Novel microsatellite development and characterization for Phacelia formosula (Hydrophyllaceae).

PREMISE OF THE STUDY: Microsatellite primers were developed to characterize genetic diversity and structuring in the genus Phacelia (Hydrophyllaceae) and to further conservation efforts for P. formosula. METHODS AND
RESULTS: Fifteen novel microsatellite primers were developed for P. formosula. These were characterized for genetic variation in three separate P. formosula populations. Two to nine alleles were found per locus. Overall observed heterozygosity and expected heterozygosity ranged from 0.000 to 0.800 and 0.000 to 0.840, respectively. Additionally, these loci were successfully amplified and showed polymorphism in P. gina-glenneae and a potential new Phacelia species.
CONCLUSIONS: These microsatellite markers will be useful in assessing genetic diversity, structuring, and gene flow within and among populations of the rare P. formosula, in addition to related Phacelia species. These markers will provide important genetic data needed for appropriate conservation and management of these rare plants.

Phacelia Juss. (Hydrophyllaceae) is a speciose genus with approximately 167 (USDA NRCS, 2017) species in the United States, predominantly in western states. We follow the taxonomy of the Boraginales Working Group (Luebert et al., 2016) in conserving Phacelia within the family Hydrophyllaceae as opposed to in a subfamily of the Boraginaceae (e.g., APG IV, 2016). In addition to the ongoing debate regarding the status of the Hydrophyllaceae, this maintains agreement with the recent Flora of Colorado (Ackerfield, 2015). Given the number of species in both the genus and family, we expect that these markers will have broad applicability for conservation and population-level studies. Additionally, there are many rare and locally endemic species in Phacelia (34 species with a G1 or G2 rank; NatureServe, 2017). Whereas previous population genetic studies in Phacelia used cpDNA (Levy et al., 1996) or allozymes (Levy and Neal, 1999), we developed the first primers specifically for population-level assessments in the genus.

Phacelia formosula Osterh. (North Park phacelia) is a rare endemic found only in the North Park basin in Jackson County, Colorado, USA. Within this area, P. formosula is found in scattered small populations restricted to soils derived from the Coalmont Formation (U.S. Fish and Wildlife Service, 2011). An understanding of the genetic diversity and distribution of P. formosula would be extremely useful in guiding management and conservation actions. Currently, these data are lacking for P. formosula, as well as other Phacelia species.

Here we report the development and characterization of 15 novel microsatellite loci for Phacelia, all of which were tested for polymorphism in P. formosula. Additionally, we cross-amplified these loci in a presumably closely related species, P. gina-glenneae N. D. Atwood & S. L. Welsh, and in a recently discovered population of uncertain specific status (Phacelia sp. in Table 1).

Table 1.

Characteristics of 15 microsatellite loci developed in Phacelia formosula from Jackson County, Colorado, USA, including annealing temperature for two separate PCR panels and individual primer concentrations.

Locus	Primer sequences (5′–3′)	Repeat motif	Ta (°C)	Primer concentration (μM)	Fluorescent label	Allele size range (bp)	GenBank accession no.
Phafor_00006	F: GAGTTCGCGGACAAAGATGC	(TATG)8	63.8	0.75	6-FAM	189–197	KP281305
	R: CTTGTGATCGCGTCCTAAGC
Phafor_00246	F: CCGCCATCTCCTTCTTCCAC	(TACA)10	63.8	2	NED	203–222	KP281306
	R: AGCAATTCGCATTAGGTCCG
Phafor_00567	F: AAAACGCACCGTCTCACTTG	(ATAC)11	62	2	VIC	222–260	KY442304
	R: TTCCGCATAAAACGCCATCG
Phafor_00650	F: ATACTGAAACCGCCGCAATC	(TGTA)7	63.8	2	PET	194–222	KP281307
	R: TTACCGCCTTCAAACCCAAC
Phafor_00745	F: AGGGTCGACACCATACTTCTC	(TTCT)8	63.8	2	NED	253–271	KP281308
	R: GCAGACCAGGCTGTTTAGTG
Phafor_01477	F: GCAAGCAATGAACACACTCC	(CAA)7	62	2	6-FAM	83–96	KP281309
	R: GTCGTATCAAAAGGCATCATTGG
Phafor_01499c	F: TGCAAAAGAGATCCATCCACG	(GA)14	62	2	PET	228–240	KP281303
	R: AGGCCTATTCTGTCCCACATC
Phafor_01817c	F: ATCGGGTTACAGAGATGGGC	(AG)14	63.8	1.5	VIC	110–133	KY442307
	R: GCCCGTTGGGAGAACAAAAG
Phafor_02245	F: TCCCATGTTAGCGAGTAGGC	(ATC)8	62	4	6-FAM	208–223	KP281310
	R: TGCGTAATCTTGACTTCTAACGAG
Phafor_02638	F: GATCAGCGATCAGTGCGTG	(TATG)12	62	4	NED	220–249	KP281312
	R: CAAATAGCACCCAACTCCACC
Phafor_02824	F: CCGTTGCTGATGTCCTTGTC	(TATC)18	63.8	4	6-FAM	262–288	KY442308
	R: CAACATGGTTGCATGCTTCAG
Phafor_03037	F: AACACATCCATGTTGCACCG	(TATC)7	63.8	1.5	VIC	231–239	KP281311
	R: TGGGTCACAGTTAGGTGATG
Phafor_03754	F: GGGTTAAGTACTGTCATCTTGTACG	(TATG)9	62	2	NED	165–189	KP281313
	R: ATTGAACTTCCACTATCGACTTG
Phafor_05461c	F: TTTGTCCAGACGCAAACGAC	(GT)12	62	2	6-FAM	155–167	KP281302
	R: AAGCAGTCGTGAGGAAAACG
Phafor_13597s	F: TGGTGCTAAAGAATATCTGCCG	(CT)14	62	1	VIC	106–140	KP281304
	R: ATTGGAAGTGACTAGAACAAGC

Note: Ta = annealing temperature.

METHODS AND RESULTS

Microsatellite development using DNA extracted from silica-dried P. formosula leaf tissue was conducted by Ecogenics GmbH (Balgach, St. Gallen, Switzerland). Microsatellite content of the genomic DNA fragments was enriched via biotin-labeled tetranucleotide (GTAT, GATA, AAAC, and AAAG; Roche 454 platform [Basel, Basel-Stadt, Switzerland] with GS FLX Titanium reagents) and dinucleotide (CT and GT; Illumina MiSeq platform [San Diego, California, USA] using the Nano 2 × 250 version 2 format) repeats using magnetic streptavidin beads. The enrichments were multiplexed with additional species and produced libraries with 4264 and 13,858 reads (respectively), which were assessed for microsatellites using Primer3 (Rozen and Skaletsky, 1999). The tetranucleotide reads averaged 415 bp in length with 151 reads containing a tetra- or trinucleotide microsatellite insert ≥6 repeat units. The dinucleotide reads averaged 402 bp in length, and 1502 reads contained a dinucleotide microsatellite insert ≥10 repeat units. Suitable primer design was possible in 83 of the tetranucleotide reads and 918 of the dinucleotide reads, of which 24 and 16 reads (respectively) were tested for functionality and polymorphism in seven samples using the methods of Schuelke (2000). The assessment resulted in 40 loci, which were then narrowed to 15 by the authors based on multiplex potential. These loci were multiplexed in two panels for data collection and analyses (Table 1).

For locus amplification within populations, total genomic DNA was extracted from silica-dried leaf tissue at Denver Botanic Gardens using the Omega E.Z.N.A. DNA Mini Kit (Omega Bio-tek, Norcross, Georgia, USA; short protocol with both elution steps). Amplification was carried out at the Nevada Genomics Center (Reno, Nevada, USA) using two PCR panels with different annealing temperatures to maximize multiplexing effectiveness. Final PCR volume was 11 μL:1 μL aliquot of panel mix (containing: forward primers [labeled with a universal M13 tail: 5′-TGTAAAACGACGGCCAGT-3′], reverse primers [primer concentration varied by loci, see Table 1], a fluorescently labeled [6-FAM, NED, PET, or VIC] 5′ tag, and 20 ng of DNA template) and 10 μL of QIAGEN Multiplex PCR Mastermix (QIAGEN, Hilden, Germany). Reaction conditions were as follows: an initial 15-min 95°C denaturing step; followed by 40 amplification cycles of 95°C for 30 s, 62°C (panel 1) or 63.8°C (panel 2) for 45 s, and 72°C for 45 s; followed by a final elongation step at 72°C for 30 min using a GeneAmp 9700 thermocycler (Applied Biosystems, Carlsbad, California, USA). PCR products were diluted to an appropriate concentration determined by PicoGreen dilution tests. One microliter of diluted PCR product was added to 10 μL of HiDi Formamide with the size standard GeneScan 500 LIZ (Thermo Fisher Scientific, Waltham, Massachusetts, USA) and 7 μL of molecular-grade water followed by electrophoresis on an ABI Prism 3730 DNA Analyzer (Applied Biosystems) at the Nevada Genomics Center. Genotype data were visualized and fragment sizes scored at Denver Botanic Gardens using Geneious version 6.0.6 (Kearse et al., 2012).

GenAlEx version 6.3 (Peakall and Smouse, 2006) was used to calculate observed heterozygosity (Ho) and expected heterozygosity (He) and to test for deviation from Hardy–Weinberg equilibrium (HWE). GENEPOP (Raymond and Rousset, 1995; Rousset, 2008) was used to test for linkage disequilibrium for each pair of loci in each population. ML-NullFreq (Kalinowski and Taper, 2006; 10,000 replicates) was used to estimate the frequency of null alleles.

All 15 microsatellite loci were variable and polymorphic in all three of the P. formosula populations. The number of alleles per locus ranged from two to nine (JC1, N = 30), from two to seven (JC2, N = 30), and from two to eight (JC3, N = 30). The Ho and He at JC1 ranged from 0.133 to 0.800 and 0.124 to 0.840, respectively. At JC2, Ho and He ranged from 0.033 to 0.700 and 0.064 to 0.707, respectively. At JC3, the Ho ranged from 0.000 to 0.700 and He ranged from 0.067 to 0.742 (Table 2). Three loci (Phafor_00567, Phafor_02245, and Phafor_02824) at the JC1 population and four loci at both the JC2 population (Phafor_00567, Phafor_01817c, Phafor_02245, and Phafor_03754) and the JC3 population (Phafor_00246, Phafor_00567, Phafor_01817c, and Phafor_02245) showed significant deviation from HWE (Table 2). After Bonferroni correction, no evidence of significant linkage disequilibrium was detected. Heterozygote deficiencies, possibly indicating the presence of null alleles, were detected for five loci at the JC1 population (Phafor_00006, Phafor_00567, Phafor_01817c, Phafor_02245, and Phafor_02824), six loci at the JC2 population (Phafor_00567, Phafor_1477, Phafor_01817c, Phafor_02245, Phafor_3754, and Phafor_13597s), and seven loci at the JC3 population (Phafor_00246, Phafor_00567, Phafor_00745, Phafor_01817c, Phafor_02245, Phafor_02824, and Phafor_05461c). All 15 microsatellite loci were successfully cross-amplified in both P. gina-glenneae (GC, N = 30) and a newly discovered Phacelia population (LC, N = 30) of uncertain specific status. All of the amplified loci were polymorphic in the P. gina-glenneae population while two loci (Phafor_03037 and Phafor_01817c) were monomorphic in the Phacelia sp. population (LC) (Table 2).

Table 2.

Genetic characterization of 15 newly developed polymorphic microsatellite loci in Phacelia formosula, P. gina-glenneae, and a Phacelia population of uncertain specific status.

	Phacelia formosula												Phacelia sp.				Phacelia gina-glenneae
	JC1				JC2				JC3				LC				GC
Locus	A	Ho	He	HWEb	A	Ho	He	HWEb	A	Ho	He	HWEb	A	Ho	He	HWEb	A	Ho	He	HWEb
Phafor_00006	2	0.367	0.486	0.178	3	0.133	0.126	0.985	2	0.467	0.498	0.732	3	0.267	0.500	0.002**	2	0.033	0.033	0.926
Phafor_00246	5	0.200	0.269	0.109	3	0.200	0.240	0.080	2	0.000	0.067	0.000***	2	0.233	0.339	0.087	2	0.267	0.391	0.081
Phafor_00567	4	0.267	0.366	0.001***	4	0.095	0.543	0.000***	4	0.069	0.250	0.000***	3	0.045	0.278	0.000***	3	0.000	0.653	0.003**c
Phafor_00650	4	0.633	0.678	0.968	3	0.100	0.096	0.994	3	0.433	0.429	0.752	2	0.167	0.206	0.295	4	0.400	0.408	0.106
Phafor_00745	2	0.133	0.124	0.696	2	0.379	0.414	0.649	2	0.069	0.128	0.013	3	0.200	0.283	0.297	11	0.667	0.622	0.885
Phafor_01477	4	0.733	0.674	0.678	2	0.067	0.064	0.850	3	0.633	0.499	0.391	2	0.033	0.095	0.000***	2	0.233	0.206	0.469
Phafor_01499c	6	0.733	0.745	0.986	5	0.600	0.523	0.976	4	0.567	0.599	0.531	6	0.833	0.789	0.890	6	0.767	0.776	0.296
Phafor_01817c	4	0.367	0.448	0.106	2	0.033	0.095	0.000***	4	0.400	0.433	0.029*	1	0.000	0.000	—c	5	0.500	0.536	0.875
Phafor_02245	2	0.133	0.231	0.020*	3	0.100	0.239	0.000***	3	0.286	0.506	0.006**	3	0.417	0.352	0.645	2	0.300	0.255	0.334
Phafor_02638	7	0.633	0.684	0.274	4	0.367	0.321	0.959	4	0.700	0.665	0.540	5	0.586	0.646	0.965	6	0.567	0.574	0.718
Phafor_02824	6	0.286	0.641	0.000***	6	0.333	0.347	1.000	7	0.667	0.742	0.368	3	0.000	0.667	0.112c	3	0.000	0.472	0.000***
Phafor_03037	3	0.367	0.445	0.671	3	0.433	0.515	0.615	3	0.367	0.403	0.255	1	0.000	0.000	—	4	0.600	0.446	0.480
Phafor_03754	5	0.633	0.628	0.955	3	0.500	0.496	0.000***	4	0.367	0.474	0.458	2	0.100	0.095	0.773	5	0.267	0.656	0.000***
Phafor_05461c	3	0.333	0.380	0.378	5	0.700	0.637	0.682	4	0.321	0.406	0.295	2	0.300	0.339	0.524	5	0.500	0.572	0.759
Phafor_13597s	9	0.800	0.840	0.725	7	0.567	0.707	0.437	8	0.667	0.681	0.831	8	0.767	0.780	0.944	6	0.700	0.773	0.885

Note: A = number of alleles per population; He = expected heterozygosity; Ho = observed heterozygosity; HWE = P values of χ test of Hardy–Weinberg equilibrium.

Voucher and locality information are provided in Appendix 1.

Significant deviation from Hardy–Weinberg equilibrium expectations noted (*P < 0.05, **P < 0.01, ***P < 0.001).

Results based on >50% missing data due to poor amplification.

CONCLUSIONS

The novel microsatellite markers described here are the first developed not only for Phacelia, but also for the Hydrophyllaceae. These markers will be valuable for investigating population genetic structure in Phacelia and potentially other genera within Hydrophyllaceae. Knowledge of genetic diversity present within and among the scattered populations of the rare P. formosula will be used to better manage the known populations to ensure their future persistence. Additionally, these markers will be useful for assessing genetic diversity in a newly discovered population of Phacelia that is morphologically similar to P. formosula but occurs in different habitats more than 40 km away. Investigating potential gene flow between this new population and existing P. formosula populations will be helpful in inferring its specific status. Cross-amplification in P. gina-glenneae demonstrates the utility of these markers in assessing genetic diversity in other species of Phacelia. Our results indicate the presence of potential null alleles. Several methods (Chapuis and Estoup, 2007) and programs can be used to detect and account for null alleles in population-level analyses (such as Kalinowski and Taper, 2006; van Oosterhout et al., 2006), and we encourage their use with these markers. These microsatellite markers constitute a valuable tool for fine-scale genetic investigations in the genus Phacelia, as well as conservation of rare Phacelia species.

Appendix 1.

Voucher and general location information for five Phacelia populations used in this study.

Species	Population	Localitya	N	Voucher (Accession no.)b
Phacelia formosula Osterh.	JC1	Jackson County, Colorado, USA	30	M. Islam 1487 (KHD00062092)
	JC2	Jackson County, Colorado, USA	30	N. D. Atwood 33622 (BRY-V 0050698)
	JC3	Jackson County, Colorado, USA	30	N. D. Atwood 33558 (BRY-V 0050700)
Phacelia sp.	LC	Larimer County, Colorado, USA	30	M. Islam 1489 (KHD00062091)
Phacelia gina-glenneae N. D. Atwood & S. L. Welsh	GC	Grand County, Colorado, USA	30	M. Islam 12-271 (KHD00051791)

N = number of individuals sampled.

Detailed location information has been omitted due to the protected status of these species.

One voucher was collected from each sampled population. Vouchers were deposited at the Kathryn Kalmbach Herbarium (KHD), Denver Botanic Gardens, Denver, Colorado, USA, or the S. L. Welsh Herbarium (BRY), Brigham Young University, Provo, Utah, USA.