Literature DB >> 28791354

Collagen type II is downregulated in the degenerative nucleus pulposus and contributes to the degeneration and apoptosis of human nucleus pulposus cells.

Chengjie Lian1, Bo Gao1, Zizhao Wu1, Xianjian Qiu1, Yan Peng1, Anjing Liang1, Caixia Xu2, Peiqiang Su3, Dongsheng Huang1.   

Abstract

Degenerative disc disease (DDD) is a common degenerative condition initiated mainly within the nucleus pulposus (NP). To date, the etiopathogenesis of DDD remains unclear, and because no effective therapeutic strategies are available to target its pathological processes, DDD is still treated with symptomatic interventions that are far from adequate. Collagen type II is one of the major matrix components of the NP, and is considered to be essential to NP homeostasis. However, the specific mechanisms by which collagen type II influences NP cells remain unknown. In the present study, collagen type II expression was detected using immunohistochemistry analysis and quantitative polymerase chain reaction, and it was demonstrated to be significantly downregulated in NP tissues from patients with DDD compared with nondegenerative controls. To further explore the mechanism in vitro, interleukin (IL)‑1β stimulation was used to induce degeneration of a human NP cell line. IL‑1β stimulation upregulated both the mRNA and protein levels of the catabolic markers matrix metalloproteinase 13 (MMP13) and a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS4), while it downregulated the anabolic makers aggrecan and collagen type II. However, addition of purified collagen type II prevented this IL‑1β‑induced metabolic disturbance of the NP cells. Furthermore, IL‑1β stimulation significantly promoted apoptosis in NP cells, while collagen type II treatment decreased the apoptotic rate and the protein levels of cleaved caspase‑3. In conclusion, collagen type II exhibited protective effects in suppressing NP cell degeneration through its anticatabolic, proanabolic and antiapoptotic effects, suggesting that it may be a promising therapeutic agent for the prevention and treatment of DDD.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28791354      PMCID: PMC5647025          DOI: 10.3892/mmr.2017.7178

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Low back pain is a serious global health problem that imposes immense social and financial burdens (1,2), and degenerative disc disease (DDD) is a major cause in ~ 40% of DDD cases (3). The etiopathogenesis of DDD remains unclear; it is thought to involve multiple factors, including imbalances of anabolism and catabolism of the extracellular matrix (ECM), increased inflammatory cytokines, and excessive apoptosis of nucleus pulposus (NP) cells (4–6). During NP degeneration, significantly upregulated proinflammatory cytokines, interleukin (IL)-1β and tumor necrosis factor (TNF) α, drive the expression of various matrix metalloproteinases (MMPs) and aggrecanases, such as a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS). Thereafter these catabolic proteases can initiate proteolytic degradation of ECM macromolecules (mainly collagen type II and proteoglycans) and induce NP cell apoptosis, resulting in progressive deterioration of the intervertebral discs (IVDs) (4–8). Because no effective therapeutic strategies are available to target these key pathological processes, DDD is still treated with symptomatic interventions that are predominantly inadequate (9). Collagen type II is encoded by the collagen type II α 1 (COL2A1) gene, and mainly synthesized by chondrocytes and NP cells (10). Collagen type II, which is one of the major matrix components of the NP, can form an irregular network to hold proteoglycans and water together and maintain the structural stability of NP tissue (3). Both the decreased secretion of collagen type II and the increased breakdown of ECM collagen fibers are regarded as typical pathological changes in DDD (4,9). In addition, the Col2a1-null mouse has been reported to be unable to remove the notochord and develop normal IVDs, which further confirms the indispensability of collagen type II for NP development and homeostasis (11). Of note, collagen type II, which was initially regarded as a structural matrix molecule, is now thought to also function as an extracellular signaling molecule. Studies in chondrocytes reveal that collagen type II can modulate chondrocyte proliferation, differentiation, and metabolism through complex signaling pathways (12–14). However, the role of collagen type II in the biological functions of NP cells remains unknown. The present study demonstrated that collagen type II is downregulated in NP tissues of patients with DDD, and treatment of NP cells in vitro with purified collagen type II prevented NP cell degeneration via its anticatabolic, proanabolic, and antiapoptotic effects.

Materials and methods

Ethics statement

The present study was approved by the Institutional Research Ethical Committee of Sun Yat-sen University (Guangzhou, China). Written informed consent was obtained from all subjects participating in the study.

Antibodies and reagents

The following primary antibodies (Abs) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA): caspase-3 (cat. no. 9662) and cleaved caspase-3 (c-caspase-3) (cat. no. 9661). Abs against GAPDH (cat. no. ab8245), COL2A1 (cat. no. ab34712), matrix metalloproteinase (MMP) 13 (cat. no. ab39012), a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS4; cat. no. ab28285), aggrecan (ACAN; cat. no. ab36861), and α-tubulin (cat. no. ab7291) were obtained from Abcam (Cambridge, Cambridgeshire, UK). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin (Ig) G and goat anti-mouse IgG secondary antibodies (cat. nos. 31460 and 31430, respectively) were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Recombinant human IL-1β was purchased from R&D Systems, Inc. (Minneapolis, MN, USA). Purified collagen type II was purchased from Chondrex, Inc. (Redmond, WA, USA).

Culture and treatment of human NP cells

Human NP cells were obtained from ScienCell (Carlsbad, CA, USA) and cultured in Human NP Cell medium (ScienCell) at 37°C/5% CO2. The medium was changed every 3 days. When the cells reached 80–90% confluence, they were trypsinized, counted, and plated again at a density of 1.5×106 cells/ml. A total of 12 h after plating, cells were treated with or without 10 ng/ml IL-1β, 100 µg/ml purified collagen type II, and/or vehicle (0.05 M acetic acid, as used for collagen type II dissolution) for 48 h and then used in subsequent experiments.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA from cells and tissue samples was extracted using the RNeasy mini kit (Qiagen GmbH, Hilden, Germany) and converted to cDNA using PrimeScript RT Master Mix (Takara Bio, Inc., Otsu, Japan). qPCR was performed on a LightCycler 480 Real-Time PCR Detection System (Roche Diagnostics, Basel, Kanton Basel-Stadt, Switzerland) using SYBR Green I Master Mix (Roche Diagnostics). The thermocycling conditions were: 95°C for 5 min, followed by 40 cycles of 95°C for 10 sec, 60°C for 20 sec and 72°C for 20 sec. Expression of COL2A1, MMP13, ADAMTS4, and ACAN were examined. The expression level of the GAPDH gene was used as reference. Primer sequences are listed in Table I. All primers were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.). Each PCR reaction was performed in triplicate. The Cq value of the GAPDH was subtracted from the Cq value of the target gene (ΔCq) and the average ΔCq value of the triplicates was recorded. The relative expression levels of each gene were determined using the 2−ΔΔCq method (15).
Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

GenePrimerSequence (5′-3′)
GAPDHForwardAGAAAAACCTGCCAAATATGATGAC
ReverseTGGGTGTCGCTGTTGAAGTC
COL2A1ForwardGGCAATAGCAGGTTCACGTACA
ReverseCGATAACAGTCTTGCCCCACTT
ACANForwardTGCATTCCACGAAGCTAACCTT
ReverseGACGCCTCGCCTTCTTGAA
ADAMTS4ForwardGAGGAGGAGATCGTGTTTCCA
ReverseCCAGCTCTAGTAGCAGCGTC
MMP13ForwardCCAGACTTCACGATGGCATTG
ReverseGGCATCTCCTCCATAATTTGGC

COL2A1, collagen type II α 1; ACAN, aggrecan; ADAMTS4, a disintegrin and metalloproteinase with thrombospondin motifs 4; MMP13, matrix metalloproteinase 13.

Western blotting

Total protein was extracted using the radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China). Equal amounts (60 µg) of each sample were subjected to SDS-PAGE on a 10% gel and transferred to polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). Membranes were blocked with 5% non-fat dry milk for 1 h at room temperature and then incubated with anti-GAPDH (1:5,000), anti-caspase-3 (1:1,000), anti-c-caspase-3 (1:1,000), anti-COL2A1 (1:1,000), anti-MMP13 (1:2,000), anti-ADAMTS4 (1:2,000), anti-ACAN (1:500), and anti-α-tubulin (1:5,000) antibodies at 4°C overnight. Then membranes were incubated with the appropriate HRP-conjugated secondary antibody (1:2,000) for 1 h at room temperature and signals were visualized using an enhanced chemiluminescence kit (EMD Millipore).

Human NP tissues

Human lumbar NP tissues were collected from 15 patients with DDD (4 males and 11 females; mean age, 56.9±8.3 years) and 8 patients with idiopathic scoliosis (8 females; mean age, 14.3±2.7 years) which served as nondegenerative controls (16,17). Magnetic resonance imaging (MRI) was performed in all patients prior to surgery, and disc degeneration was assessed using Pfirrmann's grading system based on T2-weighted MRI images (18). DDD patients were classified as grade IV–V, while idiopathic scoliosis patients were classified as grade I–II. All patients underwent surgical treatment at Sun Yat-sen Memorial Hospital of Sun Yat-sen University (Guangzhou, China) or The First Affiliated Hospital of Sun Yat-sen University (Guangzhou, China) from January 2013 to December 2015, during which NP tissues were collected.

Immunohistochemical (IHC) analysis

Paraformaldehyde (4%) was used for fixation of the tissues at room temperature for 1 h. Paraffin sections (4-µm thick) were prepared and 5% bovine serum albumin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was used as the blocking reagent for 20 min at room temperature. IHC was performed using the Histostain-Plus kit (Origin Technologies, Inc., Beijing, China) with the anti-COL2A1 antibody (Abcam, 1:500) at 4°C overnight. Detection was conducted using a DAB Horseradish Peroxidase Color Development kit (Origin Technologies, Inc.). Semi-quantitative analysis of IHC images through integrated optical density (IOD) was performed using Image-Pro Plus 7 software (Media Cybernetics, Inc., Rockville, MD, USA).

Terminal deoxynucleotidyl-transferase-mediated dUTP nick end labelling (TUNEL) assay

A TUNEL assay was performed using the MEBSTAIN Apoptosis TUNEL kit Direct (MBL International Co., Woburn, MA, USA), according to the manufacturer's instructions. The % of TUNEL-positive cells relative to propidium iodide (PI)-stained cells was calculated in 5 random fields by microscopy for each sample. Three independent experiments were conducted and quantified for each experimental group.

Flow cytometry analysis of cell apoptosis

NP cells were plated on 24-well plates at 1×105 cells/well. Following 12 h, NP cells were treated with 10 ng/ml IL-1β for 48 h to induce apoptosis. Purified collagen type II (100 µg/ml) was added simultaneously to inhibit the effect of IL-1β. To distinguish non-apoptotic cells from cells in early apoptosis and late apoptosis/necrosis, cells were stained with the fluorescein isothiocyanate (FITC)-Annexin V Apoptosis Detection kit with 7-aminoactinomycin D (7-AAD) according to the manufacturer's instructions (Sony Biotechnology Inc., San Jose, CA, USA) and then analyzed with a Gallios Flow Cytometer (Beckman Coulter, Inc., Brea, CA, USA).

Statistical analysis

All quantitative data were presented as means ± standard deviation. Statistical analysis of the results from the clinical samples was performed using the Mann-Whitney U test. Statistical analysis of the in vitro results was performed using one-way analysis of variance followed by Dunnett's post hoc test. All statistical analyses were conducted with SPSS 13.0 statistical software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of collagen type II is downregulated in degenerated human NP tissues

To determine whether the expression of collagen type II was altered in degenerated human NP tissues, 15 sampled from degenerative discs and 8 samples from nondegenerative discs were selected. IHC and RT-qPCR were conducted to assess the expression level of collagen type II in NP tissues. Compared with the nondegenerative controls, collagen type II expression was significantly decreased in degenerated NP tissues at both the mRNA and protein level (Fig. 1).
Figure 1.

Expression of COL2A1 is downregulated in patients with DDD. (A) The expression of COL2A1 protein in 15 degenerated NP tissues and 8 nondegenerated NP tissues was detected by IHC. Representative images are presented at the indicated magnifications. Scale bar, 100 µm. (B) Semi-quantitative analysis of COL2A1 protein expression levels in tissues as measured by IHC. (C) COL2A1 mRNA expression levels were detected by reverse transcription-quantitative polymerase chain reaction. *P<0.05. COL2A1, collagen type II α 1; DDD, degenerative disc disease; NP, nucleus pulposus; IHC, immunohistochemistry; IOD, integrated optical density.

Collagen type II treatment protects human NP cells from IL-1β-induced metabolic disturbance

To determine whether collagen type II may affect NP cell degeneration, human NP cells were treated in vitro with or without vehicle, 10 ng/ml IL-1β and/or 100 µg/ml purified collagen type II. RT-qPCR and western blotting revealed that IL-1β treatment alone significantly upregulated the expression levels of catabolic genes MMP13 and ADAMTS4, while it downregulated the expression of the NP-specific markers COL2A1 and ACAN, compared with control vehicle-treated cells (Fig. 2). Following addition of purified collagen type II to the IL-1β treatment, the effects of IL-1β on MMP13, ADAMTS4, CLO2A1 and ACAN mRNA and protein expression levels were significantly reversed (Fig. 2). These results demonstrated that collagen type II protected NP cells from IL-1β-induced metabolic disturbance.
Figure 2.

Collagen type II protects human NP cells from IL-1β-induced metabolic disturbance. Human NP cells were treated with or without vehicle (0.05 M acetic acid), 10 ng/ml IL-1β and/or 100 µg/ml purified collagen type II for 48 h, as indicated. (A) mRNA and (B) protein expression levels of MMP13, ADAMTS4, ACAN, and COL2A1 were detected by reverse transcription-quantitative polymerase chain reaction and western blotting, respectively. Data are presented as means ± standard deviation of three independent experiments. *P<0.05, with comparisons indicated by brackets. NP, nucleus pulposus; IL, interleukin; MMP13, matrix metalloproteinase 13; ADAMTS4, a disintegrin and metalloproteinase with thrombospondin motifs 4; ACAN, aggrecan; COL2A1, collagen type II α 1.

Collagen type II treatment inhibits IL-1β-induced apoptosis in human NP cells

To confirm whether collagen type II may modify NP cell apoptosis, human NP cells were treated in vitro with or without vehicle, 10 ng/ml IL-1β and/or 100 µg/ml purified collagen type II. Annexin V and 7-AAD staining was performed to assess cell apoptosis. IL-1β treatment increased the % of apoptotic cells in the total cell population (measured as the sum of both early and late-stage apoptotic cells) from 7.52±0.84 to 27.06±3.58% in the control and the IL1β-treated cells respectively (Fig. 3A). Addition of collagen type II to IL-1β treatment significantly decreased the apoptotic rates to 14.52±2.86% (Fig. 3A). Similar results were obtained by TUNEL assay, with IL-1β treatment increasing the % of TUNEL-positive cells compared to control, and addition of collagen type II significantly reversing this effect (Fig. 3B). Furthermore, because caspase-3 is a critical mediator of apoptosis, the protein levels of caspase-3 and cleaved caspase-3 (which represents the active form of caspase-3) were detected by western blot analysis. The upregulated cleaved caspase-3 levels mediated by IL-1β treatment were suppressed by the addition of purified collagen type II (Fig. 3C). These results demonstrated that collagen type II had a protective effect against IL-1β-induced NP cell apoptosis.
Figure 3.

Collagen type II protects human NP cells from IL-1β-induced apoptosis. Human NP cells were treated with or without vehicle (0.05 M acetic acid), 10 ng/ml IL-1β and/or 100 µg/ml purified collagen type II for 48 h, as indicated. (A) Cells were stained with FITC-conjugated Annexin V and 7-AAD and analyzed by flow cytometry. Representative plots and quantification are shown as means ± standard deviation of three independent experiments. (B) TUNEL assay was evaluated by fluorescence microscopy. Green fluorescence indicates apoptotic TUNEL-positive cells, while red fluorescence indicates PI-stained nuclei. Representative images and quantification are shown as means ± standard deviation of three independent experiments. Scale bar, 100 µm. (C) Protein levels of c-caspase-3 and total capase-3 were evaluated by western blotting. *P<0.05, with comparisons indicated by brackets. NP, nucleus pulposus; IL, interleukin; FITC, fluorescein isothiocyanate; 7-AAD, 7-aminoactinomycin D; TUNEL, terminal deoxynucleotidyl-transferase-mediated dUTP nick end labelling; PI, propidium iodide; c, cleaved.

Discussion

DDD is a chronic degenerative condition initiated mainly within the NP; genetic predisposition, environmental influence, and aging contribute to its pathogenesis (3,4,7,9,19). Loss of NP cells and destruction of the normal ECM are believed to have important roles in the progression of NP degeneration (5,6,20,21). The present study demonstrated that collagen type II is significantly decreased in the NP tissues of patients with DDD, and that addition of purified collagen type II exerted anticatabolic, proanabolic and antiapoptotic effects on the IL-1β-induced degenerative process of NP cells in vitro. The present findings therefore suggest that collagen type II may be a promising therapeutic target for the prevention and treatment of DDD. NP cells synthesize and secrete cartilage-like ECM components, such as collagen type II and aggrecan, which are essential to NP homeostasis. In the course of NP degeneration, a decline in the number of NP cells, caused by apoptosis, leads to the reduced production of ECM. At the same time, increasing numbers of proinflammatory cytokines and catabolic proteases further degrade the existing ECM. The current study confirmed that, compared with the control group, both mRNA and protein levels of collagen type II were decreased in degenerating NP tissues. However, the discrepancy in the age of the DDD patients and the control group is a limitation of the present study. Human healthy nondegenerative NP tissues are rare and difficult to acquire, and patients with AIS are commonly used as nondegenerative controls (16,17). AIS usually occurs in adolescent females while DDD frequently occurs in elderly people, thus it is impossible to get age- and sex- matched controls. It is known that collagen fibrils decrease with age in NP tissues. The age difference between the two groups in the present study may influence the results, so age- and sex- matched nondegenerative NP tissues (possibly from patients with spinal fracture who require discectomy treatment) ought to be further collected and analyzed to verify the present findings. However, the half-life of collagen fibrils is long, being estimated to be more than decades (22). Therefore, under normal conditions, the decrease in collagen with age is limited, and the effect of age difference in the present study is unlikely to be the major cause for the decrease in collagen type II. The reduction of collagen type II is regarded as a hallmark of NP degeneration (3,4). However, whether the lack of collagen type II can in turn influence the pathophysiological condition of NP cells remains unknown. An increasing number of studies have reported that collagen type II can act as an extracellular signaling molecule that can regulate multiple biological functions in chondrocytes and mesenchymal stem cells (MSCs) (12–14,23). Chiu et al (14) reported that collagen type II promotes anabolism and maintains the cartilaginous phenotype of chondrocytes. In addition, collagen type II can regulate the differentiation of chondrocytes and MSCs (13,23). Klatt et al (12) demonstrated that collagen type II can modulate the inflammatory responses of chondrocytes. However, whether collagen type II can affect the biological functions of NP cells remains unknown. In the present study, IL-1β was used to induce the degeneration of human NP cells, as described previously (8,24). IL-1β treatment alone upregulated the matrix degrading enzymes MMP13 and ADAMTS4, but downregulated the NP-characteristic ECM components aggrecan and collagen type II, in accordance with previous reports (8,25). In the present study, addition of collagen type II to IL-1β treatment significantly reversed the IL-1β-induced increase in catabolic genes and decrease in ECM genes, suggesting that collagen type II may have a pivotal role in maintaining the metabolic balance of NP cells. In addition, IL-1β induced apoptosis in NP cells, and treatment with collagen type II significantly protected against the IL-1β-enhanced apoptosis of NP cells, thus potentially preventing the loss of NP cells and reduced production of ECM. Disordered ECM metabolism and excessive decrease in NP cells are regarded as the predominant pathological changes in degenerative IVDs (5,20,24). Consequently, inhibition of the apoptosis of NP cells and ECM degradation is hypothesized to delay the progression of DDD. The present study demonstrated that collagen type II had anticatabolic, proanabolic, and antiapoptotic effects in human NP cells, therefore indicating that it may be a promising biological agent to promote the regeneration and repair of the degenerating NP. The results of the present study demonstrated that collagen type II expression was decreased in the NP of patients with DDD. The reduced production of collagen type II may aggravate the metabolic disturbance, promote the apoptosis of NP cells, and facilitate continuing degeneration, which may subsequently result in a further reduction of collagen type II. The breakage of this vicious cycle is key to the treatment of DDD. Current therapies are still restricted to symptomatic treatment and do not correct or reverse the structural and biological deteriorations of the IVD. However, extensive studies indicate that biological therapeutic strategies, including cell transplantation, the use of biomaterial and gene therapy, may have broad applications (3,4,7,21,26–28). Cell-based transplantation with biological enhancement is particularly important among these novel biological treatment approaches, because the functionality of NP cells is thought to be more important than the number of NP cells (26,27). Collagen type II, which can act as both structural matrix and bioactive factor for transplanted cells, may be an ideal agent for biological enhancement. Thus, intradiscal injection of suitable cells (such as NP cells, and undifferentiated, chondrogenic-like or NP-like differentiated MSCs) together with collagen type II, or injection of cells engineered to express the COL2A1 gene, may represent a promising therapeutic approach. This type of therapy would not only repopulate the NP with functional cells, but also create a beneficial microenvironment for NP cells by stimulating anabolism, inhibiting catabolism, and blocking apoptosis. Revealing the molecular mechanisms by which collagen type II modulates NP cell metabolism and facilitates NP cell survival is the focus of work that is underway in our group. Further studies will be needed in the future to confirm the therapeutic value, application conditions and safety issues involving the use of collagen type II in DDD treatment.
  28 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Classification of age-related changes in lumbar intervertebral discs: 2002 Volvo Award in basic science.

Authors:  Norbert Boos; Sabine Weissbach; Helmut Rohrbach; Christoph Weiler; Kevin F Spratt; Andreas G Nerlich
Journal:  Spine (Phila Pa 1976)       Date:  2002-12-01       Impact factor: 3.468

3.  CCN2 suppresses catabolic effects of interleukin-1β through α5β1 and αVβ3 integrins in nucleus pulposus cells: implications in intervertebral disc degeneration.

Authors:  Cassie M Tran; Zachary R Schoepflin; Dessislava Z Markova; Christopher K Kepler; D Greg Anderson; Irving M Shapiro; Makarand V Risbud
Journal:  J Biol Chem       Date:  2014-01-24       Impact factor: 5.157

Review 4.  Decoding the intervertebral disc: Unravelling the complexities of cell phenotypes and pathways associated with degeneration and mechanotransduction.

Authors:  Geoffrey J Kerr; Matthew A Veras; Min Kyu M Kim; Cheryle A Séguin
Journal:  Semin Cell Dev Biol       Date:  2016-05-18       Impact factor: 7.727

Review 5.  Current trends in biologics delivery to restore intervertebral disc anabolism.

Authors:  Gianluca Fontana; Eugene See; Abhay Pandit
Journal:  Adv Drug Deliv Rev       Date:  2014-08-29       Impact factor: 15.470

Review 6.  Collagens--major component of the physiological cartilage matrix, major target of cartilage degeneration, major tool in cartilage repair.

Authors:  T Aigner; J Stöve
Journal:  Adv Drug Deliv Rev       Date:  2003-11-28       Impact factor: 15.470

7.  Heme oxygenase-1 attenuates IL-1β induced alteration of anabolic and catabolic activities in intervertebral disc degeneration.

Authors:  Bo Hu; Changgui Shi; Chen Xu; Peng Cao; Ye Tian; Ying Zhang; Lianfu Deng; Huajiang Chen; Wen Yuan
Journal:  Sci Rep       Date:  2016-02-15       Impact factor: 4.379

8.  Years lived with disability (YLDs) for 1160 sequelae of 289 diseases and injuries 1990-2010: a systematic analysis for the Global Burden of Disease Study 2010.

Authors:  Theo Vos; Abraham D Flaxman; Mohsen Naghavi; Rafael Lozano; Catherine Michaud; Majid Ezzati; Kenji Shibuya; Joshua A Salomon; Safa Abdalla; Victor Aboyans; Jerry Abraham; Ilana Ackerman; Rakesh Aggarwal; Stephanie Y Ahn; Mohammed K Ali; Miriam Alvarado; H Ross Anderson; Laurie M Anderson; Kathryn G Andrews; Charles Atkinson; Larry M Baddour; Adil N Bahalim; Suzanne Barker-Collo; Lope H Barrero; David H Bartels; Maria-Gloria Basáñez; Amanda Baxter; Michelle L Bell; Emelia J Benjamin; Derrick Bennett; Eduardo Bernabé; Kavi Bhalla; Bishal Bhandari; Boris Bikbov; Aref Bin Abdulhak; Gretchen Birbeck; James A Black; Hannah Blencowe; Jed D Blore; Fiona Blyth; Ian Bolliger; Audrey Bonaventure; Soufiane Boufous; Rupert Bourne; Michel Boussinesq; Tasanee Braithwaite; Carol Brayne; Lisa Bridgett; Simon Brooker; Peter Brooks; Traolach S Brugha; Claire Bryan-Hancock; Chiara Bucello; Rachelle Buchbinder; Geoffrey Buckle; Christine M Budke; Michael Burch; Peter Burney; Roy Burstein; Bianca Calabria; Benjamin Campbell; Charles E Canter; Hélène Carabin; Jonathan Carapetis; Loreto Carmona; Claudia Cella; Fiona Charlson; Honglei Chen; Andrew Tai-Ann Cheng; David Chou; Sumeet S Chugh; Luc E Coffeng; Steven D Colan; Samantha Colquhoun; K Ellicott Colson; John Condon; Myles D Connor; Leslie T Cooper; Matthew Corriere; Monica Cortinovis; Karen Courville de Vaccaro; William Couser; Benjamin C Cowie; Michael H Criqui; Marita Cross; Kaustubh C Dabhadkar; Manu Dahiya; Nabila Dahodwala; James Damsere-Derry; Goodarz Danaei; Adrian Davis; Diego De Leo; Louisa Degenhardt; Robert Dellavalle; Allyne Delossantos; Julie Denenberg; Sarah Derrett; Don C Des Jarlais; Samath D Dharmaratne; Mukesh Dherani; Cesar Diaz-Torne; Helen Dolk; E Ray Dorsey; Tim Driscoll; Herbert Duber; Beth Ebel; Karen Edmond; Alexis Elbaz; Suad Eltahir Ali; Holly Erskine; Patricia J Erwin; Patricia Espindola; Stalin E Ewoigbokhan; Farshad Farzadfar; Valery Feigin; David T Felson; Alize Ferrari; Cleusa P Ferri; Eric M Fèvre; Mariel M Finucane; Seth Flaxman; Louise Flood; Kyle Foreman; Mohammad H Forouzanfar; Francis Gerry R Fowkes; Richard Franklin; Marlene Fransen; Michael K Freeman; Belinda J Gabbe; Sherine E Gabriel; Emmanuela Gakidou; Hammad A Ganatra; Bianca Garcia; Flavio Gaspari; Richard F Gillum; Gerhard Gmel; Richard Gosselin; Rebecca Grainger; Justina Groeger; Francis Guillemin; David Gunnell; Ramyani Gupta; Juanita Haagsma; Holly Hagan; Yara A Halasa; Wayne Hall; Diana Haring; Josep Maria Haro; James E Harrison; Rasmus Havmoeller; Roderick J Hay; Hideki Higashi; Catherine Hill; Bruno Hoen; Howard Hoffman; Peter J Hotez; Damian Hoy; John J Huang; Sydney E Ibeanusi; Kathryn H Jacobsen; Spencer L James; Deborah Jarvis; Rashmi Jasrasaria; Sudha Jayaraman; Nicole Johns; Jost B Jonas; Ganesan Karthikeyan; Nicholas Kassebaum; Norito Kawakami; Andre Keren; Jon-Paul Khoo; Charles H King; Lisa Marie Knowlton; Olive Kobusingye; Adofo Koranteng; Rita Krishnamurthi; Ratilal Lalloo; Laura L Laslett; Tim Lathlean; Janet L Leasher; Yong Yi Lee; James Leigh; Stephen S Lim; Elizabeth Limb; John Kent Lin; Michael Lipnick; Steven E Lipshultz; Wei Liu; Maria Loane; Summer Lockett Ohno; Ronan Lyons; Jixiang Ma; Jacqueline Mabweijano; Michael F MacIntyre; Reza Malekzadeh; Leslie Mallinger; Sivabalan Manivannan; Wagner Marcenes; Lyn March; David J Margolis; Guy B Marks; Robin Marks; Akira Matsumori; Richard Matzopoulos; Bongani M Mayosi; John H McAnulty; Mary M McDermott; Neil McGill; John McGrath; Maria Elena Medina-Mora; Michele Meltzer; George A Mensah; Tony R Merriman; Ana-Claire Meyer; Valeria Miglioli; Matthew Miller; Ted R Miller; Philip B Mitchell; Ana Olga Mocumbi; Terrie E Moffitt; Ali A Mokdad; Lorenzo Monasta; Marcella Montico; Maziar Moradi-Lakeh; Andrew Moran; Lidia Morawska; Rintaro Mori; Michele E Murdoch; Michael K Mwaniki; Kovin Naidoo; M Nathan Nair; Luigi Naldi; K M Venkat Narayan; Paul K Nelson; Robert G Nelson; Michael C Nevitt; Charles R Newton; Sandra Nolte; Paul Norman; Rosana Norman; Martin O'Donnell; Simon O'Hanlon; Casey Olives; Saad B Omer; Katrina Ortblad; Richard Osborne; Doruk Ozgediz; Andrew Page; Bishnu Pahari; Jeyaraj Durai Pandian; Andrea Panozo Rivero; Scott B Patten; Neil Pearce; Rogelio Perez Padilla; Fernando Perez-Ruiz; Norberto Perico; Konrad Pesudovs; David Phillips; Michael R Phillips; Kelsey Pierce; Sébastien Pion; Guilherme V Polanczyk; Suzanne Polinder; C Arden Pope; Svetlana Popova; Esteban Porrini; Farshad Pourmalek; Martin Prince; Rachel L Pullan; Kapa D Ramaiah; Dharani Ranganathan; Homie Razavi; Mathilda Regan; Jürgen T Rehm; David B Rein; Guiseppe Remuzzi; Kathryn Richardson; Frederick P Rivara; Thomas Roberts; Carolyn Robinson; Felipe Rodriguez De Leòn; Luca Ronfani; Robin Room; Lisa C Rosenfeld; Lesley Rushton; Ralph L Sacco; Sukanta Saha; Uchechukwu Sampson; Lidia Sanchez-Riera; Ella Sanman; David C Schwebel; James Graham Scott; Maria Segui-Gomez; Saeid Shahraz; Donald S Shepard; Hwashin Shin; Rupak Shivakoti; David Singh; Gitanjali M Singh; Jasvinder A Singh; Jessica Singleton; David A Sleet; Karen Sliwa; Emma Smith; Jennifer L Smith; Nicolas J C Stapelberg; Andrew Steer; Timothy Steiner; Wilma A Stolk; Lars Jacob Stovner; Christopher Sudfeld; Sana Syed; Giorgio Tamburlini; Mohammad Tavakkoli; Hugh R Taylor; Jennifer A Taylor; William J Taylor; Bernadette Thomas; W Murray Thomson; George D Thurston; Imad M Tleyjeh; Marcello Tonelli; Jeffrey A Towbin; Thomas Truelsen; Miltiadis K Tsilimbaris; Clotilde Ubeda; Eduardo A Undurraga; Marieke J van der Werf; Jim van Os; Monica S Vavilala; N Venketasubramanian; Mengru Wang; Wenzhi Wang; Kerrianne Watt; David J Weatherall; Martin A Weinstock; Robert Weintraub; Marc G Weisskopf; Myrna M Weissman; Richard A White; Harvey Whiteford; Steven T Wiersma; James D Wilkinson; Hywel C Williams; Sean R M Williams; Emma Witt; Frederick Wolfe; Anthony D Woolf; Sarah Wulf; Pon-Hsiu Yeh; Anita K M Zaidi; Zhi-Jie Zheng; David Zonies; Alan D Lopez; Christopher J L Murray; Mohammad A AlMazroa; Ziad A Memish
Journal:  Lancet       Date:  2012-12-15       Impact factor: 79.321

9.  Collagen II is essential for the removal of the notochord and the formation of intervertebral discs.

Authors:  A Aszódi; D Chan; E Hunziker; J F Bateman; R Fässler
Journal:  J Cell Biol       Date:  1998-11-30       Impact factor: 10.539

10.  BMP3 Alone and Together with TGF-β Promote the Differentiation of Human Mesenchymal Stem Cells into a Nucleus Pulposus-Like Phenotype.

Authors:  Xiaopeng Zhou; Yiqing Tao; Chengzhen Liang; Yujie Zhang; Hao Li; Qixin Chen
Journal:  Int J Mol Sci       Date:  2015-08-27       Impact factor: 5.923

View more
  11 in total

1.  Effects of AAV2-mediated co-transfection of CTGF and TIMP1 genes on degenerative lumbar intervertebral discs in rhesus monkeys in vivo.

Authors:  Yong Liu; Jie Kong; Yong-Ming Xi; Tao Yu; Xiao-Lin Wu; You-Gu Hu
Journal:  Am J Transl Res       Date:  2018-04-15       Impact factor: 4.060

2.  Arctigenin inhibits apoptosis, extracellular matrix degradation, and inflammation in human nucleus pulposus cells by up-regulating miR-483-3p.

Authors:  Zhe Ji; Rui Guo; Zhigang Ma; Hongwei Li
Journal:  J Clin Lab Anal       Date:  2022-06-11       Impact factor: 3.124

3.  MicroRNA-124-3p inhibits the differentiation of precartilaginous stem cells into nucleus pulposus-like cells via targeting FSTL1.

Authors:  Qiong Wang; Junfang Wang; Xiaofeng Gu; Dehong Feng; Ding Li; Tao Jiang
Journal:  Exp Ther Med       Date:  2021-05-04       Impact factor: 2.447

4.  Proteomic Signatures of Healthy Intervertebral Discs From Organ Donors: A Comparison With Previous Studies on Discs From Scoliosis, Animals, and Trauma.

Authors:  Shanmuganathan Rajasekaran; Chitraa Tangavel; Dilip Chand Raja Soundararajan; Sharon Miracle Nayagam; Monica Steffi Matchado; Raveendran Muthurajan; K S Sri Vijay Anand; Sunmathi Rajendran; Ajoy Prasad Shetty; Rishi Mugesh Kanna; Dharmalingam Kuppamuthu
Journal:  Neurospine       Date:  2020-06-30

5.  Single-cell RNA-seq identifies unique transcriptional landscapes of human nucleus pulposus and annulus fibrosus cells.

Authors:  Lorenzo M Fernandes; Nazir M Khan; Camila M Trochez; Meixue Duan; Martha E Diaz-Hernandez; Steven M Presciutti; Greg Gibson; Hicham Drissi
Journal:  Sci Rep       Date:  2020-09-17       Impact factor: 4.379

6.  Optimization of a rat lumbar IVD degeneration model for low back pain.

Authors:  Juliane D Glaeser; Wafa Tawackoli; Derek G Ju; Jae H Yang; Linda Ea Kanim; Khosrowdad Salehi; Victoria Yu; Evan Saidara; Jean-Phillipe Vit; Zhanna Khnkoyan; Zachary NaPier; Laura S Stone; Hyun W Bae; Dmitriy Sheyn
Journal:  JOR Spine       Date:  2020-06-22

7.  The Inner Annulus Fibrosus Encroaches on the Nucleus Pulposus in the Injured Mouse Tail Intervertebral Disc.

Authors:  Yulong Wei; Zuozhen Tian; Robert J Tower; Sarah E Gullbrand; Lutian Yao; Snehal S Shetye; Robert L Mauck; Ling Qin; Yejia Zhang
Journal:  Am J Phys Med Rehabil       Date:  2021-05-01       Impact factor: 3.412

8.  USP15 promotes the apoptosis of degenerative nucleus pulposus cells by suppressing the PI3K/AKT signalling pathway.

Authors:  Bin Yu; Bin Shen; Zhaoyu Ba; Zhonghan Liu; Jing Yuan; Weidong Zhao; Desheng Wu
Journal:  J Cell Mol Med       Date:  2020-11-01       Impact factor: 5.295

Review 9.  Main and Minor Types of Collagens in the Articular Cartilage: The Role of Collagens in Repair Tissue Evaluation in Chondral Defects.

Authors:  Lourdes Alcaide-Ruggiero; Verónica Molina-Hernández; María M Granados; Juan M Domínguez
Journal:  Int J Mol Sci       Date:  2021-12-11       Impact factor: 5.923

10.  Role of PI3K/AKT Signaling Pathway in Nucleus Pulposus Cells.

Authors:  Quan Xiao; Yun Teng; Changming Xu; Wei Pan; Hanshi Yang; Jiali Zhao; Quan Zhou
Journal:  Biomed Res Int       Date:  2021-07-01       Impact factor: 3.411

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.