine (PGM) semiconductor sequencer, ca. 4.03 million sequence reads were generated. QDD pipeline software was used to identify 190,000 microsatellite-containing regions and priming sites. From these, 90 were chosen and screened using PCR, and 15 polymorphic markers identified. These sites amplified di-, tri-, and pentanucleotide repeats with one to 20 alleles per locus. Primers were also amplified across congeners A. bicolor, A. flavidus, A. gabrielae, A. humilis, A. preissii, A. pulcherrimus, A. rufus, and A. viridis to assess cross-species transferability.
CONCLUSIONS: These markers provide a resource for population genetic studies in A. manglesii and other species within the genus.

Entities:  

Keywords:  Anigozanthos; Catspaw; Haemodoraceae; Kangaroo Paw; microsatellite primers

Year:  2017        PMID: 28924516      PMCID: PMC5584820          DOI: 10.3732/apps.1700055

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Anigozanthos manglesii D. Don (Haemodoraceae), the Red and Green Kangaroo Paw, is a perennial wildflower endemic to the Southwest Australian Floristic Region. Flowering occurs between July and November, with large inflorescences of red and green tubular flowers on stems up to a meter tall. These flowers are visited by nectar-feeding birds and invertebrates seeking nectar and pollen (Hopper, 1993). Differences in the foraging behavior of vertebrates and invertebrates are predicted to have a significant impact on pollen dispersal patterns, multiple paternity, genetic diversity, and fitness of offspring (Krauss et al., 2017). Manipulation of pollinator access to inflorescences and paternity assignment of the resulting seeds allows for the quantification of pollen dispersal patterns by specific pollinators. Here, we describe the development of microsatellite markers that will facilitate future research on the genetic consequences of pollen dispersal by bird and invertebrate pollinators of A. manglesii. In particular, we will use these markers for mating system and paternity assignment following pollinator manipulation studies to test hypotheses of high paternal diversity for plants pollinated by nectar-feeding birds (Krauss et al., 2017). The degree of congeneric cross-transferability of the markers was also assessed in eight other species, covering over 80% of the genus.

METHODS AND RESULTS

DNA was extracted from a leaf sample collected in Kings Park, Perth, Western Australia (Appendix 1), using the extraction method of Carlson et al. (1991), modified with the addition of potassium acetate after lysis incubation, a 5 M NaCl step, and an additional ethanol precipitation after the isopropanol precipitation. One hundred grams of DNA was sheared to approximately 300–400 bp using an S2 sonicator (Covaris, Woburn, Massachusetts, USA), and a single barcoded library was prepared using a NEBNext Ultra DNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA). Inserts sized 330–360 bp were selected by gel excision (E-Gel, Invitrogen/Thermo Fisher Scientific, Waltham, Massachusetts, USA), and the libraries were produced, assessed, and quantified using a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, California, USA). The final library was diluted to 9 pM using a OneTouch 2 Template 400 kit (Life Technologies, Carlsbad, California, USA) and enriched. A Personal Genome Machine (PGM) semiconductor sequencer (Life Technologies) using 850 flows on a 316 sequencing chip produced approximately 350–400 bp read lengths. Signal processing, base-calling, and quality trimming were conducted using the default settings on Torrent Suite 4.0 (Thermo Fisher Scientific), and library-specific FASTQ files were generated. This resulted in 4.03 million reads with a modal read length of 354 bp and 2.4 Gb of data (National Center for Biotechnology Information [NCBI] Sequence Read Archive Bioproject no. PRJNA390010). Using QDD 3.1 software, all reads were screened for microsatellite-containing regions (Meglecz et al., 2014). A total of 190,000 were identified. Thirty primer pairs were chosen for screening at a time. Primers chosen were all categorized as design A (no homopolymers, no other target microsatellites in flanking region, no nanosatellite in primer or flanking regions, pure not compound microsatellites), were unable to form a hairpin, had a low PCR align score, had a >20-bp distance between primer and microsatellite, had higher microsatellite repeats, and had similar annealing temperatures, but had a variety of PCR product lengths (Meglecz et al., 2014; http://net.imbe.fr/∼emeglecz/qdd.html#choice). Each assay had a final volume of 10 μL and contained 5 μL of SsoAdvanced SYBR Green Supermix (Bio-Rad Laboratories, Hercules, California, USA), 0.3 μM of forward and reverse primers, and 5–10 ng of genomic DNA. PCR was conducted on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories). Using a single sample, DNA was amplified across a range of temperatures to determine an appropriate annealing temperature. To test for polymorphism, eight individuals were amplified at the chosen best temperature and analyzed using Precision Melt Analysis (Bio-Rad Laboratories). The forward primer of primer pairs that amplified consistently across all eight individuals were each tagged with a fluorescent label (6-FAM, NED, VIC, or PET) compatible with the ABI 3500 sequencer (Life Technologies). This process was repeated three times, until 15 reliable primer pairs were produced. All other primer pairs failed to amplify consistently and/or cleanly (i.e., they displayed stuttering and allelic patterns were difficult to distinguish) across different DNA samples. To amplify microsatellite regions, PCR was performed on a Veriti Thermocycler (Life Technologies), either individually or in multiplex. Individual microsatellite loci (Am1, Am2, Am8, Am23, Am28, Am56, Am60, and Am79) were amplified using 10–20 ng of DNA with 2 μL of 5× buffer containing dNTPs (Fisher Biotec, Wembley, Western Australia, Australia), 2 mM MgCl2, 0.16 μM of both reverse and fluorescently labeled forward primers, and 0.05 μL of 5.5 units/μL Taq polymerase (Fisher Biotec) in a 10-μL reaction. The amplification cycle began with a 1-min denaturation at 95°C; followed by 35 cycles of denaturation at 95°C for 10 s, annealing (at variable temperatures, see Table 1) for 30 s, and extension at 72°C for 45 s; and a final extension of 15 min at 72°C. The remaining seven primer pairs were amplified across two multiplex mixes (primer mix 1 contained Am11, Am13, Am20, and Am29, all at 0.2 μM; primer mix 2 contained Am2 [0.1 μM], Am75 [0.4 μM], and Am82 [0.3 μM]). All multiplex reactions used 6 μL of 2× Multimix (QIAGEN, Hilden, Germany), 2 μL of 5× Q-solution (QIAGEN), 1.25 μL of primer mix, and 2.75 μL of 10–20 ng DNA in a final 12-μL reaction. The amplification cycle began with 15-min denaturation at 95°C; followed by 30 cycles of denaturation at 94°C for 30 s, annealing (at variable temperatures, see Table 1) for 90 s, and extension at 72°C for 90 s; and a final extension of 30 min at 60°C. PCR products were separated by capillary electrophoresis on an ABI 3500 Genetic Analyzer (Life Technologies), and allele sizes scored using Geneious version 7.1 (Biomatters Ltd., Auckland, New Zealand; http://www.geneious.com/).
Table 1.

Characteristics of 15 polymorphic microsatellite loci developed for Anigozanthos manglesii.

LocusPrimer sequences (5′–3′)Fluorescent labelRepeat motifAllele size (bp)Ta (°C)GenBank accession no.
AM1F: TACTGAGATCGAACCACTTCTTGVIC(AG)1519061.5KY853194
R: GGGATGGAGGTAGGACTGTT
AM2F: GTTGTGTTGTACTCGCTGGGVIC(AT)79165.5KY853195
R: GTCCTTGCTCTAGCCACCAA
AM8F: AACATGACTTAAGCTTCACTTTCG6-FAM(ATC)1514056KY853196
R: ACTTAGCCTTTCTGGCAAATG
AM11F: AGTCGGACTAACTTGGCAGC6-FAM(AAT)829057KY853197
R: CCACAACGATGTTGTCTTGC
AM13F: TTGAGTAACGATGGCAAACTTPET(ACAT)824157KY853198
R: TGACTTACCTTCATTCGCCA
AM20F: CAACTCAAGAACAAAGAAGGAAG6-FAM(AGC)819357KY853199
R: TGGTTTCTCTATCTGAGTTTGGAT
AM23F: CTCGCTCTCCACAATCCACTVIC(AG)1412060KY853200
R: TGGAATTCTCCTGCCTTCAC
AM28F: TGGTTTATCAATGGAACAATATAAGANED(AG)99456KY853201
R: CAAATGATGATAAATGAATGAATAAGA
AM29F: TCCACCATATCCTACCGTGAPET(AGC)1111957KY853202
R: GCTGCATTCACATCCTCAGA
AM56F: GGAAGTTGAAGAGGAGCTGGTVIC(AG)2412055KY853203
R: ACAAGACAGTCAATTATTCATTCATTA
AM60F: TTTCCGGAACTGAAGGAAAGVIC(AT)1017655KY853204
R: CCTGGCGAGGTTATTAAGCA
AM71F: AATCCGGAGCAAAGTATCCAPET(AAG)826364.5KY853205
R: TTGGGAGAGGAGACGCTTTA
AM75F: CAATGCATGACAGAAGGTTCANED(AAG)830065.5KY853206
R: TTCTGCATGATCAGGGTAGTTG
AM79F: AACAATCACGGCTCCCTTT6-FAM(AAG)1223764.5KY853207
R: GAGATTGTTCCTCTCGCTGC
AM82F: CTTTCCCATTCCCTCCCATPET(AAG)817765.5KY853208
R: AGCTCCTTGACCAAGCACTG

Note: Ta = annealing temperature.

Characteristics of 15 polymorphic microsatellite loci developed for Anigozanthos manglesii. Note: Ta = annealing temperature. Primers were tested on leaf samples collected from three populations of A. manglesii (Appendix 1, Table 2). All 15 markers were polymorphic in at least one population. Analysis for observed heterozygosity, expected heterozygosity, and Hardy–Weinberg equilibrium was completed with GenAlEx (Peakall and Smouse, 2006, 2012). Observed and expected heterozygosities ranged from 0.182 to 0.950 and 0.133 to 0.931, respectively. A significant departure from Hardy–Weinberg equilibrium was recorded in different loci across the three populations (Table 2). MICRO-CHECKER (van Oosterhout et al., 2004) identified the possibility of null alleles in some loci, but not consistently across populations. No stuttering or large allele dropouts were identified.
Table 2.

Genetic properties of 15 polymorphic microsatellite loci for three populations of Anigozanthos manglesii.

Kattidj (n = 20)Korung National Park (n = 25)Lovekin (n = 24)
LocusAHoHebAHoHebAHoHeb
AM140.3420.745*60.5390.799**200.6500.931*
AM2180.3890.767**70.3500.499ns90.6360.809*
AM8160.5000.914**180.7730.914**110.3330.880***
AM1190.5790.799ns90.8640.825**90.7080.773ns
AM13140.6000.880*80.7140.787ns90.5560.778**
AM2080.3130.783***130.5000.869***80.2860.810***
AM2310.0000.00010.0000.000150.3180.916***
AM2860.3750.727***80.2380.833***60.8330.842*
AM2990.5290.808ns70.5450.705*100.5220.817*
AM5620.1330.124ns20.2000.180ns50.2610.363ns
AM6030.4210.342ns100.6960.593ns10.0000.000
AM71120.5790.856***140.9090.874***80.7390.772ns
AM75150.3330.895***90.7500.834***180.5910.862*
AM7990.4740.838***70.3910.797***150.9520.901ns
AM82110.7000.818ns60.1820.419***110.6670.747*

Note: A = number of alleles sampled; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled.

Voucher and locality information are provided in Appendix 1.

Statistically significant deviation from Hardy–Weinberg equilibrium is indicated as *P < 0.05, **P < 0.01, ***P < 0.001; ns = not statistically significant.

Genetic properties of 15 polymorphic microsatellite loci for three populations of Anigozanthos manglesii. Note: A = number of alleles sampled; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled. Voucher and locality information are provided in Appendix 1. Statistically significant deviation from Hardy–Weinberg equilibrium is indicated as *P < 0.05, **P < 0.01, ***P < 0.001; ns = not statistically significant. Using the same extraction and amplification methods as above, the primers were tested on DNA extracted from five individuals from each of A. bicolor Endl., A. flavidus DC., A. gabrielae Domin, A. humilis Lindl., A. preissii Endl., A. pulcherrimus Hook., A. rufus Labill., and A. viridis Endl. Success varied, with four to eight markers successfully amplified across different species (Table 3).
Table 3.

Results of cross-amplification (allele size ranges) of microsatellite loci isolated in Anigozanthos manglesii and tested in five individuals across eight congeneric taxa. Anigozanthos manglesii is included for comparison.

LocusA. manglesiiA. bicolorA. flavidusA. gabrielaeA. humilisA. preissiiA. pulcherrimusA. rufusA. viridis
AM1152–258
AM289–10987–8981–8981–8989898989
AM884–195
AM11209–320295–307294307–309301–357294302–307294–304306–311
AM13240–280247180177
AM20178–230179–184190–197188151–190185–194177–194
AM23105–159102–125106–131128–130103–153104–122116–140103–145
AM2884–115
AM2982–132117–126114–117120112–132117–126117–129123–126106–129
AM5684–107
AM60162–187
AM71258–322271–294265–271262–286276–290276–294274–290
AM75295–362289
AM79215–260
AM82174–302179–189180–194179–182
Total76684675

Note: — = unsuccessful amplification.

Results of cross-amplification (allele size ranges) of microsatellite loci isolated in Anigozanthos manglesii and tested in five individuals across eight congeneric taxa. Anigozanthos manglesii is included for comparison. Note: — = unsuccessful amplification.

CONCLUSIONS

Fifteen microsatellite markers have been developed for A. manglesii. Without changing any of the amplification conditions, between four and eight of these markers successfully amplified in each of eight congeneric species. This suggests that with further species-specific refinement, these markers will provide a valuable resource for population genetic studies of the genus.
Appendix 1.

Voucher information for Anigozanthos species used in this study.

SpeciesVoucher specimen accession no.Collection locality (Population ID)Geographic coordinatesN
A. manglesii D. DonPERTH 2027925Kings Park and Botanic Gardens, Perth (Kattidj)−31.9602, 115.832320
A. manglesiiPERTH 2028069Canning Mills Rd., Perth Hills (Korung National Park)−32.06666, 116.0333325
A. manglesiiPERTH 2883961Kings Park, Perth (Lovekin)−31.9697, 115.829424
A. bicolor Endl.KPBG 20040828Mogumber, 37.7 km N from turnoff from Bindoon to Moora−31.05555, 116.0438895
A. flavidus DC.PERTH 4661192Mount Barker−34.766570, 117.44541635
A. gabrielae DominKPBG 20060052Mount Arid, slopes ca. 1 km due SW of summit−34.273611, 115.2697225
A. humilis Lindl.CANB 701.549.1Muchea−31.48345, 115.93335
A. preissii Endl.KPBG 2012059717.2 km S of the Mt. Barker to Denmark rd.−49.976667, 117.6208335
A. pulcherrimus Hook.KPBG 200911161.1 km from the Cockleshell Gully, Dandaragan−30.1414722, 115.09758335
A. rufus Labill.PERTH 5746167Mullet Lake Nature Reserve−33.47261, 121.5949.25
A. viridis Endl.KPBG 200003085 km S Brennans bridge Scott River National Park−34.273611, 115.2697225

Note: N = number of individuals.

Vouchers are stored in the Western Australian Herbarium (PERTH), Perth, Western Australia; the Kings Park and Botanic Gardens Herbarium (KPBG), Perth, Western Australia; and the Australian National Herbarium (CANB), Canberra, Australian Capital Territory.

  4 in total

1.  Segregation of random amplified DNA markers in F1 progeny of conifers.

Authors:  J E Carlson; L K Tulsieram; J C Glaubitz; V W Luk; C Kauffeldt; R Rutledge
Journal:  Theor Appl Genet       Date:  1991-12       Impact factor: 5.699

Review 2.  Novel Consequences of Bird Pollination for Plant Mating.

Authors:  Siegfried L Krauss; Ryan D Phillips; Jeffrey D Karron; Steven D Johnson; David G Roberts; Stephen D Hopper
Journal:  Trends Plant Sci       Date:  2017-04-12       Impact factor: 18.313

3.  QDD version 3.1: a user-friendly computer program for microsatellite selection and primer design revisited: experimental validation of variables determining genotyping success rate.

Authors:  Emese Meglécz; Nicolas Pech; André Gilles; Vincent Dubut; Pascal Hingamp; Aurélie Trilles; Rémi Grenier; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2014-05-26       Impact factor: 7.090

4.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

  4 in total
  1 in total

1.  Near-neighbour optimal outcrossing in the bird-pollinated Anigozanthos manglesii.

Authors:  Bronwyn M Ayre; David G Roberts; Ryan D Phillips; Stephen D Hopper; Siegfried L Krauss
Journal:  Ann Bot       Date:  2019-10-18       Impact factor: 4.357

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.