| Literature DB >> 28794046 |
Catherine Vancsok1, M Michelle D Peñaranda1, V Stalin Raj1,2, Baptiste Leroy3, Joanna Jazowiecka-Rakus1,4, Maxime Boutier1, Yuan Gao1, Gavin S Wilkie5, Nicolás M Suárez5, Ruddy Wattiez3, Laurent Gillet1, Andrew J Davison5, Alain F C Vanderplasschen6.
Abstract
Virion transmembrane proteins (VTPs) mediate key functions in the herpesvirus infectious cycle. Cyprinid herpesvirus 3 (CyHV-3) is the archetype of fish alloherpesviruses. The present study was devoted to CyHV-3 VTPs. Using mass spectrometry approaches, we identified 16 VTPs of the CyHV-3 FL strain. Mutagenesis experiments demonstrated that eight of these proteins are essential for viral growth in vitro (open reading frame 32 [ORF32], ORF59, ORF81, ORF83, ORF99, ORF106, ORF115, and ORF131), and eight are nonessential (ORF25, ORF64, ORF65, ORF108, ORF132, ORF136, ORF148, and ORF149). Among the nonessential proteins, deletion of ORF25, ORF132, ORF136, ORF148, or ORF149 affects viral replication in vitro, and deletion of ORF25, ORF64, ORF108, ORF132, or ORF149 impacts plaque size. Lack of ORF148 or ORF25 causes attenuation in vivo to a minor or major extent, respectively. The safety and efficacy of a virus lacking ORF25 were compared to those of a previously described vaccine candidate deleted for ORF56 and ORF57 (Δ56-57). Using quantitative PCR, we demonstrated that the ORF25 deleted virus infects fish through skin infection and then spreads to internal organs as reported previously for the wild-type parental virus and the Δ56-57 virus. However, compared to the parental wild-type virus, the replication of the ORF25-deleted virus was reduced in intensity and duration to levels similar to those observed for the Δ56-57 virus. Vaccination of fish with a virus lacking ORF25 was safe but had low efficacy at the doses tested. This characterization of the virion transmembrane proteome of CyHV-3 provides a firm basis for further research on alloherpesvirus VTPs.IMPORTANCE Virion transmembrane proteins play key roles in the biology of herpesviruses. Cyprinid herpesvirus 3 (CyHV-3) is the archetype of fish alloherpesviruses and the causative agent of major economic losses in common and koi carp worldwide. In this study of the virion transmembrane proteome of CyHV-3, the major findings were: (i) the FL strain encodes 16 virion transmembrane proteins; (ii) eight of these proteins are essential for viral growth in vitro; (iii) seven of the nonessential proteins affect viral growth in vitro, and two affect virulence in vivo; and (iv) a mutant lacking ORF25 is highly attenuated but induces moderate immune protection. This study represents a major breakthrough in understanding the biology of CyHV-3 and will contribute to the development of prophylactic methods. It also provides a firm basis for the further research on alloherpesvirus virion transmembrane proteins.Entities:
Keywords: alloherpesvirus; cyprinid herpesvirus 3; herpesvirus; proteome
Mesh:
Substances:
Year: 2017 PMID: 28794046 PMCID: PMC5640863 DOI: 10.1128/JVI.01209-17
Source DB: PubMed Journal: J Virol ISSN: 0022-538X Impact factor: 5.103
Proteins identified by 2D LC-MS/MS in purified CyHV-3 virions
Data are restricted to CyHV-3 proteins detected by SDS-PAGE and LC-MS/MS in at least two of the three independent preparations of purified virions. Predicted transmembrane proteins are shaded in gray. Protein features were based on previous publications (6, 9) or predictions made using TMHMM, SignalP, NetNGlyc 1.0, and the NetOGlyc 3.1 server from the CBS web site. Similarity and domain analyses were performed by BLASTP N-glyco and O-glyco, number of N glycosylations and O glycosylations, respectively.
No transmembrane domain was detected by software prediction. This sample was classified as a putative type 1 transmembrane protein on the basis of significant similarity to previously studied viral membrane proteins.
FIG 1CyHV-3 virion proteome. Schematic representation of CyHV-3 virion-associated proteins identified in independent studies: upper circle, analyses of the European FL strain performed in the present study; lower left circle, analyses of the FL strain performed in a former study (9); and lower right circle, analyses of two Chinese strains (GZ10 and GZ11) (10). Numbers represent CyHV-3 ORFs. Asterisks indicate viral proteins that were detected in only one of the two Chinese isolates. Predicted transmembrane proteins are underlined.
FIG 2Production of CyHV-3 recombinants to identify essential and nonessential VTPs. Deleted recombinant plasmids were produced for each ORF predicted to encode a VTP (FL BAC ORFX Del galK plasmids, with “X” standing for the number of the ORFs tested; these included ORF25, ORF32, ORF59, ORF64, ORF65, ORF81, ORF83, ORF99, ORF106, ORF108, ORF115, ORF131, ORF132, ORF136, ORF148, and ORF149). The effect of the deletion on the ability of the BAC plasmid to reconstitute infectious virus was tested by transfection into permissive CCB cells. Subsequently, for each gene identified as essential, two additional recombinant plasmids were produced to revert to wild-type ORFX sequence (FL BAC ORFX Rev1) or to insert a nonsense mutation (FL BAC ORFX NS). Plasmids were transfected into CCB cells to determine their ability to induce reconstitution of infectious virus. As an additional revertant control, FL BAC ORFX NS plasmids were cotransfected into CCB cells together with a fragment encoding the WT sequence of ORFX and flanking regions, in order to facilitate reversion to wild-type ORFX sequence by recombination in eukaryotic cells (FL BAC ORFX Rev2). To simplify the reading of the manuscript, some recombinants were given a short name (in red). The right part of the Fig. summarizes the genotype of the strains for ORF55 (TK) and ORFX. Del, deleted; WT, wild type; BAC, presence of the BAC cassette in the 3′ end of ORF55.
FIG 3Effect of deleting genes encoding VTPs on the ability of CyHV-3 FL BAC recombinant plasmids to reconstitute infectious virus. CCB cells were transfected with the plasmids indicated. At 2 and 4 dpi, the cells were examined by epifluorescence microscopy (the BAC cassette encodes EGFP). Scale bar, 1 mm. Plasmids able or not able to reconstitute infectious virus are labeled in green or red, respectively.
FIG 4Testing plasmids recombinant for CyHV-3 ORFs predicted to encode essential VTPs. For ORFs identified as essential in Fig. 3, additional recombinant plasmids (ORFX Rev1 and ORFX NS) were produced (see Fig. 2, description in the rectangular frame) and tested for their ability to reconstitute infectious virus after transfection into CCB permissive cells. At 6 days posttransfection, the cells were examined by epifluorescence microscopy for detection of EGFP. Scale bar, 1.5 mm.
Polymorphisms observed among CyHV-3 strains in ORFs encoding VTPs
| Gene | Requirement in FL strain | Mutation |
|---|---|---|
| ORF32 | Essential | No mutation |
| ORF59 | Essential | No mutation |
| ORF81 | Essential | No mutation |
| ORF83 | Essential | Several aa inserted in M3, T, and J |
| ORF99 | Essential | Several aa changed in KHV-I, M3, T, and J |
| ORF106 | Essential | No mutation |
| ORF115 | Essential | One aa changed in T |
| ORF131 | Essential | One aa changed in KHV-I, FL, Cavoy, and T |
| ORF25 | Nonessential | Several aa inserted in M3, T, J, and GZ11 |
| ORF27 | Nonessential | |
| ORF64 | Nonessential | |
| ORF65 | Nonessential | One aa deleted in KHV-I, FL, Cavoy, I, and E; one aa inserted and several aa deleted in M3, T, and J; one aa changed in GZ11 |
| ORF108 | Nonessential | One aa inserted, one aa changed and |
| ORF132 | Nonessential | One aa changed in KHV-I |
| ORF136 | Nonessential | Several aa inserted and |
| ORF148 | Nonessential | Several aa inserted in KHV-I, Cavoy, and GZ11; Several aa deleted in M3, T, and J |
| ORF149 | Nonessential | One aa changed in KHV-I, Cavoy, and E, 13 aa inserted in M3 and J |
Boldfacing indicates mutations that create an in-frame stop codon or frameshift. aa, amino acid(s).
FIG 5Effects of deleting nonessential VTPs on CyHV-3 growth in vitro. (A) Multistep growth curves. CCB cells were infected with the viruses indicated and the titer (PFU/ml) in the cell supernatant was determined at the indicated time points postinfection. Data presented are the means ± the standard errors of the mean (SEM) of triplicate measurements. Significant differences between the deleted viruses and the TK BAC virus were tested by using two-way ANOVA, taking genotype and time postinfection as variables. (B) Plaque size assay. CCB cells were infected with the viruses indicated, and plaque areas were measured over time. The data presented are means ± the SEM for the measurement of 25 randomly selected plaques. Two-way ANOVA was used to test the significance of the results, taking genotype, time postinfection, and interaction between genotype and time postinfection as variables (*, P < 0.05; **, P < 0.01; ***, P < 0.001).
FIG 6Effect of deleting genes encoding nonessential VTPs on CyHV-3 virulence. The virulence of the indicated recombinant viruses was tested in carp (triplicate groups each consisting of 15 subjects; average weight, 1.90 ± 0.68 g, and average age, 3 months old). On day 0, fish were infected for 2 h by immersion in water containing 800 PFU/ml or mock infected. Survival rate was measured over a period of 30 days. The nine upper panels show the survival curves observed for replicates. The lower panel shows the mean survival curves based on the three replicates.
FIG 7PCR detection and characterization of CyHV-3 genomes recovered from infected dead carp. DNA was extracted from the gills of three dead carp from each of the groups infected with the recombinant viruses deleted for a nonessential gene (TK BAC ΔORFXgalK) during the course of the experiment described in the legend of Fig. 6. In the TK BAC Δ25galK infections, no fish died, and hence three fish were selected randomly from among the living fish at 30 dpi. A carp infected with TK BAC virus and a mock-infected carp were used as positive and negative PCR controls, respectively. PCRs were performed with the appropriate ORFXintfw/ORFXintrev primer pair and with the ORF112intfw/ORF112intrev primer pair. The images are photographs of agarose gels. The numbers on the left of each panel are marker sizes (bp). NC, negative control.
FIG 8Flow chart of the production of CyHV-3 recombinants deleted for ORF25 or ORF56-57. Recombinants were given a short name (in red) for use in the text. Viral genotypes for ORF55 (TK), ORF25, and ORF56-57 are given on the right. Del, deleted; WT, wild type.
FIG 9Effect of ORF25 deletion on viral tropism according to qPCR analysis. At time zero, carp (average weight, 6.10 g ± 1.39 g; average age, 6 months old) were infected for 2 h by immersion in water containing the virus indicated at 800 PFU/ml and then returned to larger tanks. At the indicated time points, fish were sampled and submitted to qPCR analysis. The data obtained for each fish (according to viral genotype and time postinfection) are represented by the same symbol to allow correlation of the data obtained for the two tested organs. The number of viral genome copies is expressed as the log10 per 106 carp glucokinase gene copies. Individual values represent the mean of duplicate measurements. Mock-infected fish were used as a negative control and no viral genome copies were detected in these fish. The number of positive fish among six analyzed fish is represented by gray bars. Viral charges [viral genome copies/106 carp glucokinase gene copies (log10)] were compared using one-way ANOVA taking the viral genotype as a variable.
FIG 10Testing of Δ25galK and Δ56-57 deletion recombinants as attenuated recombinant vaccine candidates. The virulence of the recombinant viruses indicated was first tested in carp (first line of graph: four replicates per condition; n = 20 fish; average weight, 2.42 ± 0.95 g; average age, 6 months old). On day 0, fish were mock infected or infected for 2 h by immersion in water containing 40 (dotted line) or 400 (continuous line) PFU of virus/ml. The survival rate was measured over a period of 42 days. The immune protection conferred by primary infection was then tested for Δ25galK and Δ56-57-infected fish at 42 dpi by distributing mock-infected fish and fish that survived the primary infection into duplicate tanks (n = 20) and challenging them by cohabitation with fish infected with the M3 strain (middle line of graphs) or the FL strain of CyHV-3 (lower line of graphs). The survival rate was measured according to time postchallenge.
Oligonucleotide primers
| Analysis | Primer | Sequence (5′–3′) | Coordinates or accession no. |
|---|---|---|---|
| Synthesis of inserts | |||
| CyHV-3 ORF25 | ORF25outF | CCTCCGACTCTGAAGACGAT | 45389–45408 |
| ORF25outR | GGTACGTGATGCTGTAGAAG | 47569–47588 | |
| CyHV-3 ORF32 | ORF32outF | CCAGGTCCAGGCAGTCTC | 54216–54233 |
| ORF32outR | ATGCGCGTCTACAAGATCG | 55619–55601 | |
| CyHV-3 ORF59 | ORF59outF | GACGCCTGTCTCTGGTAGA | 101541–101559 |
| ORF59outR | GCGTCTCCAAAAAGAGCGG | 102941–102923 | |
| CyHV-3 ORF64 | ORF64outF | GTCGAGATATCCGAGGCAGA | 119716–119735 |
| ORF64outR | TTCATAGCCACAACCGGAGT | 122203–122184 | |
| CyHV-3 ORF65 | ORF65outF | TGGAGAACATCAAGCAGCAC | 121920–121939 |
| ORF65outR | GAAGTCTGAAACTGTCTGAATG | 124106–124127 | |
| CyHV-3 ORF81 | ORF81outF | GGTTTAGTCCAAATCCGACCT | 150519–150539 |
| ORF81outR | GCAGCTTCTGCTTCAGAGTG | 152023–152004 | |
| CyHV-3 ORF83 | ORF83outF | ACACGCTGATGGTCACGAG | 152549–152567 |
| ORF83outR | ACACCAACCAGTTCGTGCAG | 153638–153619 | |
| CyHV-3 ORF99 | ORF99intF | GCTTAGCCTGTTCGGCAC | 184445–184462 |
| ORF99intR | AAGATCTGGGACACGGACTG | 185515–185496 | |
| CyHV-3 ORF106 | ORF106outF | GCTGACACCTGTCACAACCA | 195629–195648 |
| ORF106outR | TCGTGAGGACAAACCGTCTC | 196189–196170 | |
| CyHV-3 ORF108 | ORF108outF | GATGATGAAGGGTGTTCATG | 201067–201086 |
| ORF108outR | CATCTACAAGTCGGACAACC | 201937–201956 | |
| CyHV-3 ORF115 | ORF115outF | CACGTAAACGAAGCCCCATA | 207951–207970 |
| ORF115outR | ATTCGTGGCGGCTGTTATAC | 210734–210715 | |
| CyHV-3 ORF131 | ORF131outF | GCCCTGGTCCTCGTACTTTT | 224971–224990 |
| ORF131outR | CTGATCAGATTCTCAGGAGCAG | 227271–227250 | |
| CyHV-3 ORF132 | ORF132outF | GCTCCTGAGAATCTGATCAG | 227252–227271 |
| ORF132outR | GTTAATGGTCACAGAAGCGC | 228155–228174 | |
| CyHV-3 ORF136 | ORF136outF | GTGTCAAGTACGTGGAGCGT | 231157–231176 |
| ORF136outR | GGCCTCTGAATGTGTTATTGC | 231991–232011 | |
| CyHV-3 ORF148 | ORF148outF | CATGGTTCGAGGTTGTGAAG | 253808–253827 |
| ORF148outR | CAGCATTCGTCTCTTAGTGC | 255933–255952 | |
| CyHV-3 ORF149 | ORF149outF | ACCCTATCATGATTGACGGC | 255770–255789 |
| ORF149outR | CTTTCGTTCTACTGTTCCTC | 258172–258191 | |
| Synthesis of | |||
| ORF 25 Del | ORF25 | 45495–45569 | |
| ORF25 | 47376–47450 | ||
| ORF 32 Del | ORF32 | 54417–54491 | |
| ORF32 g | 54491–54417 | ||
| ORF 59 Del | ORF59 | 101961–102035 | |
| ORF59 | 102521–102447 | ||
| ORF 64 Del | ORF64 | 119814–119863 | |
| ORF64 | 122082–122033 | ||
| ORF 65 Del | ORF65 | 122070–122119 | |
| ORF65 | 123911–123960 | ||
| ORF 81 Del | ORF81 | 150722–150796 | |
| ORF81 | 150796–150722 | ||
| ORF 83 Del | ORF83 | 153481–153530 | |
| ORF83 | 152758–152807 | ||
| ORF 99 Del | ORF99 | 184714–184763 | |
| ORF99 | 185214–185165 | ||
| ORF 106 Del | ORF106 | 195727–195776 | |
| ORF106 | 196063–196014 | ||
| ORF 108 Del | ORF108 | 201156–201230 | |
| ORF108 | 201819–201893 | ||
| ORF 115 Del | ORF115 | 208152–208226 | |
| ORF115 | 210641–210567 | ||
| ORF 131 Del | ORF131 | 225410–225484 | |
| ORf131 | 226426–226352 | ||
| ORF 132 Del | ORF132 | 227369–227443 | |
| ORF132 | 227957–228031 | ||
| ORF 136 Del | ORF136 | 231264–231337 | |
| ORF136 | 231801–231875 | ||
| ORF 148 Del | ORF148 | 253881–253955 | |
| ORF148 | 255780–255854 | ||
| ORF 149 Del | ORF149 | 255861–255935 | |
| ORF149 | 257997–258071 | ||
| Nonsense mutagenesis of essential genesc | |||
| ORF32 | ORF32.T237G-sense | GACAACGGCTGGGGCTA | 54711–54745 |
| ORF32.A237C-antisense | GATTGGATCAGAAAGGT | 54745–54711 | |
| ORF59 | ORF59.C144G-sense | CATGCAGCGCTA | 102315–102291 |
| ORF59.G144C-antisense | CTCGCACAGTTG | 102291–102315 | |
| ORF81 | ORF81.C207G-sense | TTGCGCACGCCATGTA | 150987–151015 |
| ORF81.G207C-antisense | GGGATCGTTGGA | 151015–150987 | |
| ORF83 | ORF83.G225A-sense | GTTCATGTACTG | 153268–153244 |
| ORF83.C225T-antisense | GCGTAGGGTGAC | 153244–153268 | |
| ORF99 | ORF99.C3039G-sense | CAACGACAGGTTCTCGTA | 184946–184974 |
| ORF99.G3039C-antisense | GGCTCGCCAC | 184974–184946 | |
| ORF106 | ORF106.CA108AT-sense | CTTCGTCGTCTA | 195872–195896 |
| ORF106GT108TA-antisense | GTGCTGGGCCT | 195896–195872 | |
| ORF115 | ORF115.C744A-sense | GGACCTGGTCCTGTA | 208955–208985 |
| ORF115.G744T-antisense | CACGTTCGTCTGGGA | 208985–208955 | |
| ORF131 | ORF131.C735G-sense | TCCAGGGCCGTGTA | 226054–226032 |
| SDM131.G735C-antisense | GCGGCCTC | 226032–226054 | |
| Synthesis of probes for Southern analysis (probe name) | |||
| | AGGTGAGGAACTAAACCCAG | ||
| CGTATTGCAGCAGCTTTATC | |||
| ORF32 | ORF32.SB-F | CAGATGTGGCTGGACATGA | 54567–54585 |
| ORF32.SB-R | GCTACCCAGGTGGTGTTGTT | 55006–54987 | |
| ORF59 | ORF59.SB-F | GTTCTGCGTCGAGGATGATG | 102042–102061 |
| ORF59.SB-R | CGTTCAGCACCTCGGTCTAC | 102427–102408 | |
| ORF81 | ORF81.SB-F | AAAGCTCAACTGGCCAAGAG | 150809–150828 |
| ORF81.SB-R | ACACCGCCGTCTTCGAGTAG | 151259–151240 | |
| ORF83 | ORF83.SB-F | TGCTCTCCACGTCCTTGTA | 152838–152856 |
| ORF83.SB-R | ATGTCTCCTTTGTGCGGTC | 153480–153462 | |
| ORF99 | ORF99.SB-F | CCTCCAGACGCAGATCAACT | 184751–184770 |
| ORF99.SB-R | CTTGAGGAAGGGCTGGTTG | 185204–185186 | |
| ORF106 | ORF106.SB-F | GCAGCAGCAGCAGAAGTG | 195783–195800 |
| ORF106.SB-R | TCAGTTGGTCTTGGGGCC | 196013–195996 | |
| ORF115 | ORF115.SB-F | CTACGCCAACGACGAACC | 209426–209443 |
| ORF115.SB-R | AGCACCACGAACCACACTC | 209776–209758 | |
| ORF131 | ORF131.SB-F | ACTGGAGCGGGTGATAGTTG | 225487–225506 |
| ORF131.SB-R | GGACTCGTCGTGCCTCTC | 225937–225920 | |
| PCR | |||
| ORF25 | ORF25int_F | ATCAAGCGCTACGACGACTT | 45948–45967 |
| ORF25int_R | TGTTGCAGGAGGTGTAGACG | 46442–46461 | |
| ORF64 | ORF64int_F | CCATAGTCCAGGACGACGAT | 121431–121450 |
| ORF64int_R | TGCTGCTTGATGTTCTCCAC | 121919–121938 | |
| ORF65 | ORF65int_F | GATGGTCATGTTGGTGTTGC | 122996–123015 |
| ORF65int_R | CCAAGAACGAGCTCTTCACC | 123494–123513 | |
| ORF108 | ORF108int_F | ACCAACTACACGACCGTCTC | 201246–201265 |
| ORF108int_R | CCGGGTTGGTGTAGGTAGAA | 201677–201696 | |
| ORF132 | ORF132int_F | TTGGTTTTTGTTGGTGACGA | 227468–227487 |
| ORF132int_R | TGACGGGTTCCAAGATTAGC | 227936–227955 | |
| ORF136 | ORF136int_F | CTGGTTACATGGGTGGCTTT | 231360–231379 |
| ORF136int_R | TAGCCCCTGTTGTAGGATGC | 231738–231757 | |
| ORF148 | Pr148fw2 | GGTTGTTGGAGTAGTGGTGC | 254196–254215 |
| Pr148rev2 | CTCATTCAGGCTCGGAGAC | 254592–254610 | |
| ORF149 | Pr149fw1 | GTAGTCGCTGGATGTGACG | 256662–256680 |
| Pr149rev1 | GTCAACACGGACTGCTCCG | 257093–257111 | |
| ORF112 | ORF112intFW | CCAGTGTCATCACCACAAGC | 205336–205355 |
| ORF112intREV | ACGGACATCCTGGGTATCAA | 205571–205590 | |
| qPCR | |||
| CyHV-3 ORF89 | KHV-86F | GACGCCGGAGACCTTGTG | |
| KHV-163R | CGGGTTCTTATTTTTGTCCTTGTT | ||
| KHV-109P | (6FAM) CTTCCTCTGCTCGGCGAGCACG (BHQ1) | ||
| Carp glucokinase | CgGluc-162F | ACTGCGAGTGGAGACACATGAT | |
| CgGluc-230R | TCAGGTGTGGAGCGGACAT | ||
| CgGluc-185P | (6FAM) AAGCCAGTGTCAAAATGCTGCCCACT (BHQ1) |
Coordinates are listed in relation to GenBank accession number NC_009127.1.
Underlined: segments correspond to the CyHV-3 sequence; italicization indicates sequences corresponding to galK sequence. Mutated nucleotides are both underlined and italicized.