Literature DB >> 28790987

Comparative Analysis of the Flavobacterium columnare Genomovar I and II Genomes.

Salih Kumru1, Hasan C Tekedar1, Nagihan Gulsoy2, Geoffrey C Waldbieser3, Mark L Lawrence1, Attila Karsi1.   

Abstract

Columnaris disease caused by Gram-negative rod Flavobacterium columnare is one of the most common diseases of catfish. F. columnare is also a common problem in other cultured fish species worldwide. F. columnare has three major genomovars; we have sequenced a representative strain from genomovar I (ATCC 49512, which is avirulent in catfish) and genomovar II (94-081, which is highly pathogenic in catfish). Here, we present a comparative analysis of the two genomes. Interestingly, F. columnare ATCC 49512 and 94-081 meet criteria to be considered different species based on the Average Nucleotide Identity (90.71% similar) and DNA-DNA Hybridization (42.6% similar). Genome alignment indicated the two genomes have a large number of rearrangements. However, function-based comparative genomics analysis indicated that the two strains have similar functional capabilities with 2,263 conserved orthologous clusters; strain ATCC 49512 has 290 unique orthologous clusters while strain 94-081 has 391. Both strains carry type I secretion system, type VI secretion system, and type IX secretion system. The two genomes also have similar CRISPR capacities. The F. columnare strain ATCC 49512 genome contains a higher number of insertion sequence families and phage regions, while the F. columnare strain 94-081 genome has more genomic islands and more regulatory gene capacity. Transposon mutagenesis using Tn4351 in pathogenic strain 94-081 yielded six mutants, and experimental infections of fish showed hemolysin and glycine cleavage protein mutants had 15 and 10% mortalities, respectively, while the wild-type strain caused 100% mortalities. Our comparative and mutational analysis yielded important information on classification of genomovars I and II F. columnare as well as potential virulence genes in F. columnare strain 94-081.

Entities:  

Keywords:  Flavobacterium columnare; catfish; comparative genomics; fish health; genomovars; transposon mutagenesis; virulence

Year:  2017        PMID: 28790987      PMCID: PMC5524665          DOI: 10.3389/fmicb.2017.01375

Source DB:  PubMed          Journal:  Front Microbiol        ISSN: 1664-302X            Impact factor:   5.640


Introduction

Channel catfish is the most important aquaculture commodity in Mississippi and the largest aquaculture industry in the United States, but it is impacted negatively by columnaris disease caused by Flavobacterium columnare. In the United States, the disease causes losses up to $30 million annually (Shoemaker et al., 2011; Declercq et al., 2013). Columnaris outbreaks may result in high mortality, especially during spring and autumn, and are associated with stressful conditions, including high temperatures, elevated organic loads, crowded ponds, and excessive handling (Wakabayashi, 1991). F. columnare causes acute to chronic infections and affects gills, skin, and fins; in particular, dorsal fin and surrounding skin are often affected, causing “saddleback” lesions. When the disease is acute or subacute, yellowish areas of necrotic tissue can be seen in the gills, resulting in severe gill pathology (Decostere, 2002). F. columnare was isolated by Davis in 1922 (Davis, 1922) and named Bacillus columnaris. After several reclassifications, a final name was assigned in 1996 (Bernardet et al., 1996). F. columnare is a Gram-negative, long rod in the family Flavobacteriaceae (Davis, 1922; Bernardet et al., 1996). F. columnare demonstrates varying colony morphologies and genetic heterogeneity as well as significant variation in virulence in different fish species. F. columnare strains are assigned into one of three genomovar groups by using 16S rDNA restriction fragment length polymorphism analysis (Triyanto and Wakabayash, 1999). Flavobacterium columnare ATCC 49512, belonging to genomovar group I (Michel et al., 2002), was isolated from a brown trout skin lesion in France in 1987 (Bernardet, 1989), and it is not virulent to catfish (Soto et al., 2008). F. columnare genomovar II is the most virulent genomovar group in warm water fish species, including catfish (Triyanto and Wakabayash, 1999; Arias et al., 2004; Darwish and Ismaiel, 2005; Olivares-Fuster et al., 2007; Shoemaker et al., 2008; Bullard et al., 2013). However, genomovar I isolates are more virulent than genomovar II isolates in rainbow trout challenges (Evenhuis and LaFrentz, 2016). F. columnare strain 94-081 is in genomovar II and is highly virulent in catfish (Soto et al., 2008; Staroscik et al., 2008; Lawrence et al., 2012). Flavobacterium johnsoniae UW101 genome was the first completed Flavobacterium genome reported (accession # CP000685) (McBride et al., 2009). Later, the genome of Flavobacterium psychrophilum JIP02/86, the causative agent of cold water disease in salmonid fish, was reported (accession # 511344733) (Duchaud et al., 2007). Flavobacterium branchiophilum FL-15 genome was finished in 2011 (accession # FQ859183) (Touchon et al., 2011), and our group sequenced the complete genome of F. columnare genomovar I strain ATCC 49512 (accession # CP003222.2) (Tekedar et al., 2012). F. columnare genomovar II strain 94-081 was recently sequenced and completed by our group (accession # CP013992.1) (Kumru et al., 2016). Comparative analysis of complete genomes provides an excellent opportunity to determine unique genomic features. Availability of non-virulent and virulent strains belonging to genomovars I and II should reveal potential virulence factors and mechanisms causing columnaris disease. Here, we report the first comparative analysis of F. columnare strain ATCC 49512 (genomovar I) and strain 94-081 (genomovar II) genomes. Moreover, random transposon mutagenesis in strain 94-081 was conducted to identify potential virulence genes. We expect that the new knowledge gained from this study will clarify the systematic classification of genomovar I and II F. columnare and help elucidate the pathogenesis of columnaris disease.

Materials and Methods

Bacterial Species and Growth Conditions

Bacterial strains and plasmids used in this study are listed in Table . F. columnare strain 94-081 was grown at 30°C in FCGM agar plate and FCGM broth with shaking at 200 rpm (Farmer, 2004). E. coli strains were cultured at 37°C in the Luria-Bertani (LB) medium and LB broth with shaking at 200 rpm. Bacterial strains and plasmids.

Genomic DNA Extraction and Sequencing

For genomic DNA extraction from F. columnare strain 94-081 and transposon mutants, the CTAB/NaCI protocol (Murray and Thompson, 1980; Wilson, 2001) was used with some modifications. The 1.5 ml of F. columnare strain 94-081 culture was pelleted by centrifugation for 2 m at 12,000 rpm. The supernatant was discarded, the pellet was resuspended in 567 μl of TE buffer, and 20 μl of 10 mg/ml RNAse A was added. After 1 h incubation at 37°C, 40 μl of 10% SDS was added. After gentle mixing, 6 μl of 10 mg/ml proteinase K was added. The sample was incubated for 1 h at 56°C, after which 100 μl of 5 M NaCl was added with thorough mixing. The 80 μl of CTAB/NaCl solution was added, and the sample was incubated at 65°C for 10 m. An equal volume of chloroform/isoamyl alcohol was added followed by centrifugation for 5 m at 14,000 rpm. The aqueous phase was transferred to a fresh tube. The 0.7 ml of phenol/chloroform/isoamyl alcohol was added, followed by gentle mixing and centrifugation for 5 m at 14,000 rpm. The aqueous phase was transferred to a fresh tube. The 0.6 ml of isopropanol was added, and the centrifugation was repeated. Finally, after discarding the supernatant, precipitated DNA was washed by adding 1 ml of 70% ethanol, and centrifugation was conducted for 5 m at 12,000 rpm. The supernatant was removed, and the pellet was dried briefly at room temperature and resuspended in 100 μl of TE buffer. Genomic DNA sequencing was conducted as described (Kumru et al., 2016).

Genome Annotation and Comparative Analysis

F. columnare strain ATCC 49512 and strain 94-081 genome sequence accession numbers are CP003222 and CP013992, respectively. For annotation and coding protein comparison, we applied RAST (Overbeek et al., 2014) and NCBI PGAAP (Angiuoli et al., 2008) annotation tools. For RAST annotation, nucleotide files were uploaded to RAST by default features (RAST annotation scheme: classic RAST, gene caller: RAST, FIGfam version: Release70, automatically fix errors, fix frameshifts, build metabolic model, backfill gaps, turn on debug, and disable replication: yes, verbose level: 0). Mauve multiple genome alignment tool (Darling et al., 2010) was used with default settings for comparison of genomes. To evaluate general genetic similarity, two-way Average Nucleotide Identity (ANI) (Goris et al., 2007) and DNA–DNA hybridization (DDH) assessments (Meier-Kolthoff et al., 2013) were conducted using recommended default settings. A phylogenetic tree using the complete genomes of 22 Flavobacterium genus members was built from their core genomes (as of 04/2017). The core genome gene sets were aligned one by one using MUSCLE (Edgar, 2004) followed by concatenation of the alignments. Alignment results were used to compute Kimura distance matrix, which was used as input for the Neighbor-Joining algorithm as implemented in the PHYLIP package (Felsenstein, 1989). To predict bacterial protein secretion systems, analysis with MacSyFinder was performed using default features (unordered replicon, circular, all available systems, maximal E-value 1.0, maximal independent E-value 0.001, minimal profile coverage 0.5) (Abby et al., 2014). CRISPRFinder was used to detect the clustered regularly interspaced short palindromic repeats (CRISPRs) and specific families of tandem repeats (Grissa et al., 2007). To determine phage elements, PHASTER was used (Arndt et al., 2016). To identify genomic islands (GIs), IslandViewer3[1], which integrates three different identification approaches (IslandPick, SIGI-HMM, IslandPath-DIMOB), was applied (Hsiao et al., 2003; Waack et al., 2006; Langille et al., 2008; Dhillon et al., 2015). To determine insertion sequences (ISs), ISsaga[2] was used (Varani et al., 2011). For identification and analysis of signal transduction regulatory proteins, P2RP[3] was used (Barakat et al., 2013). Orthologous genes analysis was performed using OrthoVenn[4] with default features (E-value 1e - 5, inflation value 1.5) (Wang et al., 2015). Virulence factors were determined by downloading MvirDB[5] (Zhou et al., 2007) and constructing a searchable database in Genomics Workbench 6.5.1 with a cutoff E-value of 10-10.

Random Transposon Mutagenesis

Random transposon mutagenesis in F. columnare 94-081 was performed as described previously with some modifications (McBride and Kempf, 1996; Karlyshev et al., 2000; Karsi et al., 2009). Briefly, F. columnare 94-081 and donor E. coli S17-1 λpir strain with pEP4351 were grown to mid-log phase. Then bacteria were harvested by centrifugation at 12,000 rpm for 2 m. F. columnare and donor E. coli were mixed at 1:2 or 1:4 ratios and spotted onto a filter paper placed on FCGM agar. Following overnight incubation at 30°C, bacteria were removed from the filter paper by washing with FGCM broth, and serial dilutions were prepared. Diluted bacteria were spread on FCGM agar containing erythromycin (10 μg/ml) and colistin (50 μg/ml). During development of the method, lower concentrations of erythromycin were used (1 μg/ml and 5 μg/ml), but some background non-mutant colonies occurred. At 10 μg/ml, erythromycin-resistant F. columnare colonies appeared after 2 days of incubation at 30°C. Tn4351 insertion sites were identified using a single-primer PCR method (Karlyshev et al., 2000; Karsi et al., 2009). Tn4351 ends were amplified using specific left (atcaggcagtatatcccλgg) or right (attgcgctttatctccctgtaa) primers, and amplicons were sequenced using nested left (atcgacctcgtλagacttgg) or right (ggacggacaattλgcλga) primers. Sequences were searched using BLASTX for identification of genes with Tn4351 insertion.

Fish Virulence

This study was conducted by a protocol approved by the Mississippi State University Institutional Animal Care and Use Committee. Virulence of mutants was compared to parent strain 94-081 in channel catfish as described (Karsi et al., 2009). Briefly, 640 specific-pathogen-free (SPF) channel catfish fingerlings (14.65 ± 1.43 cm, 24.75 ± 6.50 g) were stocked into 32 40-L flow-through tanks (flow rate: 1 L/m) at a rate of 20 fish/tank and acclimated for 1 week. Chlorine, dissolved oxygen, and temperature were monitored daily. Four tanks were randomly assigned to each F. columnare mutant (total six mutants), F. columnare strain 94-081, and negative control. Immersion challenge was applied by lowering the water in each tank to 10-L and by adding 100 ml overnight culture (adjusted to equivalent bacterial concentration using optical density at 600 nm). Infection dose (average 1.93 × 107 CFU/ml water) was determined by serial dilution and plate counting. Negative control treatment tanks were exposed to an equal volume of sterile FCGM. After 5 h of incubation under aerated conditions, water flow was restored to each tank, and mortalities were recorded daily for a total of 8 days.

Results

Genome Features

The circular genome size of F. columnare strain ATCC 49512 is 3,162,432 bp (G+C 31.5%), which has 2,632 predicted protein coding genes, 1,121 of which are hypothetical proteins. The genome includes 5 ribosomal RNA operons (5S, 16S, and 23S) (two tandem and three scattered operons), and 74 tRNAs. RAST annotation showed 318 subsystems in the F. columnare strain ATCC 49512 genome (Table ). Genome features of F. columnare ATCC 49512 and 94-081. The circular genome size of F. columnare strain 94-081 is 3,321,600 bp. The chromosome is predicted to contain 2,779 protein-coding genes, 1,158 of which encode hypothetical proteins. The genome has 4 ribosomal RNA (5S, 16S, and 23S) operons (two of which are located in tandem), 74 tRNAs, and 3 non-coding RNAs. RAST annotation showed 324 subsystems in the F. columnare strain 94-081 genome (Table ). Gene function analysis by RAST showed that strain ATCC 49512 contains 393 unique coding genes, and strain 94-081 has 412 unique coding genes (Figure ). In particular, genes unique to strain 94-081 encode biosynthetic enzymes for amino acids and derivatives, cofactor synthetic enzymes, cell wall synthesis enzymes, DNA metabolism proteins, membrane transport proteins, cell division proteins, regulation and cell signaling proteins, and carbohydrate metabolism enzymes. F. columnare ATCC 49512 and F. columnare 94-081 genome subsystems by RAST annotation.

Phylogeny Analysis

Genome alignment by Mauve showed that although the F. columnare ATCC 49512 and F. columnare 94-081 genomes have local synteny of gene clusters, extensive genomic rearrangements are present (Figure ). Two-way ANI is 90.71%, and DDH approximation is 42.60%. A phylogenetic tree was built based on the core genomes of 22 Flavobacterium strains with complete genomes (Figure ). The core Flavobacterium genome consisted of 1,025 genes, which encompassed 1,073,527 bp per genome (23,617,594 bp total for all 22 genomes). Comparison of F. columnare ATCC 49512 (A) and F. columnare 94-081 (B) genomes using MAUVE genome alignment. Phylogenetic tree based on comparison of the core genomes from all the current complete genomes in the Flavobacterium genus.

Secretion Systems

The F. columnare ATCC 49512 genome has a type I secretion system (T1SS), a partial type II secretion system (T2SS), a partial type III secretion system (T3SS), type IV pilus (T4P; homologous to components of the T2SS), type IV secretion system (T4SS) elements, type VI secretion system subtype 3 (T6SSiii), and type IX secretion system (T9SS). The F. columnare strain 94-081 genome contains a T1SS, T3SS, T4P, T4SS, T6SSiii, and T9SS as a complete operon or partial elements (Table ). Predicted protein secretion systems in F. columnare ATCC 49512 and 94-081.

CRISPR-Cas System

Results of the CRISPRs analysis are summarized in Table . The F. columnare ATCC 49512 genome contains two CRISPR loci; one has 43 spacers, and the other has 8 spacers. Direct repeat (DR) lengths are 36 bp. The first CRISPR locus is located near a pseudogene (possibly CRISPR-associated Cas2 genes), and the second CRISPR locus is between genes encoding hypothetical proteins. While the CRISPR-associated Cas1 and possible Cas2 genes are adjacent in the genome, the Cas9 gene is at a different location. A questionable third CRISPR is located near the CRISPR-associated Cas9 gene. The strain ATCC 49512 genome also encodes Cas9 type II and Cas1 type II proteins. CRISPRs in F. columnare ATCC 49512 and 94-081. By comparison, the F. columnare 94-081 genome contains three CRISPR loci with 34, 7, and 3 spacers. DR lengths are 36, 36, and 26 bp, and the sequences are different for each CRISPR locus. The first CRISPR locus is located between CRISPR-associated genes Cas9 and Cas2. The second CRISPR locus is located between genes encoding two hypothetical proteins. The third CRISPR locus interrupts a gene encoding the cell envelope biogenesis protein OmpA (AWN65_RS13895). The F. columnare 94-081 genome has five possible CRISPRs-like structures with only two or three spacers in each (Table ). Possible CRISPR 5 is located in a gene encoding a hypothetical protein (AWN65_RS05930). Possible CRISPR 3 is located near the second CRISPR locus, and the other possible CRISPRs are located between genes encoding hypothetical proteins. The strain 94-081 genome encodes Cas9 type II, Cas1 type II, and Cas2 type I-II-III proteins.

Phage Sequences

The F. columnare ATCC 49512 genome carries three incomplete phage clusters in different locations on the genome. The lengths of the phage clusters are 6.3, 7, and 11.6 kb. Phage sequences were searched against Flavobacterium genomes using BLASTX, and 31 genes were determined (Table ). Seven of these genes encode possible virulence factors in MvirDB. Phage elements in F. columnare ATCC 49512 and 94-081. The F. columnare 94-081 genome contains one incomplete phage cluster of 13.8 kb with 16 genes, two of which have significant similarity with proteins in MvirDB. Eight of the phage genes were common in both F. columnare genomes. Phage elements in the F. columnare genomes are listed in Table .

Genomic Islands and Insertion Elements

The F. columnare ATCC 49512 genome contains eight integrated GIs encoding 71 proteins, 50 of which are hypothetical. On the other hand, the F. columnare 94-081 genome has 15 integrated GIs encoding 162 proteins, 125 of which are hypothetical (Figure ). Transposase, integrase, and DNA repair protein were encoded in GIs from both strains. Glycerol transferase, IS481 family transposase, and DNA-directed RNA polymerase sigma-70 factor were unique in GIs from strain ATCC 49512, whereas AAA family ATPase, ABC transporter ATP-binding protein, and flagellar motor protein MotB were unique to strain 94-081. The F. columnare ATCC 49512 genome contains 14 IS families with 95 interspersed protein-coding genes, while the F. columnare 94-081 genome has nine IS families with 79 interspersed predicted protein-coding genes (Figure ). Genomic islands in the genomes of the F. columnare strain ATCC 49512 (A) and strain 94-081 (B). Red: integrated prediction methods; orange: SIGI-HMM prediction methods; blue: IslandPath-DIMOB prediction method. Insertion sequences (ISs) in the genomes of F. columnare strains ATCC 49512 and strain 94–081.

Regulatory Systems

The F. columnare strain ATCC 49512 genome encodes 32 predicted two-component system proteins, 58 transcription factor proteins, and 7 other DNA-binding proteins. The F. columnare strain 94-081 genome encodes 32 two-component system proteins, 74 transcription factor proteins, and 6 other DNA-binding proteins (Table ). Although they have the same number of two-component systems, the distribution of histidine kinases (HK), response regulators (RR), and phosphotransferase proteins (PP) is different between the two strains. Strain 94-081 has more regulatory capacity than strain ATCC 49512 primarily due to the number of transcriptional regulator (TR) proteins. Regulatory systems in F. columnare ATCC 49512 and 94-081. Each of the two strains encodes unique regulatory proteins; strain ATCC 49512 encodes a unique transposase, cupin, PAS/PAC sensor signal transduction HK, and integration host factor subunit beta. Strain 94-081 encodes unique sensor HK, AAA family ATPase, ATP-binding protein, and HxIR family TR.

Orthology Analysis

Orthology analysis by OrthoVenn showed that the F. columnare strain ATCC 49512 and strain 94-081 genomes contained 2,263 intersecting orthologous clusters. Strain ATCC 49512 has 290 unique orthologous clusters, which is composed of 274 single copy genes and 16 clusters with ≥2 paralogs. Strain 94-081 has 391 unique orthologous clusters with 370 single copy genes and 21 clusters with ≥2 paralogs. In its unique clusters, 28 of the F. columnare ATCC 49512 genes encode hypothetical proteins, and 18 encode transposases. Proteins unique tp strain ATCC 49512 included two Rhs element Vgr proteins, two peptidoglycan L-alanyl-D-glutamate endopeptidases, and one RHS repeat-associated core domain protein. In the F. columnare 94-081 genome, 90 of the total unique proteins were hypothetical, two were TRs, two were XRE family TRs, and two were endonucleases.

Virulence Factors

Protein sequences of strains ATCC 49512 and 94-081 were searched against MvirDB. Results indicated that strain ATCC 49512 encoded a high number of proteins matching transposases in MvirDB, while strain 94-081 encoded a large number of proteins matching hypothetical proteins in the virulence database. MvirDB searches with a cutoff E-value of 10-10 indicated that F. columnare strain ATCC 49512 encodes 567 potential virulence proteins and F. columnare 94-081 encodes 592 potential virulence proteins (Supplementary Tables 1, 2). Proteins matches in the MvirDB database by both strains include 16S rRNA dimethyltransferase, 23S rRNA methyltransferase RlmB, an ABS transporter, a cold shock protein, gliding motility lipoproteins GldJ and GldK, molecular chaperones DnaJ, DnaK, GroEL, and HtpG, and secretion protein HlyD. In strain ATCC 49512, unique MvirDB matches include cell envelope biogenesis protein OmpA, multidrug ABC transporter permease/ATPase, multi-sensor hybrid HK, and sigma-54-dependent Fis family TR. Unique MvirDB matches from strain 94-081 include a hemolysin, λ family ATPase, Clp protease ClpC, an efflux transporter periplasmic adaptor subunit, flagellar motor protein MotB, and transcription factors.

Mutational Analysis

Using erythromycin at 10 μg/ml, our conjugation yielded six F. columnare strain 94-081 Tn4351 mutants (Table ). All six colonies contained transposon insertions; no background non-mutant colonies occurred. Wild-type strain 94-081 caused 100% mortality in catfish fingerlings, while FcMut01 [F. columnare Tn4351 chalcone isomerase (CHI) insertion mutant] and FcMut02 (hemolysin mutant) had averages of 20 and 15% mortalities, respectively. Additionally, FcMut03 (anhydro-N-acetylmuramic acid kinase mutant) had an average of 40% mortalities, and FcMut04 (glycine dehydrogenase mutant) had an average of 10% mortalities. FcMut05 and FcMut06 had similar mortalities to the wild-type strain (Figure ). Tn4351 insertion mutants of F. columnare 94-081. Mean percent mortalities resulting from experimental infection of channel catfish by F. columnare strain 94-081 and strain 94-081 Tn4351 insertion mutants (FcMut01: chalcone isomerase; FcMut02: hemolysin; FcMut03: anhydro-N-acetylmuramic acid kinase (AnmK); FcMut04: glycine cleavage system protein P (GcvP); FcMut05: transcriptional regulator TetR, FcMut06: peptidoglycan-binding protein LysM.

Discussion

F. columnare strains are divided into three genomovar groups based on their colony morphology and genetic heterogeneity (Triyanto and Wakabayash, 1999). The purpose of this study was to compare the genomes of F. columnare strain ATCC 49512 (genomovar I) and F. columnare strain 94-081 (genomovar II) (Tekedar et al., 2012; Kumru et al., 2016). Evaluation of both strains in catfish by immersion challenge showed that F. columnare strain ATCC 49512 was not virulent in catfish, while F. columnare strain 94-081 was highly virulent (Soto et al., 2008). Among the three genomovar groups, genomovar II contains the most F. columnare strains that are virulent to catfish (Triyanto and Wakabayash, 1999; Arias et al., 2004; Darwish and Ismaiel, 2005; Olivares-Fuster et al., 2007; Shoemaker et al., 2008; Bullard et al., 2013). F. columnare strain ATCC 49512 and strain 94-081 are the first complete genomes in their corresponding genomovars; the genomovar III group does not have a representative complete genome yet. F. columnare genomes are bigger than F. psychrophilum (2,860,382 bp) but smaller than F. branchiophilum (3,559,884 bp) and F. johnsoniae (6,096,872 bp). In F. columnare, the strain 94-081 genome (3,331,600 bp) is 169 kb bigger than the strain ATCC 49512 genome (3,162,432 bp). Furthermore, strain 94-081 has 147 more predicted protein-coding genes and has one less ribosomal RNA operon compared to strain ATCC 49512 (Table ). RAST annotation showed that both genomovars share similar subsystems (Figure ). Genome alignment by MAUVE showed local synteny but very different overall alignments. ANI between the two strains (90.71%) and DDH determination (42.60%) indicate that the two genomovars could be considered different species. The accepted ANI cutoff to define two strains as the same species is greater than 95% (Goris et al., 2007). Similarly, the recommended DDH cutoff to define strains as a species is >70% (Meier-Kolthoff et al., 2013, 2014). Phylogenetic analysis of all the available complete genomes in the Flavobacterium genus shows that F. columnare genomovar I and genomovar II strains cluster separately, but they are more closely related to each other than other species (Figure ). F. indicum GPTSA100-9 and F. psychrophilum are the closest species to F. columnare. Based on these criteria, our results suggest these two strains could be considered different species. Bacterial secretion systems are necessary for bacterial growth, virulence, and competition (Green and Mecsas, 2016), and there are several types of bacterial secretion systems (Gerlach and Hensel, 2007; Sato et al., 2010; Dalbey and Kuhn, 2012; Xu and Luo, 2013). The F. columnare strain ATCC 49512 and strain 94-081 genomes both have complete T1SS, T6SSiii, and T9SS as well as other partial secretion system elements (Table ). Proteases, lipases, hemolysins, and leukotoxins are secreted by T1SS in pathogens (Akatsuka et al., 1995; Dirix et al., 2004; Bleves et al., 2010; Kanonenberg et al., 2013). Strain ATCC 49512 encodes more T1SS structural proteins than strain 94-081. Type VI secretion system has three subtypes, including a new subtype unique to the Bacteroidetes first described as T6SSiii in F. johnsoniae (Russell et al., 2014). T6SS contributes to virulence of Gram-negative bacteria by transferring toxins to host cells or preventing the growth of other bacteria (Zoued et al., 2014; Aubert et al., 2015; Costa et al., 2015). Although both strains have a T6SSiii, the number of TssD (Hcp) and TssI (VgrG) secretion proteins encoded in the two strains is different (Table ). TssD (Hcp) and TssI (VgrG) are bacteriophage-related proteins interacting with non-overlapping sets of effectors. While Hcp is ring-shaped and interacts with effectors within its pore, VgrG is a phage tail spike-like protein that interacts with effectors via conserved adaptor domains. Strain 94-081 has more VgrG and Hcp proteins than strain ATCC 49512, which could contribute to genomovar II pathogenicity in catfish. Type IX secretion system or PorSS was identified first in Porphyromonas gingivalis and F. johnsoniae; this secretion system is also common in the Bacteroidetes phylum (McBride, 2001; Sato et al., 2010; McBride and Zhu, 2013; Kharade and McBride, 2015). In the Bacteroidetes phylum, T9SS is a protein carriage system for bacteria, and it is important for surface motility protein secretion and adhesion in F. johnsoniae (Shrivastava et al., 2013). Both genomovar strains have similar T9SS and motility proteins. In prokaryotes, CRISPR systems are the “memory” component of a genetic adaptive immune system (Touchon et al., 2011). Cas (CRISPR-associated family genes) system provides the mechanism of prokaryotic resistance to foreign DNA (Mojica et al., 2005; Pourcel et al., 2005; Makarova et al., 2006). CRISPR-Cas proteins may control gene expression and regulate bacterial virulence (Hatoum-Aslan and Marraffini, 2014; Westra et al., 2014). Generally, up to 16 CRISPR clusters have been identified in prokaryotic genomes with the same or different numbers of DRs, which can vary in size between 24 to 47 bp (Mojica et al., 1995; Jansen et al., 2002; Bolotin et al., 2005; Barrangou et al., 2007). Spacer sequences are usually between 0.6 and 2.5X DR size, and spacers are the CRISPR immunity targets (Stern et al., 2010; Brodt et al., 2011). Some CRISPR systems are classified as “possible” because their DRs are not 100% identical (Grissa et al., 2007). Strain 94-081 has eight CRISPR loci (including five “possible”), and strain ATCC 49512 has three (one “possible”). Although strain 94-081 has more CRISPR loci than strain ATCC 49512, the total number of DR in CRISPR is very similar between to the two strains. Strain 94-081 has more CRISPR-Cas proteins, but the significance of this in bacterial pathogenesis is unknown. Phages and prophages (lysogenic bacteriophage inserted into bacterial chromosomes and plasmids) contribute to bacterial environmental adaptation, antibiotic resistance, or pathogenicity. Bacteriophages can carry bacterial virulence genes, and chromosomal integration can inactivate bacterial genes (Casjens, 2003; Chibani-Chennoufi et al., 2004; Coates and Hu, 2007; Zhou et al., 2011; Arndt et al., 2016). Bacteriophages can be inactive, and some are activated in host cells to express virulence functions (Casjens, 2003; Coates and Hu, 2007; Zhou et al., 2011; Arndt et al., 2016). Strain ATCC 49512 has more prophage regions and proteins than strain 94-081, which may allow some unique environmental adaptations. Genomic islands are clustered genes in prokaryotic genomes, and they play a major role in microbial genome evolution. They are commonly considered to originate from horizontal gene transfer and can encompass large genomic regions. Often they encode adhesion proteins, toxins, T3SSs, iron uptake proteins, antibiotic resistance proteins, or virulence factors (Hacker and Carniel, 2001; Whittle et al., 2002; Dobrindt et al., 2004; Gal-Mor and Finlay, 2006; Langille et al., 2010). IslandViewer3 integrates three of the most accurate GI prediction methods, IslandPick, IslandPath-DIMOB, and SIGI-HMM, which utilize different prediction methods (Hsiao et al., 2003; Waack et al., 2006; Langille et al., 2008; Langille and Brinkman, 2009; Dhillon et al., 2015). Strain 94-081 has more GIs, most of which encode hypothetical proteins. Twenty-four proteins encoded in GIs from strain 94-081 have significant matches with virulence proteins in MvirDB, while 15 of the GI proteins in strain ATCC 49512 have matches with proteins in MvirDB. Insertion sequences are self-directed mobile genetic elements that contribute to horizontal gene transfer and genome organization (Varani et al., 2011). IS elements range from 0.7 to 3.5 kb in size, but they are usually less than 2.5 kb (Mahillon and Chandler, 1998; Siguier et al., 2006). IS elements appear to contribute to evolution of pathogenic bacterial genomes (Moran and Plague, 2004; Song et al., 2010; Schmitz-Esser et al., 2011; Varani et al., 2011), and movement of IS in the genome can contribute to antibiotic resistance (Tan, 1999; Wagner, 2006). Strain ATCC 49512 has more IS families and genes than strain 94-081, possibly indicating increased horizontal gene exchange has occurred. Transcriptional regulation by transcription factors and two-component system proteins is important for microbial adaptation (Barakat et al., 2013). Two-component signal transduction systems (TCS) consist of HKs and a RR. These systems modulate gene expression in response to changing environmental conditions, including pathogenic events such as invasion of host cells, biofilm formation, and resistance to antibiotics (Ernst et al., 1999; Laub, 2011; Dsouza et al., 2014; Kadowaki et al., 2016). Other types of transcriptional regulatory factors include sigma factors (SF) and one component systems (OCS) (Osterberg et al., 2011; Barakat et al., 2013). The F. columnare 94-081 genome contains 18 more transcription factor proteins and two component system elements than the F. columnare ATCC 49512 genome, suggesting a more complex regulatory network. Orthologous genes (clusters of genes derived from a common ancestor) (Fitch, 1970) are useful for comparative analysis of genome functional pathways. Orthologous cluster comparison can also be helpful for phylogenetic analysis (Henikoff et al., 1997; Mushegian et al., 1998; Wang et al., 2015). Interestingly, even though ANI and DDH analysis indicate strains ATCC 49512 and 94-081 could be considered different species, and genome alignment indicates extensive genomic rearrangements, strain ATCC 49512 and strain 94-081 have a large core of orthologous clusters (2,263 total). This indicates that despite their genomic differences, ATCC 49512 and 94-081 are functionally similar. Therefore, phenotypic differentiation of genomovar I and genomovar II strains may not be feasible. Interestingly, the relatively low number of unique proteins to genomovar II strains mediate a large difference in virulence in catfish; further study of these proteins is warranted. Eleven of the unique proteins from strain 94-081 are encoded in GIs, and three of the unique proteins from strain ATCC 49512 are encoded by GIs, suggesting horizontal gene transfer as the source. Identification of virulence factors is important for understanding bacterial pathogenesis and host/pathogen interactions (Wu et al., 2008). Comparison of the strains’ predicted proteomes against MvirDB indicated a similar number of potential virulence genes (567 for strain ATCC 49512 and 592 for strain 94-081). GIs frequently carry virulence genes, and many of the virulence genes unique to genomovar II are in GIs (Zhou et al., 2007). Some of the unique predicted virulence proteins from genomovar II are involved in secretion systems and regulatory proteins. A random transposon mutagenesis method was adapted to F. columnare genomovar II strain 94-081. Previously, transfer of plasmid pCP29 by conjugation into strain 94-081 was reported (Staroscik et al., 2008), but to our knowledge the current study is the first report of transposon mutagenesis in this strain. Similar to previously reported transposon mutagenesis using Tn4351 in F. columnare (Staroscik et al., 2008), the efficiency of mutagenesis was low (a total of six mutants were obtained from a single conjugation), so refinement of this method is warranted. We used a higher concentration of erythromycin (10 μg/ml) than previously reported (Staroscik et al., 2008), which eliminated background colonies. Virulence of the mutants was compared to parent strain 94-081 using an established model with channel catfish. Three of the mutants caused <20% mortalities (compared to 100% mortalities for wild-type strain). One of these had an insertion in a gene encoding CHI, which is an enzyme involved in flavone/flavanone degradation in bacteria. The human intestinal anaerobic bacterium Eubacterium ramulus expresses this enzyme (Braune et al., 2016), but it has not been implicated in virulence. Another mutation that caused attenuation was in a gene encoding a hemolysin, which can be an important virulence factor (Rowe and Welch, 1994; Zhang and Austin, 2000). In F. psychrophilum, hemolytic activity is contact dependent and mediated by a thermolabile enzyme (Hogfors-Ronnholm and Wiklund, 2010). The third mutant was in glycine cleavage system protein P (gcvP). The glycine cleavage system was linked to virulence in the fish pathogen Edwardsiella ictaluri, where the enzyme was shown to be involved in neutrophil and serum resistance (Karsi et al., 2009; Dahal et al., 2013). Mutation of the gene encoding anhydro-N-acetylmuramic acid kinase (anmK) in 94-081 also caused attenuation, but mean percent mortalities were higher (>40%). In Francisella, the anmK gene is necessary for full virulence, but it is not required for intracellular growth (Ludu et al., 2008). Two F. columnare 94-081 mutants were not attenuated. One of the mutations was in a TetR family TR, which typically function as transcriptional repressors and can regulate antibiotic resistance, catabolic pathways, quorum sensing, and virulence of other pathogenic bacteria (Krushkal et al., 2011; Cuthbertson and Nodwell, 2013). The 94-081 lysM mutant was also not attenuated; LysM is a peptidoglycan-binding protein that is widely distributed in prokaryotes. In some bacteria, LysM mediates attachment to extracellular matrix (Downer et al., 2002). In summary, comparison of the genomes from F. columnare genomovar I strain ATCC 49512 and genomovar II strain 94-081 provided some evidence that the two genomovars could be considered separate species (based on ANI and DDH analysis). However, orthology analysis revealed a largely conserved core genome, indicating that phenotypically the two genomovars are very similar. In particular, core metabolic functions are similar between the two genomovars. Both genomovars have CRISPR-Cas systems and evidence of horizontal gene acquisition, and despite local syntenic regions, a large number of genomic rearrangements are present between the two. For the first time, we report transposon mutagenesis of a genomovar II strain; this tool along with the genome sequence and an established infection model in catfish will enable future elucidation of mechanisms of pathogenesis in this important fish pathogen.

Author Contributions

Designed the experiments: SK, HT, NG, GW, ML, and AK. Conducted comparative genomics analysis: SK and HT. Transposon mutagenesis and fish challenge were performed by NG. The manuscript was written by SK, HT, ML, and AK. All authors read and accepted the final manuscript.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Table 1

Bacterial strains and plasmids.

StrainsReference
Flavobacterium columnare 94-081Soto et al., 2008
Escherichia coli S17-1 λpirSimon et al., 1983
Plasmids
pEP4351 (Tn4351 transposon)
Table 2

Genome features of F. columnare ATCC 49512 and 94-081.

Features/StrainATCC 4951294-081
StatusCompletedCompleted
SourceBrown TroutDiseased Catfish
Country of isolationFranceUnited States
Date of isolation19871994
Genome size3,162,4323,321,600
G+C content (%)31.530.8
Number of total protein2,6322,779
Number of total genes2,7722,897
Complete rRNAs operons54
Number of total rRNA1512
Number of total tRNA7474
Number of other RNA13
Number of pseudogene genes5029
Number of hypothetical protein1,1211,158
Number of subsystems318324
Compared function based unique genes1034
Sequence-based unique genes393412
Table 3

Predicted protein secretion systems in F. columnare ATCC 49512 and 94-081.

Secretion systemsRole in the systemGenesNumber of genes available in F. columnare ATCC 49512Number of genes available in F. columnare 94-081
T1SSMandatoryT1SS-abc66
T1SS-mfp33
T1SS-omf43
T2SSMandatoryT2SS-gspJ10
T3SSMandatoryT3SS-sctN22
T4PMandatoryT4P-pilB11
T4P-pilC11
T4P-pilM21
T4P-pilQ11
T4SSMandatoryT4SS-t4cp210
AccessoryT4SS-G-tfc1801
T4SS-I-traP01
T6SSiMandatoryT6SSi-tssH22
T6SSiiiMandatoryT6SSiii-tssB11
T6SSiii-tssC11
T6SSiii-tssD45
T6SSiii-tssE11
T6SSiii-tssF11
T6SSiii-tssG11
T6SSiii-tssH11
T6SSiii-tssI36
T6SSiii-tssK11
T6SSiii-tssN11
T6SSiii-tssP11
T9SSMandatoryT9SS-gldK11
T9SS-gldL11
T9SS-gldM11
T9SS-gldN11
T9SS-sprA11
T9SS-sprE11
T9SS-sprT11
AccessoryT9SS-porQ22
T9SS-porU11
T9SS-porV11
T9SS-gldJ11
Table 4

CRISPRs in F. columnare ATCC 49512 and 94-081.

CRISPR beginCRISPR endNo. of spacersDR lengthCRISPR length (bp)
Flavobacterium columnare 94-081
CRISPR 232099432332034362,326
CRISPR 4758381758905736524
CRISPR 731656453165919326274
Possible CRISPR 121227521237413299
Possible CRISPR 3758039758235236196
Possible CRISPR 51334949133504312694
Possible CRISPR 62395248239532612378
Possible CRISPR 832070393207149129110
Flavobacterium columnare ATCC 49512
CRISPR 139156439447643362,912
CRISPR 216799671680530836563
Possible CRISPR 31994455199455412399
Table 5

Phage elements in F. columnare ATCC 49512 and 94-081.

LocationLocus tagProduct
Flavobacterium columnare strain 94-081Region I175781-176356AWN65_RS00815Guanylate kinase
176392-176757AWN65_RS00820Four helix bundle protein
176791-177372AWN65_RS00825Nicotinic acid mononucleotide adenylyltransferase
177495-178397AWN65_RS00830N-Acetylmuramoyl-L-alanine amidase
179325-180776AWN65_RS00835Nicotinate phosphoribosyltransferase
180901-181632AWN65_RS00840Metallophosphatase
181665-183095AWN65_RS00845ATPase
183207-183656AWN65_RS00850Hypothetical protein
183762-184319AWN65_RS00855RNA 2’-phosphotransferase
184558-185193AWN65_RS00860hypothetical protein
185330-185518AWN65_RS00865Hypothetical protein
185635-186198AWN65_RS00870Hypothetical protein
186284-187126AWN65_RS00875Crystallin J1
187123-187659AWN65_RS00880Hypothetical protein
187656-188486AWN65_RS00885Phosphoribosylpyrophosphate synthetase
188909-189601AWN65_RS00890NUDIX hydrolase

Flavobacterium columnare ATCC 49512Region I1241010-1241513FCOL_RS05470Chromosome partitioning protein ParB
1241510-1242790FCOL_RS05475Phosphoadenosine phosphosulfate sulfurtransferase
1242787-1244013FCOL_RS05310Hypothetical protein
1244047-1244736FCOL_RS05485Hypothetical protein
1244733-1245056FCOL_RS05490Hypothetical protein
1245075-1245617FCOL_RS05495hypothetical protein
1245798-1246442FCOL_RS05500Hypothetical protein
1246439-1246918FCOL_RS05505Peptidoglycan L-alanyl-D-glutamate endopeptidase
1246890-1247372FCOL_RS05510Hypothetical protein

Region II2941840-2942271FCOL_RS14160Hypothetical protein
2942993-2943172FCOL_RS12865Transposase
2943259-2944173FCOL_RS12870Transposase
2944446-2945636FCOL_RS12875Acyltransferase
2945889-2946626FCOL_RS12880Capsular polysaccharide biosynthesis protein
2946753-2947616FCOL_RS12885ABC transporter permease
2947619-2948905FCOL_RS12890ABC transporter ATP-binding protein

Region III3022580-3023155FCOL_RS13225Guanylate kinase
3023191-3023556FCOL_RS13230Four helix bundle protein
3023645-3024157FCOL_RS13235Nicotinate-nicotinamide nucleotide adenylyltransferase
3024280-3025182FCOL_RS13240N-Acetylmuramoyl-L-alanine amidase
3025996-3027444FCOL_RS13245Nicotinate phosphoribosyltransferase
3027503-3028006FCOL_RS13250Hypothetical protein
3028052-3028456FCOL_RS13255Hypothetical protein
3028541-3029266FCOL_RS13260Metallophosphatase
3029263-3029805FCOL_RS13265RNA 2’-phosphotransferase
3029802-3030464FCOL_RS13270Hypothetical protein
3030527-3031030FCOL_RS13275RNase III inhibitor
3031196-3031753FCOL_RS13280Hypothetical protein
3031753-3032286FCOL_RS13285Hypothetical protein
3032283-3033113FCOL_RS13290Phosphoribosylpyrophosphate synthetase
3033491-3034183FCOL_RS13295NUDIX hydrolase
Table 6

Regulatory systems in F. columnare ATCC 49512 and 94-081.

F. columnarePredicted regulatory proteins
Two component systems
Transcription factors
Other DNA-binding proteins
HKRRPPTROCSRRSFODP
94-08113154499976
ATCC 4951215143357977
Table 7

Tn4351 insertion mutants of F. columnare 94-081.

MutantsTransposon endLocus tagGene ID
FcMut01FAWN65_RS03755Chalcone isomerase
FcMut02RAWN65_RS11020Hemolysin
FcMut03FAWN65_RS03750Anhydro-N-acetylmuramic acid kinase (AnmK)
FcMut04RAWN65_RS11110Glycine cleavage system protein P (GcvP)
FcMut05RAWN65_RS03940Transcriptional regulator TetR
FcMut06RAWN65_RS04445Peptidoglycan-binding protein LysM
  100 in total

1.  Single-primer PCR procedure for rapid identification of transposon insertion sites.

Authors:  A V Karlyshev; M J Pallen; B W Wren
Journal:  Biotechniques       Date:  2000-06       Impact factor: 1.993

2.  Identification of genes that are associated with DNA repeats in prokaryotes.

Authors:  Ruud Jansen; Jan D A van Embden; Wim Gaastra; Leo M Schouls
Journal:  Mol Microbiol       Date:  2002-03       Impact factor: 3.501

Review 3.  Ecological fitness, genomic islands and bacterial pathogenicity. A Darwinian view of the evolution of microbes.

Authors:  J Hacker; E Carniel
Journal:  EMBO Rep       Date:  2001-05       Impact factor: 8.807

Review 4.  Pathogenicity islands: a molecular toolbox for bacterial virulence.

Authors:  Ohad Gal-Mor; B Brett Finlay
Journal:  Cell Microbiol       Date:  2006-08-24       Impact factor: 3.715

Review 5.  Novel approaches to developing new antibiotics for bacterial infections.

Authors:  A R M Coates; Y Hu
Journal:  Br J Pharmacol       Date:  2007-08-20       Impact factor: 8.739

6.  Distinguishing homologous from analogous proteins.

Authors:  W M Fitch
Journal:  Syst Zool       Date:  1970-06

7.  PHAST: a fast phage search tool.

Authors:  You Zhou; Yongjie Liang; Karlene H Lynch; Jonathan J Dennis; David S Wishart
Journal:  Nucleic Acids Res       Date:  2011-06-14       Impact factor: 16.971

8.  Tricarboxylic acid cycle and one-carbon metabolism pathways are important in Edwardsiella ictaluri virulence.

Authors:  Neeti Dahal; Hossam Abdelhamed; Jingjun Lu; Attila Karsi; Mark L Lawrence
Journal:  PLoS One       Date:  2013-06-07       Impact factor: 3.240

9.  Genome-based comparative analyses of Antarctic and temperate species of Paenibacillus.

Authors:  Melissa Dsouza; Michael W Taylor; Susan J Turner; Jackie Aislabie
Journal:  PLoS One       Date:  2014-10-06       Impact factor: 3.240

10.  A two-component system regulates gene expression of the type IX secretion component proteins via an ECF sigma factor.

Authors:  Tomoko Kadowaki; Hideharu Yukitake; Mariko Naito; Keiko Sato; Yuichiro Kikuchi; Yoshio Kondo; Mikio Shoji; Koji Nakayama
Journal:  Sci Rep       Date:  2016-03-21       Impact factor: 4.379

View more
  11 in total

1.  Validation of a quantitative PCR assay for the detection of 2 Flavobacterium columnare genomovars.

Authors:  Gordon D Gibbs; Matthew J Griffin; Michael J Mauel; Mark L Lawrence
Journal:  J Vet Diagn Invest       Date:  2020-04-20       Impact factor: 1.279

2.  Evaluating Stress-Mediated Microbial Pathogenesis in Golden Shiners, Notemigonus crysoleucas.

Authors:  Sindhu Kaimal; Bradley D Farmer; Nilima N Renukdas; Hisham A Abdelrahman; Anita M Kelly
Journal:  Front Physiol       Date:  2022-05-11       Impact factor: 4.755

3.  Type IX Secretion System Effectors and Virulence of the Model Flavobacterium columnare Strain MS-FC-4.

Authors:  Nicole C Thunes; Rachel A Conrad; Haitham H Mohammed; Yongtao Zhu; Paul Barbier; Jason P Evenhuis; David Perez-Pascual; Jean-Marc Ghigo; Ryan S Lipscomb; John R Schneider; Nan Li; Devon H Erbes; Clayton Birkett; Benjamin R LaFrentz; Timothy J Welch; Mark J McBride
Journal:  Appl Environ Microbiol       Date:  2021-11-24       Impact factor: 5.005

4.  The Emerging Fish Pathogen Flavobacterium spartansii Isolated from Chinook Salmon: Comparative Genome Analysis and Molecular Manipulation.

Authors:  Shicheng Chen; Jochen Blom; Thomas P Loch; Mohamed Faisal; Edward D Walker
Journal:  Front Microbiol       Date:  2017-11-30       Impact factor: 5.640

5.  Genomic Diversity and Evolution of the Fish Pathogen Flavobacterium psychrophilum.

Authors:  Eric Duchaud; Tatiana Rochat; Christophe Habib; Paul Barbier; Valentin Loux; Cyprien Guérin; Inger Dalsgaard; Lone Madsen; Hanne Nilsen; Krister Sundell; Tom Wiklund; Nicole Strepparava; Thomas Wahli; Greta Caburlotto; Amedeo Manfrin; Gregory D Wiens; Erina Fujiwara-Nagata; Ruben Avendaño-Herrera; Jean-François Bernardet; Pierre Nicolas
Journal:  Front Microbiol       Date:  2018-02-07       Impact factor: 5.640

6.  Identification of Four Distinct Phylogenetic Groups in Flavobacterium columnare With Fish Host Associations.

Authors:  Benjamin R LaFrentz; Julio C García; Geoffrey C Waldbieser; Jason P Evenhuis; Thomas P Loch; Mark R Liles; Fong S Wong; Siow F Chang
Journal:  Front Microbiol       Date:  2018-03-13       Impact factor: 5.640

7.  Draft Genome Sequence of the Fish Pathogen Flavobacterium columnare Genomovar III Strain PH-97028 (=CIP 109753).

Authors:  Alexis Criscuolo; Olivier Chesneau; Dominique Clermont; Chantal Bizet
Journal:  Genome Announc       Date:  2018-04-05

Review 8.  Secretion Systems in Gram-Negative Bacterial Fish Pathogens.

Authors:  Sophanit Mekasha; Dirk Linke
Journal:  Front Microbiol       Date:  2021-12-15       Impact factor: 5.640

9.  Bacteriophage Resistance Affects Flavobacterium columnare Virulence Partly via Mutations in Genes Related to Gliding Motility and the Type IX Secretion System.

Authors:  Heidi M T Kunttu; Anniina Runtuvuori-Salmela; Krister Sundell; Tom Wiklund; Mathias Middelboe; Lotta Landor; Roghaieh Ashrafi; Ville Hoikkala; Lotta-Riina Sundberg
Journal:  Appl Environ Microbiol       Date:  2021-07-27       Impact factor: 4.792

10.  Biofilm Spreading by the Adhesin-Dependent Gliding Motility of Flavobacterium johnsoniae: 2. Role of Filamentous Extracellular Network and Cell-to-Cell Connections at the Biofilm Surface.

Authors:  Keiko Sato; Masami Naya; Yuri Hatano; Naoki Kasahata; Yoshio Kondo; Mari Sato; Katsuki Takebe; Mariko Naito; Chikara Sato
Journal:  Int J Mol Sci       Date:  2021-06-27       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.