| Literature DB >> 28868270 |
Hossein Jalali1, Mohammad Reza Mahdavi2, Najmeh Zaeromali3.
Abstract
Torque Teno virus (TTV) is a transfusion transmitted virus that seems to be involved in several complications such as acute respiratory diseases, liver diseases, AIDS, cancer, and autoimmune reactions. In the present study the frequency of TTV was investigated among β- thalassemia (BT) and haemodialysis (HD) patients (high risk patients for TTV) in Mazandaran province, Iran. DNA was extracted from the serum of 82 BT and 100 HD patients, and nested PCR method was applied to detect TTV DNA. The aspartate transaminase(AST) and alanine transaminase (ALT) enzyme levels in BT patients were measured using photometric assay. The mean age of BT and HD patients as 23.4±5.4 and 48.8±8.2 years, respectively. 21% of HD and 26.8% of BT patients were infected with TTV, respectively. The frequency of TTV was not significantly different between two groups of patients and there was no significant correlation between sex and TTV infection. The mean AST and ALT levels in TTV positive BT patients was not significantly higher than TTV negative cases. The present study showed that TTV prevalence in BT patients with recurrent blood transfusion was not significantly higher than HD patients. The investigation of TTV prevalence in healthy individuals is recommended to identify if transfusion or dialysis is associated with higher TTV infection. Besides, although TTV infection did not change the AST and ALT enzymes in BT patients, the liver involvement may still exist in these patients.Entities:
Keywords: Torque Teno virus (TTV); haemodialysis; β-thalassemia
Year: 2017 PMID: 28868270 PMCID: PMC5568193
Source DB: PubMed Journal: Int J Mol Cell Med ISSN: 2251-9637
The sequence of primers used for TTV DNA detection
|
|
|
| |
|---|---|---|---|
| First round of PCR | 320 | NS1 | GGGTGCCGAAGGTGAGTTTAC |
| NS2 | GCGGGGCACGAAGCACAGAAG | ||
| Second round of PCR | 295 | NS3 | AGTTTACACACCGAAGTCAAG |
| NS4 | AGCACAGAAGCAAGATGATTA |
Frequency of TTV infection between BT patients with multiple transfusion and HD patients
|
|
|
| |||||||
|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
|
|
| ||
| BT patients (n=82) | 23.4±5.4 | 10 | 12 | 22.00±12 | 20.7±16 | 28 | 32 | 29.6±17 | 31.6±25 |
| HD patients (n=100) | 48.8±8.2 | 9 | 12 | NI | NI | 32 | 47 | NI | NI |
AST: aspartate transaminase; ALT: alanine transaminase; SD: standard deviation; NI: not investigated; TTV= Torque Teno virus.