Mariana Melani1,2, Ayelén Valko1, Nuria M Romero1, Milton O Aguilera3, Julieta M Acevedo1, Zambarlal Bhujabal4, Joel Perez-Perri1, Rocío V de la Riva-Carrasco1, Maximiliano J Katz1, Eleonora Sorianello1,2, Cecilia D'Alessio1,2,5, Gabor Juhász6,7, Terje Johansen4, María I Colombo2,3, Pablo Wappner8,2,5. 1. Fundación Instituto Leloir, Buenos Aires 1405, Argentina. 2. Consejo Nacional de Investigaciones Científicas y Tecnológicas (CONICET), Buenos Aires, Argentina. 3. Laboratorio de Biología Celular y Molecular-Instituto de Histología y Embriología, Facultad de Ciencias Médicas, Universidad Nacional de Cuyo, 5500 Mendoza, Argentina. 4. Molecular Cancer Research Group, Department of Medical Biology, University of Tromsø-The Arctic University of Norway, 9037 Tromsø, Norway. 5. Departamento de Fisiología, Biología Molecular y Celular, Facultad de Ciencias Exactas y Naturales-Universidad de Buenos Aires, 1428 Buenos Aires, Argentina. 6. Department of Anatomy, Cell and Developmental Biology, Eötvös Loránd University, 1053 Budapest, Hungary. 7. Institute of Genetics, Biological Research Centre, 6726 Szeged, Hungary. 8. Fundación Instituto Leloir, Buenos Aires 1405, Argentina pwappner@leloir.org.ar.
Abstract
Autophagy is an evolutionary conserved process by which eukaryotic cells undergo self-digestion of cytoplasmic components. Here we report that a novel Drosophila immunophilin, which we have named Zonda, is critically required for starvation-induced autophagy. We show that Zonda operates at early stages of the process, specifically for Vps34-mediated phosphatidylinositol 3-phosphate (PI3P) deposition. Zonda displays an even distribution under basal conditions and, soon after starvation, nucleates in endoplasmic reticulum-associated foci that colocalize with omegasome markers. Zonda nucleation depends on Atg1, Atg13, and Atg17 but does not require Vps34, Vps15, Atg6, or Atg14. Zonda interacts physically with Atg1 through its kinase domain, as well as with Atg6 and Vps34. We propose that Zonda is an early component of the autophagy cascade necessary for Vps34-dependent PI3P deposition and omegasome formation.
Autophagy is an evolutionary conserved process by which eukaryotic cells undergo self-digestion of cytoplasmic components. Here we report that a novelDrosophila immunophilin, which we have named Zonda, is critically required for starvation-induced autophagy. We show that Zonda operates at early stages of the process, specifically for Vps34-mediated phosphatidylinositol 3-phosphate (PI3P) deposition. Zonda displays an even distribution under basal conditions and, soon after starvation, nucleates in endoplasmic reticulum-associated foci that colocalize with omegasome markers. Zonda nucleation depends on Atg1, Atg13, and Atg17 but does not require Vps34, Vps15, Atg6, or Atg14. Zonda interacts physically with Atg1 through its kinase domain, as well as with Atg6 and Vps34. We propose that Zonda is an early component of the autophagy cascade necessary for Vps34-dependent PI3P deposition and omegasome formation.
Autophagy, one of the main degradative pathways of the cell, begins with the formation of a membranous cistern called phagophore or isolation membrane that buds from a cup-shaped structure associated with the endoplasmic reticulum (ER) called omegasome (Axe ; Matsunaga ; Biazik ; Karanasios and Ktistakis, 2015). Thereafter, the phagophore expands and finally seals, giving rise to a double membrane organelle named autophagosome where cytoplasmic components including protein aggregates, ribosomes, and mitochondria are sequestered (reviewed by Mizushima ). Soon afterward, autophagosomes acquire degradative enzymes by successive fusion with late endosomes and lysosomes, thereby becoming an autophagolysosome where the engulfed material is degraded (for a revision, see Eskelinen, 2005).Autophagy, whose main stimulus is the stress generated by nutrient deprivation, is modulated by intracellular signaling pathways, mainly the target of rapamycin (TOR) and AMP-activated protein kinase (AMPK) cascades, as well as by extracellular factors including hormones (e.g., insulin and glucagon) or cytokines (e.g., gamma interferon) (Mizushima ). Activation of the ULK1 complex (Atg1 complex in yeast and Drosophila) has been described as the first event in the autophagy cascade. This complex, formed by ULK1/2, FIP200/Atg17, Atg13, and Atg101, is constitutively assembled (Hara and Mizushima, 2009), and its kinase activity is negatively regulated by TOR signaling, which in turn depends on amino acid availability and the energy status of the cell (Anding and Baehrecke, 2015). ULK1/Atg1 regulates the recruitment and activation of a second complex: the Vps34lipid kinase complex, also called the autophagy nucleation complex, which is composed of the class 3 phosphatidylinositol 3-kinase Vps34 and the proteins PI3KR4 (Vps15), Beclin1 (BECN1)/Atg6, and Atg14 (Juhasz ; Simonsen and Tooze, 2009; Itakura and Mizushima, 2010; Anding and Baehrecke, 2015; Sanchez-Wandelmer ).Vps34 mediates the synthesis of phosphatidylinositol 3-phosphate (PI3P) (Sanchez-Wandelmer ). Local synthesis of this lipid defines the location of omegasome formation and, therefore the site of recruitment of several FYVE domain-containing proteins including DFCP1 and WIPI1, which in turn mediate phagophore elongation and autophagosome formation (Axe ; Proikas-Cezanne ). Within the Vps34 complex, BECN1 is a direct target of ULK1/Atg1 (Russell ), and Vps34 kinase activity is believed to depend on the differential interaction of BECN1 with AMBRA1 or with the anti-apoptotic protein BCL-2 (Gu ). BCL-2 binding modulates the levels of BECN1 that become available to interact with Vps34 in the autophagy nucleation complex, thereby contributing to define if the cell will enter apoptosis or activate autophagy (Marquez and Xu, 2012).FK506-binding proteins (FKBPs) play a role in immunoregulation and participate in critical cellular functions that include protein trafficking and folding. Members of this family display peptidyl prolyl cis/trans isomerase (PPIase) activity, participating in de novo protein folding through the interconversion of intermediate folding states into the final tridimensional structure (Kang ). We have investigated a novelDrosophila gene—which we have named Zonda (Zda)—that encodes an immunophilin of the FKBP family, presumably homologous to mammalianFKBP8/FKBP38 (Bhujabal ).By utilizing an in vivo approach, we found that Zda is critically required for starvation-induced autophagy. Zda protein displays a cytoplasmic distribution in well-fed larvae and, shortly after the onset of starvation, nucleates in foci that colocalize with omegasome markers. Genetic manipulations revealed that components of the induction complex, Atg1, Atg13, and Atg17, but not components of the Vps34 complex, Vps34, Vps15, Atg6, or Atg14, are required for starvation-induced Zda nucleation. Moreover, Zda interacts physically with Atg1, Atg6, and Vps34 and is necessary for autophagic activation of Vps34 and omegasome formation, as revealed by DFCP1 foci formation following starvation. Zonda overexpression is sufficient to trigger a bona fide autophagic response, as evaluated by different autophagic markers. We propose that Zda is a novel component of the Drosophila autophagy machinery that forms part of the omegasome and is required for deposition of PI3P by the Vps34 complex and, hence, for the initiation of autophagosome biogenesis.
RESULTS
Zonda is required for starvation-induced autophagy
We investigated the function of the Drosophila melanogaster CG5482 gene product, a presumptive immunophilin of the FKBP family. The predicted protein structure of Zda includes three tetratricopeptide repeat motifs, a calmodulin binding domain, and a transmembrane domain on the C-terminus (Supplemental Figure S1A), the latter being a unique feature within the DrosophilaFKBP family (Shirane and Nakayama, 2003; Barth ). To begin investigating the biology of this gene, which we have called Zonda (Zda), after the name of a wind that blows at the Andes mountain chain, we analyzed its expression by quantitative real-time (RT) PCR and found that it was expressed in all third instar larval tissues, although at higher levels in the gut and fat body (Supplemental Figure S1B). As a next step, we sought to assess Zda subcellular distribution, for which we generated a mCherry-Zda fusion protein (mCh-Zda), which we expressed in fat body cells of transgenic larvae. In feeding third instar larvae, mCh-Zda was distributed throughout the cytoplasm (Figure 1A). After 6 h of starvation, Zda distribution shifted to a punctate pattern (Figure 1B), suggesting that it might participate in the autophagy process. To investigate this possibility, we performed colocalization experiments with Atg8, a protein that is cytoplasmic in fed conditions and incorporates in autophagic structures on starvation. We utilized a transgenic line expressing GFP-Atg8, in which the green fluorescence displayed ubiquitous distribution in fat body cells of feeding larvae (Figure 1A′) and a punctate pattern when the larvae were subjected to starvation (Figure 1B′). Note that 81% of the GFP-Atg8 foci colocalized with mChZda in these starving larvae (Figure 1B″), suggesting that Zda was recruited to autophagic structures. In spite of displaying this dramatic redistribution depending on the feeding status, Zda mRNA is expressed at similar levels in fed or starved individuals (Supplemental Figure S1C).
FIGURE 1:
Zonda redistributes on starvation and is required for starvation-induced autophagy. (A, B) Zda subcelullar localization was sensitive to starvation. Confocal images of fat body cells from fed (A) or starved (B) third instar larvae expressing UAS-mCherry-Zda (mCh-Zda) and UAS-GFP-Atg8 with a Ppl-Gal4 driver. In well-fed larvae, GFP-Atg8 and mCh-Zda distributed throughout the cytoplasm. In starved larvae, both proteins colocalized in autophagic structures. (C–Y) Zda is required for starvation-induced autophagy. Transmission electron microscopy images of fat body cells of starved third instar larvae expressing w (C) or zda (D). In control cells autophagic structures, such as autophagosomes (AP) and autolysosomes (AL), could be observed at high frequency, while their occurrence was largely reduced in cells of zda larvae (E), N = 3. One-tailed, unpaired Student’s t test, p < 0.05. Scale bar 1 μm. Confocal images of fat body cells of feeding or starved third instar larvae expressing GFP-Atg8 and the indicated double-stranded RNAs (F–J). GFP-Atg8 was distributed homogenously in feeding larvae (F) and nucleated in larvae expressing a control RNAi (w) subjected to 4 h starvation (G). This nucleation was prevented in larvae expressing zda (H) or atg1 (I) RNAi. Quantification of GFP-Atg8 puncta is depicted (J), N = 40. In control individuals, LysoTracker staining increased sharply 4 h after starvation, revealing the accumulation of lysosomes and autolysosomes (K and L). This increase was blocked in larvae expressing zda (M) or atg1 (N) RNAi. Quantification of the cell area fraction positive for LysoTracker in K–N is shown (O), N = 20. In control larvae, GFP-Lamp puncta increased sharply after 4 h starvation, showing once again that lysosomes or autolysosomes accumulated (P and Q). Expression of zda (R) or atg1 (S) RNAi blocked this accumulation, N = 20. Quantification of the cell area fraction covered by GFP-Lamp in P–S is depicted (T). A GFP fusion to the adaptor protein Ref(2)P did not accumulate in control larvae in feeding or in starved conditions, indicating that the autophagic flux was normal (U and V). In larvae expressing zda (W) or atg1 (X) RNAi, the autophagic flux was stalled, as indicated by the accumulation of GFP-Ref(2)P. Cell area fraction covered by GFP-Ref(2)P in U–X is depicted (Y), N = 20. Data represent mean ± SD. Means with asterisks are significantly different from w fed. One-way ANOVA followed by a Tukey’s test with a confidence interval higher than 95% (p 0.05). Scale bar: 50 μm.
Zonda redistributes on starvation and is required for starvation-induced autophagy. (A, B) Zda subcelullar localization was sensitive to starvation. Confocal images of fat body cells from fed (A) or starved (B) third instar larvae expressing UAS-mCherry-Zda (mCh-Zda) and UAS-GFP-Atg8 with a Ppl-Gal4 driver. In well-fed larvae, GFP-Atg8 and mCh-Zda distributed throughout the cytoplasm. In starved larvae, both proteins colocalized in autophagic structures. (C–Y) Zda is required for starvation-induced autophagy. Transmission electron microscopy images of fat body cells of starved third instar larvae expressing w (C) or zda (D). In control cells autophagic structures, such as autophagosomes (AP) and autolysosomes (AL), could be observed at high frequency, while their occurrence was largely reduced in cells of zda larvae (E), N = 3. One-tailed, unpaired Student’s t test, p < 0.05. Scale bar 1 μm. Confocal images of fat body cells of feeding or starved third instar larvae expressing GFP-Atg8 and the indicated double-stranded RNAs (F–J). GFP-Atg8 was distributed homogenously in feeding larvae (F) and nucleated in larvae expressing a control RNAi (w) subjected to 4 h starvation (G). This nucleation was prevented in larvae expressing zda (H) or atg1 (I) RNAi. Quantification of GFP-Atg8 puncta is depicted (J), N = 40. In control individuals, LysoTracker staining increased sharply 4 h after starvation, revealing the accumulation of lysosomes and autolysosomes (K and L). This increase was blocked in larvae expressing zda (M) or atg1 (N) RNAi. Quantification of the cell area fraction positive for LysoTracker in K–N is shown (O), N = 20. In control larvae, GFP-Lamp puncta increased sharply after 4 h starvation, showing once again that lysosomes or autolysosomes accumulated (P and Q). Expression of zda (R) or atg1 (S) RNAi blocked this accumulation, N = 20. Quantification of the cell area fraction covered by GFP-Lamp in P–S is depicted (T). A GFP fusion to the adaptor protein Ref(2)P did not accumulate in control larvae in feeding or in starved conditions, indicating that the autophagic flux was normal (U and V). In larvae expressing zda (W) or atg1 (X) RNAi, the autophagic flux was stalled, as indicated by the accumulation of GFP-Ref(2)P. Cell area fraction covered by GFP-Ref(2)P in U–X is depicted (Y), N = 20. Data represent mean ± SD. Means with asterisks are significantly different from w fed. One-way ANOVA followed by a Tukey’s test with a confidence interval higher than 95% (p 0.05). Scale bar: 50 μm.To analyze whether Zda is necessary for autophagy, we knocked down zda by RNA interference (RNAi) expression (zda) in fat body cells (Supplemental Figure S1D) and analyzed the effect on the occurrence of autophagic structures by transmission electron microscopy (TEM). The areas occupied by autophagic structures (Figure 1, C–E) and acidic organelles (Supplemental Figure S1, E–G) in larval fat body cells were remarkably reduced in zda larvae as compared with control individuals expressing an unrelated RNAi (white RNAi; w, suggesting that Zda participates in the autophagy process. To confirm this, we analyzed several different autophagy markers in larvae expressing zda in comparison to control w larvae. The behavior of all the tested markers indicated that Zda is indeed required for autophagy (Figure 1, F–Y): First, nucleation of GFP-Atg8 in fat body cells of starving larvae was abolished in zda individuals (Figure 1, F–H and J), and notably, the extent of nucleation inhibition was comparable to that observed after silencing Atg1 (atg1), a key serine/threonine kinase whose activation triggers the autophagy cascade (Figure 1, F, G, I, and J). Interestingly, the Zda requirement for starvation-induced autophagy is not exclusive of fat body cells, as silencing of Zda in salivary glands also prevented nucleation of Atg8 in starved third instar larvae (Supplemental Figure S1, H–J).As a second criterion, we analyzed the incorporation of LysoTracker, a dye that stains acidic vesicles such as lysosomes and autolysosomes. The LysoTracker pattern changes dramatically in cells that have induced autophagy (Scott ), due to the increase in size and number of acidic structures (Saftig and Klumperman, 2009). Whereas LysoTracker staining was faint in fat body cells of feeding larvae of the control genotype (w) (Figure 1K), after 4 h of starvation the LysoTracker signal became stronger and punctate, due to an increase in the size and number of lysosomes (Figure 1L). In fat body cells of starving zda larvae, the LysoTracker pattern was largely abolished (Figure 1, M and O), further indicating that Zda participates in starvation-induced autophagy. Once again, the inhibition provoked by zda was similar to that observed after RNAi-mediated silencing of Atg1 (Figure 1, M–O).We generated a mutant allele of zda by imprecise excision of a P-element inserted 58 base pairs upstream of the 5′ end of the gene. The resulting excision removed 1100 base pairs of the coding region, including the transcription initiation site (Supplemental Figure S1K). This resulted in the generation of a zda null allele (zda), as confirmed by RT–PCR analysis of zda transcript levels in zda homozygous embryos (Supplemental Figure S1L). zda homozygous individuals died at the first larval molt, and viability was rescued by expression of the zda cDNA with pumpless or heat shock-Gal4 drivers, indicating that the excision generated a bona fide zda mutant allele. To confirm the results obtained with zda-mediated silencing, we generated zda homozygous clones by heat shock-induced mitotic recombination (Perrimon and Gans, 1983). Mosaic third instar larvae were subjected to starvation, and LysoTracker incorporation was analyzed in the fat body as well as in wing imaginal discs. Whereas in zda cells LysoTracker staining was strong, in zda clones the signal was much weaker (Supplemental Figure S1, M–N′). These observations validate the results obtained with the expression of zda and suggest that Zda function in autophagy is cell autonomous.To continue the characterization of Zda function in autophagy, we analyzed the behavior of two additional autophagy markers, namely Lamp and Ref(2)P. Lamp, which can be visualized through a GFP-Lamp fusion construct, is a lysosomal transmembrane glycosylated protein (Pulipparacharuvil ). Whereas in well-fed control larvae, GFP-Lamp displayed a punctate pattern composed of small dots (Figure 1P), this pattern changed to bigger and more abundant GFP-Lamp puncta after starvation (Figure 1, Q and T), indicating that autophagy was activated. Notably, expression of the zda transgene abrogated the accumulation of big GFP-Lamp puncta (Figure 1, R and T) in a comparable manner to that observed following Atg1 silencing (Figure 1, S and T), further indicating that Zda is necessary for autophagy. Finally, as a fourth marker, we analyzed the accumulation of GFP-Ref(2)P. Ref(2)P is the fly orthologue of mammalianSQSTM1/p62, an adaptor protein normally used to follow the autophagic degradation of ubiquitinated proteins (Bjorkoy ). p62/Ref(2)P is degraded at the autolysosome along with ubiquitinated substrates during the autophagy process, and therefore, accumulation of p62/Ref(2)P is a hallmark of impaired autophagic flux. As shown in Figure 1, U, V, and Y, in control larvae GFP-Ref(2)P accumulated minimally in fat body cells of either feeding or starved individuals, which is indicative of an active autophagy flux (Lindmo ; Chang and Neufeld, 2009). In contrast, in starved larvae expressing zda or atg1 the GFP-Ref(2)P signal increased sharply (Figure 1, W–Y), indicating that autophagic degradation was impaired (Chang and Neufeld, 2009). Altogether the above results show that Zda is necessary for starvation-induced autophagy in Drosophila larvae.
Zonda nucleation depends on the Atg1 complex but not on the Vps34 complex
To identify the specific step of the autophagy cascade in which starvation-induced Zda nucleation takes place, we analyzed whether nucleation still occurs after knocking down components of the induction complex, namely Atg1, Atg13, or Atg17. As shown in Figure 2, A–E, silencing of any of the three genes of the induction complex prevented nucleation of mCh-Zda in fat body cells of starving larvae. Nucleation of GFP-Atg8 was used as a positive control, and, as expected, its nucleation also diminished after knocking down Atg1, Atg13, or Atg17 (Figure 2, F–J). Following the same rationale, we analyzed whether elements of the nucleation complex are necessary for Zda foci formation. Neither in larvae expressing a dominant negative form of Vps34 (vps34) (Juhasz ), nor in a line that expressed an RNAi against the same kinase (Vps34) mCh-Zda nucleation was affected (Figure 2, K–M and Q), while nucleation of GFP-Atg8 was largely abolished (Figure 2, R–T and Y). Similar results were observed after silencing additional components of the nucleation complex, namely Vps15, Atg6, or Atg14; none of them affected Zda nucleation (Figure 2, K and N–Q) but prevented formation of GFP-Atg8 puncta (Figure 2, R and U–Y). Taken together, the above results suggest that starvation-induced Zda nucleation depends on the induction complex and is independent of the Vps34 complex.
FIGURE 2:
Starvation-induced Zda nucleation is downstream of the induction complex and upstream or in parallel of the nucleation complex. Confocal images of fat body cells of starved third instar larvae expressing mChZda (A–D and K–P) or GFP-Atg8 (F–I and R–X) and the indicated RNAi. mCh-Zda (A and K) and GFP-Atg8 (F and R) nucleated in larvae expressing a control RNAi (w). Silencing of the induction complex components atg1, atg17, or atg13 blocked starvation-dependent Zda nucleation (B–D) and GFP-Atg8 nucleation (G–I). Inactivation or silencing of the nucleation complex components vps34, vps15, atg6, or atg14 did not block starvation-induced Zda nucleation (L–P), whereas it did block GFP-Atg8 nucleation (S–X). The mCh-Zda and GFP-Atg8 foci in each condition were counted manually (E, J, Q, and Y). Data represent mean ± SD. Means marked with an asterisk are significantly different. One-way ANOVA followed by a Tukey’s test with a confidence interval higher than 99% (p < 0.01). Scale bar: 20 μm. Number of cells counted for each genotype (N): A = 59; B = 87; C = 90; D = 87; F = 67; G = 39; H = 59; I = 40; K = 76; L = 88; M = 85; N = 87; O = 59; P = 77; R = 112; S = 76; T = 84; U = 104; V = 50; X = 69.
Starvation-induced Zda nucleation is downstream of the induction complex and upstream or in parallel of the nucleation complex. Confocal images of fat body cells of starved third instar larvae expressing mChZda (A–D and K–P) or GFP-Atg8 (F–I and R–X) and the indicated RNAi. mCh-Zda (A and K) and GFP-Atg8 (F and R) nucleated in larvae expressing a control RNAi (w). Silencing of the induction complex components atg1, atg17, or atg13 blocked starvation-dependent Zda nucleation (B–D) and GFP-Atg8 nucleation (G–I). Inactivation or silencing of the nucleation complex components vps34, vps15, atg6, or atg14 did not block starvation-induced Zda nucleation (L–P), whereas it did block GFP-Atg8 nucleation (S–X). The mCh-Zda and GFP-Atg8 foci in each condition were counted manually (E, J, Q, and Y). Data represent mean ± SD. Means marked with an asterisk are significantly different. One-way ANOVA followed by a Tukey’s test with a confidence interval higher than 99% (p < 0.01). Scale bar: 20 μm. Number of cells counted for each genotype (N): A = 59; B = 87; C = 90; D = 87; F = 67; G = 39; H = 59; I = 40; K = 76; L = 88; M = 85; N = 87; O = 59; P = 77; R = 112; S = 76; T = 84; U = 104; V = 50; X = 69.
Zonda is required for Vps34 autophagic function
The above set of results suggests that Zda operates upstream of the Vps34 complex and therefore, that it might be required for Vps34 autophagic activation. Vps34 activity (i.e., deposition of PI3P on internal cell membranes) can be visualized using PI3P probes such as the GFP-2xFYVE reporter. Vps34 plays a central role at early steps of autophagy but is also required more broadly for several vesicular trafficking processes (Matsunaga ). In fat body cells of feeding larvae, GFP-2xFYVE labels early endosomes found around the nuclei, as well as autophagosomes, which are usually more peripheral (Figure 3, A and C) (Juhasz ; Matsunaga ; Shravage ). On starvation, a significant increase of peripheral puncta (autophagosomes) occurs in white control larvae, while the number of perinuclear puncta (early endosomes) remains constant (Figure 3, A–C). To investigate whether Zda is required for autophagic activation of Vps34, we analyzed the behavior of the GFP-2xFYVE reporter in larvae expressing zda in parallel with control genotypes such as vps34, atg1 (positive controls), or atg5 (negative control). Interestingly, after Zda silencing, the increase of peripheral GFP-2xFYVE foci on starvation was prevented, while perinuclear foci were not affected (Figure 3, D–F, and Supplemental Figure S2, A–D), suggesting that Zda is required for activation of Vps34 specifically during autophagy. As previously reported, expression of the vps34KD construct abrogated both the basal GFP-2xFYVE signal in well-fed larvae, as well as the autophagy-triggered increase of peripheral GFP-2xFYVE signal (Figure 3, G–I, and Supplemental Figure S2, A–D) (Juhasz ). Consistent with the above results, accumulation of GFP-Rab5 or GFP-Rab7, which label respectively early and late endosomes (Wucherpfennig ; Zhang ; Juhasz ), were not affected in zda larvae (Supplemental Figure S2, E–L). As expected, expression of atg1 (positive control) interfered specifically with the increase of peripheral foci (autophagosomes) on starvation (Figure 3, J–L), and notably, the extent to which the autophagic activation of Vps34 depends on Zda was similar to its dependence on Atg1 (Figure 3, D–F and J–L). The autophagic increase of GFP-2xFYVE peripheral signal did not depend on Atg5 (negative control), a molecule involved in Atg8 lipidation and therefore known to operate downstream of Vps34 (Figure 3, M–O). Collectively the above set of results indicates that Zda is required for autophagic activation of Vps34 and, hence, for PI3P deposition on locations where formation of the omegasome will take place.
FIGURE 3:
Starvation-induced Vps34 activity requires Zda. Confocal images of fat body cells of fed (A, D, G, J, and M) or starved (B, E, H, K, and N) third instar larvae expressing the PI3P reporter GFP-2xFYVE. white (A and B), zda (D and E), vps34 (G and H), atg1 (J and K), or atg5 (M and N) were coexpressed. In control larvae under feeding conditions, a proportion of the GFP-2xFYVE signal was perinuclear (corresponding to endosomes), while another proportion was more peripheral (autophagosomes) (A). Following starvation, the peripheral signal of the reporter increased significantly, while the perinuclear signal remained constant (B). In larvae expressing zda (D and E) or atg1 (J and K) the GFP-2xFYVE signal did not change after starvation, indicating that autophagic activation of Vps34 was blocked. In larvae expressing atg5 (M and N), starvation-induced activation of Vps34 was normal. Expression of a dominant negative form of Vps34 (vps34) largely suppressed the GFP-2xFYVE signal both under feeding (G) or starving (H) conditions. The insets depict how the GFP-2xFYVE signal was quantified in the perinuclear (within the blue circle) and peripheral regions (between the blue circle and the red line that marks the plasma membrane). The reporter signal (number of foci) was quantified in each of these two regions in at least 20 cells of three independent experiments (C, F, I, L, and O). Data represent mean ± SD. One-tailed, unpaired Student’s t test, p < 0.05. Scale bar: 50 μm. Number of cells counted for each genotype and condition (N): A = 8; B = 12; D = 12; E = 12; G = 9; H = 9; J = 8; K = 9; M = 9; N = 12.
Starvation-induced Vps34 activity requires Zda. Confocal images of fat body cells of fed (A, D, G, J, and M) or starved (B, E, H, K, and N) third instar larvae expressing the PI3P reporter GFP-2xFYVE. white (A and B), zda (D and E), vps34 (G and H), atg1 (J and K), or atg5 (M and N) were coexpressed. In control larvae under feeding conditions, a proportion of the GFP-2xFYVE signal was perinuclear (corresponding to endosomes), while another proportion was more peripheral (autophagosomes) (A). Following starvation, the peripheral signal of the reporter increased significantly, while the perinuclear signal remained constant (B). In larvae expressing zda (D and E) or atg1 (J and K) the GFP-2xFYVE signal did not change after starvation, indicating that autophagic activation of Vps34 was blocked. In larvae expressing atg5 (M and N), starvation-induced activation of Vps34 was normal. Expression of a dominant negative form of Vps34 (vps34) largely suppressed the GFP-2xFYVE signal both under feeding (G) or starving (H) conditions. The insets depict how the GFP-2xFYVE signal was quantified in the perinuclear (within the blue circle) and peripheral regions (between the blue circle and the red line that marks the plasma membrane). The reporter signal (number of foci) was quantified in each of these two regions in at least 20 cells of three independent experiments (C, F, I, L, and O). Data represent mean ± SD. One-tailed, unpaired Student’s t test, p < 0.05. Scale bar: 50 μm. Number of cells counted for each genotype and condition (N): A = 8; B = 12; D = 12; E = 12; G = 9; H = 9; J = 8; K = 9; M = 9; N = 12.
Zonda physically interacts with Atg1, Vps34, and Atg6
Given the above genetic evidence indicating that Zda operates downstream or in parallel to Atg1 and upstream of the Vps34 nucleation complex, we assessed physical interactions of Zda with Atg1 and with elements of the nucleation complex. Using glutathione S-transferase (GST) pull-down assays, we found that Zda binds directly to Atg1, and domain analysis revealed that Zda–Atg1 interaction requires the Atg1 kinase domain (Figure 4, A–C). Deletion of this domain (amino acids 10–280; Figure 4A) completely prevented binding to Zda (Figure 4, B and C). Next we assessed whether Zda also interacts with members of the nucleation complex. Indeed, we detected direct physical interaction of Zda with Vps34 (Figure 4D) and with Atg6 (Figure 4E). Altogether these results suggest that Zda directly interacts with Atg1 and with the components of the nucleation complex Vps34 and Atg6.
FIGURE 4:
Zda binds directly to Atg1B, Atg6, and Vps34 in vitro. (A) Schematic representation of the DmAtg1b domain structure and deletion constructs made to determine domain-mediated binding to Zda. (B) GST pull-down assay using in vitro–translated 35S-labeled Myc-tagged Dm-Atg1B. In vitro–translated full length, or a kinase domain deletion mutant, of Myc-tagged DmAtg1B were incubated with recombinant GST or GST-Zda expressed in E. coli attached to glutathione–sepharose beads and bound protein was detected by autoradiography (AR). The Coomassie-stained SDS–PAGE gel indicates the amount of GST protein used in the assay. The graph displays percentage binding of in vitro–translated protein relative to the input. (C) Similar to B except that in vitro–translated 35S-labeled Myc-tagged Zda was incubated with GST or GST-DmAtg6. Quantifications with mean values and SDs from three independent experiments of the binding assays are shown in the graph bar diagram. (D) Similar to B, except that in vitro–translated 35S-labeled Myc-tagged DmVps34 was incubated with GST or GST-Zda. The graph represents the mean value with SD from three independent experiments.
Zda binds directly to Atg1B, Atg6, and Vps34 in vitro. (A) Schematic representation of the DmAtg1b domain structure and deletion constructs made to determine domain-mediated binding to Zda. (B) GST pull-down assay using in vitro–translated 35S-labeled Myc-tagged Dm-Atg1B. In vitro–translated full length, or a kinase domain deletion mutant, of Myc-tagged DmAtg1B were incubated with recombinant GST or GST-Zda expressed in E. coli attached to glutathione–sepharose beads and bound protein was detected by autoradiography (AR). The Coomassie-stained SDS–PAGE gel indicates the amount of GST protein used in the assay. The graph displays percentage binding of in vitro–translated protein relative to the input. (C) Similar to B except that in vitro–translated 35S-labeled Myc-tagged Zda was incubated with GST or GST-DmAtg6. Quantifications with mean values and SDs from three independent experiments of the binding assays are shown in the graph bar diagram. (D) Similar to B, except that in vitro–translated 35S-labeled Myc-tagged DmVps34 was incubated with GST or GST-Zda. The graph represents the mean value with SD from three independent experiments.
Zonda is required for omegasome formation and localizes at the omegasome
The omegasome has been described in mammals as a membranous structure that forms in association with the ER from where the phagophore emerges (Axe ), so it is considered the earliest distinguishable autophagic structure. We investigated if formation of the omegasome is impaired in zda larvae. The omegasome can be visualized as a ring or omega-shaped structure when labeled with PI3P probes such as FYVE domain constructs fused to fluorescent proteins. Shortly after formation, omegasomes become loaded with the autophagy proteins Atg5 and Atg8 that mark the phagophore, which afterward gives rise to the autophagosome (Axe ; Roberts and Ktistakis, 2013). DFCP1 is a component of mammalian omegasomes and therefore is usually utilized to identify these early autophagy structures (Axe ). In an attempt to visualize Drosophila omegasomes, and given that a DFCP1 homologue does not exist in Drosophila, specific markers for the Drosophila omegasome are not currently available, and considering that human DFCP1 expressed in Caenorhabditis elegans localizes at the worm omegasome (Lu ), we generated a transgenic fly line expressing human DFCP1 fused to GFP on its N-terminus (GFP-DFCP1). As shown in Supplemental Figure S3, the heterologous DFCP1 construct became incorporated into structures reminiscent of mammalian omegasomes, with a ring shape of 0.7 μm diameter on average, which colocalized with the PI3P reporter myc-2xFYVE (Supplemental Figure S3A and Supplemental Movie S1) (Gillooly ). Remarkably, these ring-shaped structures contained a particle of RFP-Atg5 (Supplemental Figure S3B and Supplemental Movie S2) (Barth ) or mCh-Atg8 (Supplemental Figure S3C and Supplemental Movie S3) within the ring—presumably the phagophore budding off—as was previously reported for mammalian omegasomes (Axe ). We therefore conclude that mammalian GFP-DFCP1 labels the Drosophila omegasome.As expected, in control larvae, the occurrence of GFP-DFCP1 foci increased significantly after starvation (Figure 5, A, B, and E), indicating induction of omegasome biogenesis following the autophagic stimulus. Interestingly, this increase was prevented in zda individuals (Figure 5, A, C, and E), consistent with a role of Zda in omegasome formation. Notably, omegasome formation following starvation was prevented to a similar extent in larvae expressing the Vps34 dominant negative construct (Figure 5, A, D, and E). Taken together, these results suggest that Zda plays a role in biogenesis of the omegasome.
FIGURE 5:
Starvation-induced DFCP1 deposition requires Zonda. Confocal images of salivary gland cells of fed (A) or starved (B–D) third instar larvae expressing GFP-DFCP1 (green) and labeled with rhodamine-phalloidin (red). white (A and B), zda (C), or a vps34 (D) were coexpressed. Starvation induced an increase in the number of DFCP1 foci in white larvae, indicating omegasome formation (A and B). Zda silencing (C) or Vps34 activity blockage (D) abolished this increase. The number of GFP-DFCP1 foci per cell was quantified in each condition (E), N = 40. Data represent mean ± SD. Means marked with an asterisk are significantly different. One-way ANOVA followed by a Tukey´s test with a confidence interval higher than 95% (p < 0.05). Scale bar: 20 μm.
Starvation-induced DFCP1 deposition requires Zonda. Confocal images of salivary gland cells of fed (A) or starved (B–D) third instar larvae expressing GFP-DFCP1 (green) and labeled with rhodamine-phalloidin (red). white (A and B), zda (C), or a vps34 (D) were coexpressed. Starvation induced an increase in the number of DFCP1 foci in white larvae, indicating omegasome formation (A and B). Zda silencing (C) or Vps34 activity blockage (D) abolished this increase. The number of GFP-DFCP1 foci per cell was quantified in each condition (E), N = 40. Data represent mean ± SD. Means marked with an asterisk are significantly different. One-way ANOVA followed by a Tukey´s test with a confidence interval higher than 95% (p < 0.05). Scale bar: 20 μm.Given that Zda was required for autophagic activation of Vps34 and omegasome formation (Figures 3 and 5), we performed detailed colocalization analysis of mCh-Zda with ER, omegasome, and phagophore markers. Several lines of evidence suggest that Zda localizes at the omegasome: mCh-Zda formed 0.5- to 1.0-μm-diameter rings or omega-like structures. These structures colocalized with the ER marker GFP-PDI (Figure 6, A and F), with the omegasome marker GFP-DFCP1 (Figure 6, B and F, and Supplemental Movie S4), as well as with GFP-2xFYVE rings (Figure 6, C and F, and Supplemental Movie S5). Interestingly, we detected Zda ring-shaped structures containing a particle of GFP-Atg5 (Figure 6, D and F, and Supplemental Movie S6) or GFP-Atg8 (Figure 6, E and F, and Supplemental Movie S7) budding off from the omegasome, which presumably represents the phagophore. These results suggest that Zda is a novelcomponent of the Drosophila omegasome.
FIGURE 6:
Zonda localizes at the omegasome. Confocal images of fat body cells of starving third instar larvae coexpressing mCh-Zda along with GFP-PDI (A), GFP-DFCP1 (B), GFP-2xFYVE (C), GFP-Atg5 (D), or GFP-Atg8 (E). A magnified view of the omegasomes for each panel is shown in the insets. The percentage of colocalization between Zonda foci and each of the markers is shown in F. Zda formed rings on the ER (A–A″) that colocalized with the omegasome markers GFP-DFCP1 (B–B″) and GFP-2xFYVE (C–C″). Phagophore markers GFP-Atg5 (D) and GFP-Atg8 (E) are observed in the center of Zda-containing rings, which are presumably omegasomes. Scale bar: 5 μm. Number of fields counted for each genotype (N): A = 5; B = 6; C = 7; D = 7; E = 8.
Zonda localizes at the omegasome. Confocal images of fat body cells of starving third instar larvae coexpressing mCh-Zda along with GFP-PDI (A), GFP-DFCP1 (B), GFP-2xFYVE (C), GFP-Atg5 (D), or GFP-Atg8 (E). A magnified view of the omegasomes for each panel is shown in the insets. The percentage of colocalization between Zonda foci and each of the markers is shown in F. Zda formed rings on the ER (A–A″) that colocalized with the omegasome markers GFP-DFCP1 (B–B″) and GFP-2xFYVE (C–C″). Phagophore markers GFP-Atg5 (D) and GFP-Atg8 (E) are observed in the center of Zda-containing rings, which are presumably omegasomes. Scale bar: 5 μm. Number of fields counted for each genotype (N): A = 5; B = 6; C = 7; D = 7; E = 8.It was recently reported that FKBP8/FKBP38, a mammalian membrane immunophilin that is presumably the orthologue of DrosophilaZda, participates in mitophagy (Bhujabal ). We therefore analyzed if Zda remains associated with late autophagy structures in fat body cells of larvae subjected to starvation and found that this was indeed the case. Colocalization studies with GFP-Atg8 or GFP-Lamp revealed that Zda localizes also at autophagosomes and autolysosomes but not at lysosomes (Figure 7, A–F). Consistent with the recent study performed in mammalian cells (Bhujabal ), we observed at high frequency that the mitochondrial marker Mito-GFP appeared within these late Zda-containing autophagy structures (Figure 7, G–I), suggesting that DrosophilaZda might also participate in mitophagy. This set of data suggests that Zda participates in at least two different steps of the autophagy process: First, it is required for omegasome formation and later remains associated with mature autophagy structures.
FIGURE 7:
Zonda localizes at autophagosomes and autolysosomes. Confocal images of fat body cells of starving third instar larvae coexpressing mCh-Zda along with GFP-Atg8 (A and B), GFP-Lamp (D and E), and Mito-GFP (G and H). A magnified view of the structures for each panel is shown in the insets. The percentage of colocalization between Zonda foci and each of the markers is shown in C, F, and I. Zda and Atg8 are part of the same structure at both early and late starvation times. Zonda does not colocalize with GFP-Lamp nor with Mito-GFP-labeled structures at early starvation times, but it does colocalize with these markers at later starvation periods, which indicates that Zonda is not present at lysosomes or mitochondria but is present at autophagosomes and autolysosomes. Scale bar: 10 μm. Number of fields counted for each genotype (N): A = 8; B = 6; D = 4; E = 4; G = 4; H = 5.
Zonda localizes at autophagosomes and autolysosomes. Confocal images of fat body cells of starving third instar larvae coexpressing mCh-Zda along with GFP-Atg8 (A and B), GFP-Lamp (D and E), and Mito-GFP (G and H). A magnified view of the structures for each panel is shown in the insets. The percentage of colocalization between Zonda foci and each of the markers is shown in C, F, and I. Zda and Atg8 are part of the same structure at both early and late starvation times. Zonda does not colocalize with GFP-Lamp nor with Mito-GFP-labeled structures at early starvation times, but it does colocalize with these markers at later starvation periods, which indicates that Zonda is not present at lysosomes or mitochondria but is present at autophagosomes and autolysosomes. Scale bar: 10 μm. Number of fields counted for each genotype (N): A = 8; B = 6; D = 4; E = 4; G = 4; H = 5.
Overexpression of Zonda triggers autophagy
Having established that Zda is required for autophagy and that it can interact with Atg1, we sought to investigate whether, as is the case for Atg1 (Scott ), Zda overexpression can trigger autophagy, and to this end we expressed two copies of mCh-Zda at 25°C in well-fed larvae. TEM analysis revealed that Zda overexpression provoked a dramatic accumulation of autophagic structures in fat body cells of third instar larvae (Figure 8, A, C, and D) and, remarkably, this accumulation was comparable to that observed on starvation of wild-type controls (Figure 8, A–D). Then we assessed autophagy induction by GFP-Atg8 nucleation and LysoTracker staining. Both criteria confirmed autophagy induction (Figure 8, E–G and J, and K–M and P). As a next step, we investigated whether autophagy induction provoked by Zda overexpression was dependent on Atg1 or Vps34, so we overexpressed Zda in an Atg1 null mutant background or in a strain that coexpressed the Vps34 dominant negative construct. Whereas in the Atg1 mutant background Zda-induced autophagy diminished (Figure 8, E–H and J, and K–N and P), the coexpression of Vps34 totally prevented autophagy induction (Figure 8, E–G, I, and J, and K–M, O, and P). These results indicate that Zda-induced autophagy partially requires Atg1 and depends completely on Vps34.
FIGURE 8:
Zonda overexpression induces autophagy. (A–C) Transmission electron microscopy images of fat body cells of control animals under feeding (A) or starved (B) conditions or Zonda-overexpressing feeding larvae (C). The area of autophagic structures per 100 μm2 was quantified (D), N = 3. Scale bar: 1 μm. (E–I) Confocal images of fat body cells of third instar larvae under feeding (E and G–I) or starved (F) conditions. In all cases, the autophagosome marker GFP-Atg8 was expressed under the control of ppl-Gal4 driver. (G–I) Panels G–I also express two copies of a mCh-Zda in wild-type (G), atg1 (H) or vps34 (I) background. (J) Quantification of the number of GFP-Atg8 foci per cell in each of the indicated genotypes. Overexpression of two copies of mCh-Zda is sufficient to induce GFP-Atg8 nucleation (G). This nucleation depends on atg1 (H) and vps34 (I). (K–P) Confocal images of fat body cells of third instar larvae under feeding (K and M–O) or starved (L) conditions. Lysosomal marker (LysoTracker) incorporation was analyzed. (M–O) Panels M–O also express two copies of a mCh-Zda in wild-type (M), atg1 (N), or vps34 (O) background. (P) Quantification of the cell area fraction positive for LysoTracker in each of the indicated genotypes. Overexpression of two copies of mCh-Zda is sufficient to induce LysoTracker incorporation (M). This phenotype depends on atg1 (N) and vps34 (O). Data represent mean ± SD. Means with different number of asterisks are significantly different. One-way ANOVA followed by a Tukey´s test with a confidence interval higher than 95% (p < 0.05). Scale bar: 10 μm. Number of cells counted for each genotype and condition (N): E = 20; F = 21; G = 29; H = 34; I = 20; K = 19; L = 18; M = 28; N = 25; O = 17.
Zonda overexpression induces autophagy. (A–C) Transmission electron microscopy images of fat body cells of control animals under feeding (A) or starved (B) conditions or Zonda-overexpressing feeding larvae (C). The area of autophagic structures per 100 μm2 was quantified (D), N = 3. Scale bar: 1 μm. (E–I) Confocal images of fat body cells of third instar larvae under feeding (E and G–I) or starved (F) conditions. In all cases, the autophagosome marker GFP-Atg8 was expressed under the control of ppl-Gal4 driver. (G–I) Panels G–I also express two copies of a mCh-Zda in wild-type (G), atg1 (H) or vps34 (I) background. (J) Quantification of the number of GFP-Atg8 foci per cell in each of the indicated genotypes. Overexpression of two copies of mCh-Zda is sufficient to induce GFP-Atg8 nucleation (G). This nucleation depends on atg1 (H) and vps34 (I). (K–P) Confocal images of fat body cells of third instar larvae under feeding (K and M–O) or starved (L) conditions. Lysosomal marker (LysoTracker) incorporation was analyzed. (M–O) Panels M–O also express two copies of a mCh-Zda in wild-type (M), atg1 (N), or vps34 (O) background. (P) Quantification of the cell area fraction positive for LysoTracker in each of the indicated genotypes. Overexpression of two copies of mCh-Zda is sufficient to induce LysoTracker incorporation (M). This phenotype depends on atg1 (N) and vps34 (O). Data represent mean ± SD. Means with different number of asterisks are significantly different. One-way ANOVA followed by a Tukey´s test with a confidence interval higher than 95% (p < 0.05). Scale bar: 10 μm. Number of cells counted for each genotype and condition (N): E = 20; F = 21; G = 29; H = 34; I = 20; K = 19; L = 18; M = 28; N = 25; O = 17.To continue with the characterization of Zda-induced autophagy, we wondered as whether autophagy flux is normal following Zda overexpression, and we utilized for this an alternative overexpression method in which a single copy of the transgene was expressed at 29°C. This overexpression method was as efficient as the one utilized above, as revealed by Atg8 nucleation (Supplemental Figure S4, A–D). Interestingly, analysis of the GFP-Ref(2)P reporter demonstrated that the autophagy flux is not stalled (Supplemental Figure S4, E–H), suggesting that autophagy proceeds normally after Zda-dependent induction of the process. We also investigated if Zda overexpression provokes accumulation of omegasomes and found that this was indeed the case, as revealed by increased signal of the omegasome-specific GFP-DFCP1 reporter (Supplemental Figure S4, I–L), as well as by the specific increase of GFP-2xFYVE peripheral puncta (Supplemental Figure S4, M–P). Collectively this set of results indicates that sufficient levels of Zda protein are enough to induce a bona fide autophagy process even in conditions of nutrient abundance, strengthening the notion that Zda operates at early phases of the autophagy cascade.
Zda is a negative regulator of growth and inhibits the TOR pathway
Previous studies in Drosophila larvae demonstrated that Atg1 negatively regulates the TOR pathway, leading to reduction of cell growth (Lee ; Scott ). Given that Zonda is an early component of the autophagy cascade, we sought to investigate its effect on tissue and cell growth. First, we generated zda FLP-FRT (Flippase-Flippase Recognition Target) clones (Newsome ) and observed significant increase of head size (Figure 9, A–C), while thorax size was unaffected. Next we overexpressed Zda in FLP-out clones and observed in the fat body that increased levels of Zda provoked cell size reduction (Figure 9, D and E). These results indicate that Zda is a negative regulator of growth. As a next step, we investigated if Zda can modulate the TOR pathway, so we performed Western blot analysis of phosphorylated S6 kinase (pS6K), a hallmark of TOR pathway activation (Laplante and Sabatini, 2009). As depicted in Figure 9F, pS6K was clearly reduced in larvae that overexpressed Zda. Collectively these results suggest that Zda contributes to restrict cell and organ growth through the inhibition of the TOR pathway.
FIGURE 9:
Zonda is a negative regulator of Tor. (A–C) Representative heads of the indicated genotypes. Mutant heads were generated using eyeless-induced FLP-mediated recombination. Homozygous wild-type cells were eliminated due do the presence of a minute mutation in the recombined chromosome. In comparison to control heads (FRT82, A), zda heads are bigger. As a positive control, tsc heads were generated, and they are also bigger than controls. Numbers inside panels represent the incremental percentage with respect to control heads. The increments are statistically significant, p < 0.05. (D) An example of a fat body containing wild-type and mCh-Zda–overexpressing cells is shown in D. DAPI labels cell nuclei. (E) Quantification of nuclei size of control fat body cells or Zonda-overexpressing fat body cells (UAS-Zda 2x). Zonda overexpressing cells were generated using the flip-out technique. N = 20. Two-tailed, unpaired Student’s t test, p < 0.05. (F) Western blot analysis of larval homogenates overexpressing the indicated UAS constructs using a ppl-Gal4 driver. Membranes were blotted with antibodies against phospho-S6K and tubulin. A representative membrane from three independent experiments is shown. Number of heads counted for each genotype (N): A = 30; B = 35; C = 28. Number of cells counted (N): D = 20.
Zonda is a negative regulator of Tor. (A–C) Representative heads of the indicated genotypes. Mutant heads were generated using eyeless-induced FLP-mediated recombination. Homozygous wild-type cells were eliminated due do the presence of a minute mutation in the recombined chromosome. In comparison to control heads (FRT82, A), zda heads are bigger. As a positive control, tsc heads were generated, and they are also bigger than controls. Numbers inside panels represent the incremental percentage with respect to control heads. The increments are statistically significant, p < 0.05. (D) An example of a fat body containing wild-type and mCh-Zda–overexpressing cells is shown in D. DAPI labels cell nuclei. (E) Quantification of nuclei size of control fat body cells or Zonda-overexpressing fat body cells (UAS-Zda 2x). Zonda overexpressing cells were generated using the flip-out technique. N = 20. Two-tailed, unpaired Student’s t test, p < 0.05. (F) Western blot analysis of larval homogenates overexpressing the indicated UAS constructs using a ppl-Gal4 driver. Membranes were blotted with antibodies against phospho-S6K and tubulin. A representative membrane from three independent experiments is shown. Number of heads counted for each genotype (N): A = 30; B = 35; C = 28. Number of cells counted (N): D = 20.
DISCUSSION
In this work, we describe a previously uncharacterized Drosophila immunophilin named Zonda (Zda) that functions as an upstream positive component of the autophagy cascade. Previously, other immunophilins have been proposed both as positive or negative regulators of autophagy. In Drosophila, FKBP39 was found to be a negative regulator of developmentally triggered autophagy, possibly through the regulation of the transcription factor Foxo (Juhasz ). Mammalian FKBP51 was described as a scaffold protein that recruits PHLPP, Akt, and Beclin1, leading to activation of autophagy (Albu ). More recently, FKBP38 has been reported as a mitophagy receptor that interacts with LC3. Coexpression of FKBP38 along with LC3 can trigger Parkin-independent mitophagy (Bhujabal ).Based on sequence homology, Zda is the likely orthologue of FKBP38. Not only do they share characteristics domains of FKBP proteins (Kang ), but both proteins are the only members of their families to have a transmembrane domain on their C-terminal end. We have shown that Zda is required for starvation-induced autophagy. Larval fat body cells in which Zda expression has been silenced fail to trigger autophagy, as assessed by several independent criteria: 1) inability of the cells to form autophagosomes and autolysosomes after starvation, as assessed by TEM and Atg8 nucleation; 2) their inability to increase the number and size of lysosomes, as evaluated by LysoTracker and GFP-Lamp markers; and 3) accumulation of Ref(2)P in these cells, which is indicative of impaired autophagic flux.We have found that, after nutrient deprivation, Zda can be detected in omegasomes, colocalizing with PI3P and DFCP1, from which early autophagic structures labeled with GFP-Atg5 and GFP-Atg8 bud off. Consistent with the notion that Zda is an early component of the autophagy cascade, our genetic analysis revealed that starvation-induced Zda nucleation depends fully on components of the Atg1 induction complex but not on components of the Vps34 nucleation complex. Vps34 autophagic activation following starvation is regulated by the nutritional status of the cell downstream of Atg1 (Juhasz ). We found that Zda interacts physically with the Atg1 kinase domain, as well as with components of the nucleation complex, including Atg6 and Vps34, suggesting that it may contribute to the activation of the latter complex by Atg1. This notion is consistent with the results of our genetic experiments utilizing early autophagy markers, as they suggest that autophagy-dependent Vps34 activation and omegasome formation are dependent on Zda, this dependence being comparable to that on Atg1. Unlike Atg6, which was shown to be also required for Vps34 basal activity (Shravage ), Zda is clearly not necessary for early endosome formation but only for autophagic activation of Vps34. Thus, given the requirement of Zda for Vps34 autophagy-specific activation, and based on its localization at the omegasome, we propose that Zda contributes to define the location on the ER at which Vps34-dependent PI3P deposition and omegasome formation take place (Figure 10).
FIGURE 10:
Model for the mode of action of Zonda in omegasome formation. From left to right: Shortly after starvation Zda nucleates on the ER and the Zda-labeled sites function as platforms for Vps34-dependent PI3P deposition. ER domains enriched in PI3P evolve into ring-shaped omegasomes from which phagophores containing Atg5 and Atg8 bud off.
Model for the mode of action of Zonda in omegasome formation. From left to right: Shortly after starvation Zda nucleates on the ER and the Zda-labeled sites function as platforms for Vps34-dependent PI3P deposition. ER domains enriched in PI3P evolve into ring-shaped omegasomes from which phagophores containing Atg5 and Atg8 bud off.Induction of autophagy depends on the nutritional status of the cell and is subject to a contra-regulatory mechanism that occurs between mTOR and Atg1 (Chen and Klionsky, 2011). Under nutrient-rich conditions, active mTOR phosphorylates and inactivates the Atg1 complex (Chang and Neufeld, 2009; Kamada ; Kishi-Itakura ), and when nutrients are scarce, mTOR-dependent inactivation of Atg1 is released. Atg1 in turn reinforces down-regulation of mTOR through mechanisms that remain poorly defined (Chang and Neufeld, 2009). In line with this, Drosophila fat body cells that are mutant for atg1 grow bigger than control cells when subjected to prolonged nutrient deprivation, and conversely, Atg1 overexpression provokes cell size reduction and induces autophagosome formation (Chang and Neufeld, 2009). We have shown here that when overexpressed above certain levels, Zda can trigger a bona fide autophagic process, as assed by several indicators, including TEM, Atg8 nucleation, and LysoTracker incorporation. We have shown that this autophagic response fully depends on the activity of Vps34 and partially on Atg1. This suggests that Zonda operates upstream of Vps34 and in parallel to Atg1. Consistent with this, we observed that under the same overexpression conditions, the TOR pathway is down-regulated and cell size is reduced similarly to what has been reported for Atg1 (Lee ; Scott ). In line with these observations, adult flies that are homozygous for a Zda null mutation specifically in the head exhibit larger heads. Thus Zda mediates negative regulation of TOR, thereby exerting cell-autonomous negative regulation of growth.Given that immunophilins are known to work as chaperons or scaffolds (Kang ), we propose that Zda might provide a platform where Atg1 and the Vps34 complex interact. Further research is required to define the mechanism by which Zda cooperates with Atg1 on the activation of the Vps34 nucleation complex that culminates in localized PI3P deposition for omegasome formation.
MATERIALS AND METHODS
Fly stocks
Flies were raised at 25°C on standard cornmeal/agar medium. In all experiments, larvae were sorted 24 h after egg deposition. Thirty to 40 larvae were grown per vial for each experimental condition at 25°C or 29°C depending on the experiment. When required, larvae were starved for the indicated periods of time on agar plates. The following D. melanogaster lines were from the Bloomington Stock Center (http://flystocks.bio.indiana.edu): w (BL 3605), actin-Gal4 (BL 4414), pumpless-Gal4 (ppl-Gal4) (BL58768), UAS-GFP-2xFYVE (BL42712), UAS-GFP-PDI (BL 6839), UAS-GFP-Atg5 (BL 50877), UAS-mito-GFP (BL 25747), UAS-GFP-Rab5 (BL 43336), white (BL 33613), atg17(BL36918) atg14(BL40858) Vps15(BL34092), Vps34 (BL33384), and FRT42D. zda (v110620), atg1 (v16133), atg13 (v103381), and atg6 (v22123) were from the Vienna Drosophila RNAi Center (VDRC, http://stockcenter.vdrc.at). UAS-Atg1, UAS-GFP-Atg8, UAS-mCherry-Atg8, UAS-GFP-Ref(2)P, and UAS-Vps34 were kindly provided by Thomas Neufeld (University of Minnesota, Minneapolis) (Juhasz ); UAS-GFP-LAMP was provided by Helmut Kramer (University of Texas Southwestern Medical Center, Dallas) (Pulipparacharuvil ); UAS-GFP-Rab7 and UAS-myc-2xFYVE were provided by Marcos González-Gaitán (University of Geneva, Switzerland) (Entchev ); UAS-RFP-Atg5 was kindly gifted by Katja Koehler (Institute of Molecular Systems Biology, ETH Zurich) (Barth ); UAS-Rheb and TSCQ87X (Tsc) were kindly provided by Sean Oldham (Sanford-Burnham Medical Research Institute, La Jolla, CA) (Tapon ); UAS-mCh-Zda and UAS-GFP-DFCP1 lines were generated by germline transformation.
Cloning and transgenic lines generation
Zonda locus was analyzed using FlyBase genome browser (www.flybase.org). Assembly PCR was used to generate a fusion between the coding sequences of mCherry and Zda, with the following primers:Zda Fw: CACCATGGATACGGAGAAGTCTAGCAGCAGCZda Rv: TTAGTACTTGTAACGATAAATAGCCACGCZda -mCherry tail Fw: CTGTACAAGATGGATACGGAGAAGTCTAGCAGCAGCmCherry Fw: CACCATGGTGAGCAAGGGCGAGGAGGATCherry Rv-Zda tail: CGTATCCATCTTGTACAGCTCGTCCATGCCGCCGGTThe amplified fragments were subcloned into a pENTR/D-Topo plasmid and then transferred to a pUASg destination vector. Transgenic lines bearing the UAS-mCh-Zonda construct was generated by transposase-mediated genome integration (Spradling and Rubin, 1982).UAS-GFP-DFCP1 was generated by cloning the GFP-DFCP1 sequence into pUAST from a previously described plasmid (Axe ), kindly provided by Nicholas Ktistakis (University of Cambridge).
RT–PCR
Total RNA was isolated from embryos of the desired genotypes using the Trizol Reagent (Invitrogen). Genomic DNA was cleared out from RNA samples using the Ambion’s DNA-free kit. cDNA was synthesized from 1–1.5 μg of RNA using oligo-dT as a primer and SuperScript III First-Strand Synthesis System (Invitrogen). RT–PCR was performed using Taq DNA polymerase (Invitrogen) and SYBRGreen and ROX (Invitogen) as fluorescent dyes. Three independent biological samples were analyzed in each experiment. The following primers were used:Zda Fw: GTACAGACGTGCCCTCGACTTTCTZda Rv: GTCACTGTTCGAGAGCTCCAAGTCTTub Fw: ATCCCCAACAACGTGAAGACTub Rv: GCCTGAACATAGCGGTGAAC
Tissue staining, visualization, and image processing of Drosophila tissues
Third instar larvae were dissected in phosphate-buffered saline (PBS) and fixed in 4% formaldehyde (Sigma) for 2 h (fat body) at room temperature, washed three times in PBS-0.1% Triton X-100, and mounted in 40% glycerol for direct visualization of tissues. When needed, 300 nM 4′,6-diamidine-2-phenylindole (DAPI) was added to the first washing step.For LysoTracker staining, the reagent was added to unfixed tissues and directly visualized as previously described (Scott ). Tissues were imaged using a Zeiss confocal microscope LSM 710, using a 20× or 63× Zeiss Plan-Apochromat objective (NA 1.0 and 1.4, respectively) or a 40× Zeiss Plan-Neofluor objective (NA 1.3). When needed images were deconvoluted using Huygens Professional deconvolution software from Scientific Volume Imaging. Omegasome three-dimensional reconstructions were performed with Imaris software from Bitplane (Oxford Instruments), using confocal Z-stacks comprising up to 32 optical slices. For counting GFP-2xFYVE foci in Figure 3, a threshold was set using ImageJ to eliminate background signal. The cells were divided in two regions: a perinuclear region of 5 μm around the nuclei and a peripheral region in between the border of the cell and the perinuclear region (red and blue lines, respectively).
Transmission electron microscopy
Larvae were dissected and fixed overnight at 4°C using 2.5% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4, followed by postfixation in 1% osmium tetroxide for 1 h. Samples were stained overnight at 4°C in 2% uranyl acetate and dehydrated with ethanol. Next, samples were embedded in Epoxy resin (Durcupan) and 60- to 70-nm sections were cut. Images were obtained using a transmission electron microscope (TEM-Zeiss-EM109T) and photographed on a Gatan ES1000W digital camera. A total of 20–30 12,000× magnification images were taken randomly from at least three animals per genotype, and the area of autophagic structures was manually encircled for area quantification with the ImageJ software.
Protein homogenates and Western blot analysis
Twenty larvae of the indicated genotype were homogenized in 200 μl of lysis buffer (50 mM HEPES, pH 7.4, 150 mM KCl, 6.5% glycerol, 0.5 mM dithiothreitol [DTT], 0.1% Triton X-100, and complete protease inhibitor tablet [Roche]). Samples were spun at 10,000 × g for 10 min at 4°C. Proteins were quantified in the supernatant using the bicinchininic acid (BCA) method. Proteins (40 mg) were separated in 10% polyacrylamide gel and transferred to a nitrocellulose membrane. Membrane was blocked with 5% milk in TBS buffer with 0.1% Tween. Membranes were incubated overnight at 4°C with primary antibodies (anti-Drosophila phospho-S6K, cell signaling). Blots were incubated in goat anti–rabbit-HRP secondary antibody and diluted 1:30,000 in 3% milk/TBST (Tris buffered saline tween) for 1 h at room temperature. Blots were washed in TBST and then incubated with enhanced chemiluminescence (ECL) reagent (GE Healthcare), and signal was detected using ImageQuant LAS 4000 (GE Healthcare).
Cloning and construction of plasmids
Plasmids were made using the Gateway recombination system from Invitrogen. Full-length cDNA clone of Zonda was obtained from the DNASU plasmid repository, Arizona State University (Clone ID:DmCD00768948). Specific deletion mutations were generated by using QuickChange site-directed mutagenesis strategy (Stratagene, 200523). Full-length construct of DmVps34 was a kind gift from Tor Erik Rusten, Department of Molecular Cell Biology, Institute for Cancer Research, Oslo University Hospital, Norway. Vps34 cDNA was subcloned into a Gateway compatible entry vector by traditional restriction digestion-based cloning. All plasmids were verified by restriction digestions and DNA sequencing (BigDye Applied Biosystems, 4337455). Oligonucleotides used for mutagenesis and sequencing were obtained from Invitrogen.
Recombinant protein production and GST pull down
GST or GST tagged protein were expressed in Escherichia coli strain BL21 (DE3). GST or GST fusion proteins were purified and immobilized on glutathione–sepharose 4 Fast Flow beads (GE Healthcare, 17-5132-01). Myc-tagged proteins of interest were translated in vitro using TNT T7 coupled reticulocyte lysate system (Promega) in the presence of 35S-labeled methionine. In vitro–translated proteins were preincubated with 10 µl of glutathione–sepharose beads with 100 µl of NETN buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40) with cOmplete Mini EDTA-free protease inhibitor cocktail (1 tablet/10 ml) (11836170001; Roche Applied Science) for 30 min to reduce unspecific binding. Preincubated lysate was then incubated with the immobilized GST fusion protein for 2 h at 4°C. Beads were washed five times with NETN buffer, boiled with 2X SDS gel loading buffer (125 mM Tris, pH 6.8; 4% SDS, 0.04% bromophenol blue, 8% sucrose, 100 mM DTT), and subjected to SDS–PAGE. Gels were stained with Coomassie brilliant blue to visualize GST fusion proteins and vacuum dried. Signals from 35S-labeled protein were detected using a Fujifilm bioimaging analyzer BAS-5000 (Fuji). Signals from 35S-labeled protein were measured as units of photostimulated luminescence and quantitated relative to those obtained for 10% or 5% of the in vitro–translated lysate.
Statistical analysis
Unless indicated otherwise, statistical significance was calculated using one-way analysis of variance (ANOVA) followed by a Tuckey’s test with a 95% confidence interval (p < 0.05). When needed Grubb’s test was used to identify the values that were significant outliers from the rest (p < 0.05) (https://graphpad.com/quickcalcs/grubbs2/). Normality was tested with Shapiro Wilks’ test and Q-QPlot. When needed, data were transformed to log(n+1) or to square root to reach normality. Homoscedasticity was tested with Bartlett’s test. When necessary, the variances were modeled on VarIdent function using the smaller AIC criteria. Statistical analyses were executed using Rstudio, version 3.3.1. In all cases, error bars represent the SD. Each experiment was repeated at least three times. N indicates the number of cells or fields counted.
Authors: Suprabha Pulipparacharuvil; Mohammed Ali Akbar; Sanchali Ray; Evgueny A Sevrioukov; Adam S Haberman; Jack Rohrer; Helmut Krämer Journal: J Cell Sci Date: 2005-07-26 Impact factor: 5.285
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391