| Literature DB >> 28868269 |
Meysam Hasannejad Bibalan1, Morteza Eshaghi1, Mahdi Rohani2, Mohammad Reza Pourshafie1, Malihe Talebi1.
Abstract
Lactobacillus species play a major role in gastrointestinal (GI) tract function, intestinal microbiota balance, and the immune system activity by exerting a strong activity against many intestinal pathogens. The aim of this study was to isolate Lactobacillus species from fecal samples, investigate their antimicrobial properties, and characterize their bacteriocin encoding genes. 48 fecal samples were grown in MRS broth and then MRS agar. The colonies grown in MRS agar were selected and identified by PCR. 72 Lactobacillus species were obtained from 434 lactic acid bacteria (LAB) strains. Approximately 40% of all Lactobacillus isolates had antimicrobial activity against one or more microorganisms and 17.4% of them were active against all four indicator bacteria. The frequency of bacteriocin encoding genes were 5 (6.9%), 3 (4.1%) and 5 (6.9%) for Gassericin A, Plantaricin S and Laf operon, respectively. pH alteration had no effect on antibacterial activity, but in the alkaline range these activities were reduced and the strains showed the highest antibacterial activity after 48 h incubation. These data indicate that the majority of isolates were susceptible to GI tract or belonged to other bacterial forms such as viable but nonculturable (VBNC). The detection of bacteriocin encoding genes in about only 6% of all Lactobacillus isolates seems to be due to the existence of many other bacteriocin encoding genes in Lactobacillus species which were not tested. Further study of the bacteriocin gene clusters, types, subtypes and the probiotic effect of these strains will contribute to a better characterization of these isolates.Entities:
Keywords: Lactobacillus; antibacterial activity; bacteriocin genes; healthy individual
Year: 2017 PMID: 28868269 PMCID: PMC5568192
Source DB: PubMed Journal: Int J Mol Cell Med ISSN: 2251-9637
Primers for bacteriocin genes
|
|
|
|
|
|
|
|---|---|---|---|---|---|
| (6) | 800 | 62 | GAACAGGTGCACTAATCGGT | gas F | Gassericin A |
| CAGCTAAGTTAGAAGGGGCT | gas R | ||||
| (13) | 184 | 52 | AGTCGTTGTTGGTGGAAGAAAT | F | Laf |
| TCTTATCTTGCCAAAACCACCT | R | ||||
| (7) | 320 | 60 | GCCTTACCAGCGTAATGCCC | pln F | Plantaricin S |
| CTGGTGATGCAATCGTTAGTTT | pln R |
Determination of Lactobacillus antibacterial activity
|
|
|
|
|---|---|---|
| Enteropathogenic | 34 (47.2) | 37 (51.3) |
| Enteroaggregative | 32 (44.4) | 35 (48.6) |
|
| 28 (38.8) | 27 (37.5) |
|
| 24 (33.3) | 30 (41.6) |
Fig. 1PCR product of Lactobacillus bacteriocin genes. M: 100 bp DNA ladder; C-: negative control; lane 1 through 3 represent Pln, Laf and Gas genes, respectively