| Literature DB >> 28789340 |
Sanjib Chaudhary1, B Madhu Krishna1, Sandip K Mishra1.
Abstract
Forkhead box protein A1 (FOXA1) is essential for the growth and differentiation of breast epithelium, and has a favorable outcome in breast cancer (BC). Elevated FOXA1 expression in BC also facilitates hormone responsiveness in estrogen receptor (ESR)-positive BC. However, the interaction between these two pathways is not fully understood. FOXA1 and GATA binding protein 3 (GATA3) along with ESR1 expression are responsible for maintaining a luminal phenotype, thus suggesting the existence of a strong association between them. The present study utilized the Oncomine™ microarray database to identify FOXA1:ESR1 and FOXA1:ESR1:GATA3 co-expression co-regulated genes. Oncomine™ analysis revealed 115 and 79 overlapping genes clusters in FOXA1:ESR1 and FOXA1:ESR1:GATA3 microarrays, respectively. Five ESR1 direct target genes [trefoil factor 1 (TFF1/PS2), B-cell lymphoma 2 (BCL2), seven in absentia homolog 2 (SIAH2), cellular myeloblastosis viral oncogene homolog (CMYB) and progesterone receptor (PGR)] were detected in the co-expression clusters. To further investigate the role of FOXA1 in ESR1-positive cells, MCF7 cells were transfected with a FOXA1 expression plasmid, and it was observed that the direct target genes of ESR1 (PS2, BCL2, SIAH2 and PGR) were significantly regulated upon transfection. Analysis of one of these target genes, PS2, revealed the presence of two FOXA1 binding sites in the vicinity of the estrogen response element (ERE), which was confirmed by binding assays. Under estrogen stimulation, FOXA1 protein was recruited to the FOXA1 site and could also bind to the ERE site (although in minimal amounts) in the PS2 promoter. Co-transfection of FOXA1/ESR1 expression plasmids demonstrated a significantly regulation of the target genes identified in the FOXA1/ESR1 multi-arrays compared with only FOXA1 transfection, which was suggestive of a synergistic effect of ESR1 and FOXA1 on the target genes. In summary, the present study identified novel FOXA1, ESR1 and GATA3 co-expressed genes that may be involved in breast tumorigenesis.Entities:
Keywords: ChIP; Oncomine™; breast cancer; co-expression; multi-array; tumorigenesis
Year: 2017 PMID: 28789340 PMCID: PMC5529806 DOI: 10.3892/ol.2017.6329
Source DB: PubMed Journal: Oncol Lett ISSN: 1792-1074 Impact factor: 2.967
Forkhead box protein A1:estrogen receptor 1 microarray used for the analysis.
| Author | Type[ | Sample numbers | Ref. |
|---|---|---|---|
| Higgins | Normal | 34 | ( |
| Roth | Normal | 353 | ( |
| Shyamsundar | Normal | 123 | ( |
| Tabchy | Breast | 178 | ( |
| Perou | Breast | 65 | ( |
| Su | Normal | 101 | ( |
| Zhao | Breast | 64 | ( |
| Yu | Breast 3 | 96 | ( |
| Wang | Breast | 286 | ( |
| Waddell | Breast | 85 | ( |
| Van't Veer | Breast | 117 | ( |
| Schmidt | Breast | 200 | ( |
| Pollack | Breast 2 | 41 | ( |
| Minn | Breast 2 | 121 | ( |
| Lu | Breast | 129 | ( |
| Korde | Breast | 61 | ( |
| Kao | Breast | 327 | ( |
| Julka | Breast | 44 | ( |
| Hatzis | Breast | 508 | ( |
| Gluck | Breast | 158 | ( |
| Farmer | Breast | 49 | ( |
| Desmedt | Breast | 198 | ( |
| Bos | Breast | 204 | ( |
| Bonnefoi | Breast | 160 | ( |
According to the Oncomine database acronym.
Lists of primers used.
| Primers | Primer sequence (5′-3′) | Amplicon size (bp) |
|---|---|---|
| RT- | F: GGGTGGCTCCAGGATGTTAGG | 194 |
| R: GGGTCATGTTGCCGCTCGTAG | ||
| RT- | F: CAGACCACCACAACCACACTCT | 124 |
| R: GGATGCCTCCTTCTTCATAGTCA | ||
| RT- | F: CGCGCTCTACCCTGCACTC | 121 |
| R: TGAATCCGGCCTCAGGTAGTT | ||
| RT- | F: GAAGGTCGAACAGGAAGGTTATCT | 224 |
| R: GTAACGCTACAGGGTATGGAACA | ||
| RT- | F: CCTCGGCAGTCCTGTTTCCCTGT | 124 |
| R: CCAGGACATGGGCAGGAGTAGGG | ||
| RT- | F: TGTGGATGACTGAGTACCTG | 116 |
| R: GGAGAAATCAAACAGAGGCC | ||
| RT- | F: GAACAAGGTGATCTGCGCCC | 223 |
| R: TTCTGGAGGGACGTCGATGG | ||
| RT- | F: AAGATCATCAGCAATGCCTC | 619 |
| R: CTCTTCCTCTTGTGCTCTTG | ||
| F: CATGTTGGCCAGGCTAGTCT | 165 | |
| R: CATTCCGTCTAGGCCTAAGC | ||
| F: GCTTAGGCCTAGACGGAATG | 180 | |
| R: CTCATATCTGAGAGGCCCTC | ||
| F: TTAAGTGATCCGCCTGCTTT | 271 | |
| R: CTCCCGCCAGGGTAAATACT | ||
| F: CTTATGCAATGTGTTGGTCTCACG | ||
| R: CGTGAGACCAACACATTGCATAAG | ||
| GGCCTCCCAAAGTGTTGGGATTACAGGCGT | ||
| ACGCCTGTAATCCCAACACTTTGGGAGGCC | ||
| CCCCGTGAGCCACTGTTGTCACGGCCAAG | ||
| CTTGGCCGTGACAACAGTGGCTCACGGGG |
RT, reverse transcription; FOXA1, forkhead box protein A1; EMSA; electrophoretic mobility shift assay; GATA3, GATA binding protein 3; PGR, progesterone receptor; BCL2, B-cell lymphoma 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ERE, estrogen response element; F, forward; R, reverse; PS2, trefoil factor 1; SIAH2, seven in absentia homolog 2; CMYB, cellular myeloblastosis viral oncogene homolog
FOXA1 Oncomine™ meta-analysis.
| Gene | Percentage of co-expression (%) |
|---|---|
| 100 | |
| 67 | |
| 67 | |
| 67 | |
| 63 | |
| 63 | |
| 63 | |
| 63 | |
| 58 | |
| 58 | |
| 58 | |
| 54 | |
| 54 | |
| 54 | |
| 54 | |
| 54 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 38 | |
| 38 | |
| 38 | |
| 38 | |
| 38 | |
| 38 | |
| 38 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 |
FOXA1, forkhead box protein A1.
ESR1 Oncomine™ meta-analysis.
| Gene | Percentage of co-expression (%) |
|---|---|
| 100 | |
| 79 | |
| 79 | |
| 71 | |
| 71 | |
| 71 | |
| 67 | |
| 67 | |
| 63 | |
| 63 | |
| 63 | |
| 63 | |
| 58 | |
| 58 | |
| 58 | |
| 54 | |
| 54 | |
| 54 | |
| 54 | |
| 54 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 50 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 46 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 42 | |
| 38 | |
| 38 | |
| 38 | |
| 38 | |
| 38 | |
| 38 | |
| 38 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 33 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 29 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 25 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 21 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 | |
| 17 |
ESR1, estrogen receptor 1.
Figure 1.Analysis of overlapping FOXA1 and ESR1 co-expression genes. Venn diagrams depicting genes overlapping with FOXA1 and ESR1 with a cut-off frequency of (A) 4 (~16%) and (B) 5 (~20%) by meta-analysis with Oncomine™. (C) Pie chart of functional categories for FOXA1:ESR1 overlapping genes with a cut-off frequency of ≥5 studies. The Oncomine™ data analyzed consisted of 4 normal and 20 breast cancer microarrays data sets. FOXA1, forkhead box protein A1; ESR1, estrogen receptor 1.
Overlapping meta-analysis of ESR1 and FOXA1 with a cut-off frequency of 5 (20%).
| Overlap of | |||
|---|---|---|---|
| Gene | FOXA1 (%) | ESR1 (%) | Function |
| 67 | 100 | Estrogen receptor 1 | |
| 63 | 79 | Carbonic anhydrase 12 | |
| 67 | 79 | GATA binding protein 3 | |
| 58 | 71 | NAT1 N-acetyltransferase 1 | |
| 58 | 71 | Zinc transporter ZIP6 | |
| 58 | 71 | TBC1 domain family member 9 | |
| 54 | 67 | Axonemal dynein light intermediate polypeptide 1 | |
| 100 | 67 | Forkhead box protein A1 | |
| 50 | 63 | Annexin A9 | |
| 50 | 63 | DnaJ homolog subfamily C member 12 | |
| 50 | 63 | Growth regulation by estrogen in breast cancer 1 | |
| 50 | 63 | Microtubule-associated protein tau | |
| 25 | 63 | Neural proliferation differentiation and control protein 1 | |
| 42 | 58 | 4-aminobutyrate aminotransferase | |
| 46 | 58 | Signal peptide, CUB domain, EGF-like 2 | |
| 63 | 58 | Trefoil factor 3 | |
| 38 | 54 | Receptor tyrosine-protein kinase erbB-4 | |
| 46 | 54 | Lysine (K)-specific demethylase 4B | |
| 67 | 54 | Melanophilin | |
| 50 | 54 | Myb proto-oncogene protein | |
| 63 | 54 | X-box binding protein 1 | |
| 63 | 50 | Anterior gradient homolog 2 | |
| 33 | 50 | Dachshund homolog 1 | |
| 50 | 50 | Fructose-1,6-bisphosphatase 1 | |
| 42 | 50 | Glycoprotein 130 | |
| 50 | 50 | Melanoma antigen fmily D, 2 | |
| 50 | 50 | Trefoil factor 1 | |
| 46 | 50 | Guanine nucleotide exchange factor | |
| 38 | 46 | Acyl-CoA dehydrogenase, short/branched chain | |
| 33 | 46 | GDNF family receptor alpha-1 | |
| 46 | 46 | Inositol polyphosphate-4-phosphatase | |
| 29 | 46 | Estrogen-induced gene 121 | |
| 29 | 46 | Progesterone receptor | |
| 54 | 46 | Sodium channel, non-voltage-gated 1 alpha subunit | |
| 54 | 46 | Choline transporter-like protein 4 | |
| 33 | 46 | Solute carrier family 7 (amino acid transporter light chain, L system) | |
| 54 | 46 | SAM pointed domain-containing ETS transcription factor | |
| 42 | 42 | B-cell lymphoma 2 | |
| 29 | 42 | Chromosome 9 open reading frame 116 | |
| 33 | 42 | Calcium channel, voltage-dependent, L type, alpha 1D subunit | |
| 38 | 42 | Enah/Vasp-like | |
| 33 | 42 | Guanidinoacetate N-methyltransferase | |
| 42 | 42 | Glycerol-3-phosphate dehydrogenase 1-like | |
| 38 | 42 | NME/NM23 family member 5 | |
| 29 | 42 | Serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 | |
| 33 | 42 | Stanniocalcin-related protein | |
| 38 | 42 | Syntabulin (syntaxin-interacting) | |
| 42 | 42 | Tetratricopeptide repeat domain 39A | |
| 33 | 42 | Zinc finger, MYND-type containing 10 | |
| 29 | 38 | AF4/FMR2 family, member 3 | |
| 25 | 38 | Anterior gradient 3 homolog (xenopus laevis) | |
| 46 | 38 | Androgen receptor | |
| 46 | 38 | Family with sequence similarity 174, member B | |
| 46 | 38 | SID1 transmembrane family, member 1 | |
| 25 | 38 | Thrombospondin, type I, domain containing 4 | |
| 54 | 38 | Tetraspanin 1 | |
| 21 | 33 | Calsyntenin 2 | |
| 21 | 33 | Cytochrome P450, family 2, subfamily B, polypeptide 6 | |
| 25 | 33 | Cytochrome P450, family 2, subfamily B, polypeptide 7 pseudogene 1 | |
| 29 | 33 | ELOVL fatty acid elongase 5 | |
| 25 | 33 | Family with sequence similarity 134, member B | |
| 29 | 33 | Potassium channel, subfamily K, member 15 | |
| 21 | 33 | RAS-like, estrogen-regulated, growth inhibitor | |
| 42 | 33 | Ras homolog family member B | |
| 33 | 33 | Solute carrier family 16, member 6 (monocarboxylic acid transporter 7) | |
| 21 | 33 | Solute carrier family 22 (organic cation/carnitine transporter), member 5 | |
| 25 | 33 | UDP-glucose ceramide glucosyltransferase | |
| 38 | 33 | Zinc finger protein 552 | |
| 21 | 29 | ATP-binding cassette transporter sub-family C member 8 | |
| 21 | 29 | Chromosome 5 open reading frame 30 | |
| 21 | 29 | Chromosome 6 open reading frame 97 | |
| 29 | 29 | Cytochrome B5 type A (microsomal) | |
| 21 | 29 | Dynein, light chain, roadblock-type 2 | |
| 25 | 29 | Glutathione S-transferase mu 3 (brain) | |
| 21 | 29 | Insulin Receptor Substrate 1 | |
| 25 | 29 | Microtubule associated serine/threonine kinase family member 4 | |
| 29 | 29 | Methylcrotonoyl-CoA carboxylase 2 (beta) | |
| 29 | 29 | Metallothionein-like 5, testis-specific (tesmin) | |
| 25 | 29 | Patatin-like phospholipase domain containing 4 | |
| 21 | 29 | Protein tyrosine phosphatase, receptor type, T | |
| 25 | 29 | Rabaptin, RAB GTPase binding effector protein 1 | |
| 25 | 29 | Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B | |
| 29 | 29 | Siah E3 ubiquitin protein ligase 2 | |
| 25 | 29 | Synaptotagmin XVII | |
| 33 | 29 | Tetraspanin 13 | |
| 21 | 25 | Actin binding LIM protein family, member 3 | |
| 29 | 25 | Aldo-keto reductase family 7, member a3 (aflatoxin aldehyde reductase) | |
| 29 | 25 | Chromosome 10 open reading frame 116 | |
| 29 | 25 | Cysteine-rich protein 1 (intestinal) | |
| 21 | 25 | V-Erb-B2 erythroblastic leukemia viral oncogene homolog 3 (avian) | |
| 21 | 25 | Fibrous sheath interacting protein 1 | |
| 33 | 25 | Polypeptide N-acetylgalactosaminyltransferase 6 | |
| 25 | 25 | Inositol polyphosphate-5-phosphatase J | |
| 21 | 25 | Potassium channel tetramerisation domain containing 3 | |
| 25 | 25 | Kinesin family member 5C | |
| 25 | 25 | Mediator complex subunit 13-like | |
| 33 | 25 | Ras-related protein Rab-17 | |
| 33 | 25 | RNA binding motif protein 47 | |
| 25 | 25 | Saccharopine dehydrogenase (putative) | |
| 25 | 25 | Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F | |
| 29 | 25 | Solute carrier family 2 (facilitated glucose transporter), member 10 | |
| 21 | 25 | T-box protein 3 | |
| 38 | 25 | TOX high mobility group box family Member 3 | |
| 21 | 25 | Wolfram syndrome 1 (wolframin) | |
| 25 | 21 | Calcium/calmodulin-dependent protein kinase II inhibitor 1 | |
| 21 | 21 | EF-hand domain (C-terminal) containing 1 | |
| 21 | 21 | Fatty acid amide hydrolase | |
| 29 | 21 | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) | |
| 21 | 21 | Uncharacterized protein KIAA0040 | |
| 29 | 21 | LAG1 homolog, ceramide synthase 6 | |
| 21 | 21 | LPS-responsive vesicle trafficking, beach and anchor containing | |
| 21 | 21 | Meteorin, glial cell differentiation regulator | |
| 21 | 21 | Melanoregulin | |
| 29 | 21 | RAB26, member RAS oncogene family | |
| 21 | 21 | Ring finger protein 103 | |
FOXA1, forkhead box protein A1; ESR1, estrogen receptor 1.
Comparison of ESR1 and FOXA1 co-expression Oncomine™ analysis with 51 estrogen-upregulated genes reported by Tozlu et al (71).
| Co-expression Oncomine™ | Co-expression Oncomine™ | ||
|---|---|---|---|
| + | + | ||
| + | + | ||
| + | + | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | + | ||
| + | |||
| + | + | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | + | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + |
FOXA1, forkhead box protein A1; ESR1, estrogen receptor 1.
Figure 2.Analysis of overlapping FOXA1, ESR1 and GATA3 co-expression genes. (A) Pie chart of FOXA1, ESR1 and GATA3 overlapping genes with a cut-off frequency of 4. (B) Pathway pie chart of FOXA1, ESR1 and GATA3 overlapping genes with a cut-off frequency of 4. The FOXA1 and ESR1 Oncomine™ microarray analysis consisted of 4 normal and 20 breast cancer microarray data. The GATA3 microarray data was extracted from published data by Wilson and Giguère (31). ESR1, estrogen receptor 1; FOXA1, forkhead box protein A1; GATA3, GATA binding protein 3.
Comparison of ESR1 and forkhead box protein A1 co-expression Oncomine™ analysis with the direct targets of ESR1(39).
| Genes | Expression pattern |
|---|---|
| ↑ | |
| ↑ | |
| ↑ | |
| ↑ | |
| ↑ | |
| ↑ | |
| ↑ | |
| ↓ |
ESR1, estrogen receptor 1; ↑, upregulation; ↓, downregulation.
Figure 3.Gene expression analysis using RT-PCR and RT-qPCR. Several identified genes from the FOXA1:ESR1 overlapping cluster were examined following ectopic FOXA1 expression in ESR-positive MCF7 and T47D cell lines at 24 h post-transfection. Glyceraldehyde 3-phosphate dehydrogenase was used as an internal control. (A) Gene expression of FOXA1:ESR1 overlapping genes using RT-PCR. (B) Gene expression of FOXA1:ESR1 overlapping genes using RT-qPCR. (C) FOXA1 overexpression following FOXA1 ectopic expression, as determined by RT-qPCR. *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001, vs. the control. ns, not significant; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; BCL2, B-cell lymphoma 2; PGR, progesterone receptor; GATA3, GATA binding protein 3; FOXA1, forkhead box protein A1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; CTRL, control; OE, overexpression; PS2, trefoil factor 1; SIAH2, seven in absentia homolog 2; CMYB, cellular myeloblastosis viral oncogene homolog.
Figure 4.Schematic representation of the PS2 promoter. (A) Schematic diagram showing the presence of a functional estrogen response element (−407 nucleotide position) and two putative FOXA1 binding sites at −384 and −539 nucleotide positions, respectively. (B) In vitro binding assay. A total of 30 bp oligonucleotides containing FOXA1 binding sites were labeled with γ32P radioisotope and incubated with nuclear lysate extracted from MCF7 cells. An unlabeled FOXA1 (cold probe) consensus sequence was used for competition at 100 and 150-fold molar excess. The reactions were subjected to electrophoresis in a 6% polyacrylamide gel at 180 V in 0.5X Tris/borate/ethylenediaminetetraacetic acid for ~1 h, and subsequently, the gel was dried and autoradiographed. (C) In vivo ChIP assay was performed for FOXA1 binding sites using an anti-FOXA1 antibody. The DNA elute from ChIP was subjected to polymerase chain reaction analysis from −321 to −464 and from −443 to −606 nucleotide positions for site 1 and site 2, respectively. FOXA1, forkhead box protein A1; ERE, estrogen response element; ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; IP, immunoprecipitation; IgG, immunoglobulin G; Ntd, nucleotide; PS2, trefoil factor 1.
Figure 5.Effect of FOXA1 and ESR1 on the PS2 promoter. For ChIP assay, MCF7 cells in the absence or presence of estradiol stimulation were sonicated, lysed and pre-cleared. ChIP with specific antibodies against FOXA1 and ESR1 along with corresponding control Ig G was performed. The nucleotide positions −573 to −315 and −506 to −344 represent the ERE and FOXA1 binding sequences, respectively, in the PS2 promoter. The eluted ChIP DNA samples were subjected to PCR analysis using ERE or FOXA1 site-specific primers. The PCR samples were electrophoresed in a 2% agarose gel. E2, estradiol; Ntd, nucleotide; IP, immunoprecipitation; IgG, immunoglobulin G; FOXA1, forkhead box protein A1; ERE, estrogen response element; ESR1, estrogen receptor 1; ChIP, chromatin immunoprecipitation; PCR, polymerase chain reaction; PS2, trefoil factor 1.
Figure 6.Quantification of target genes regulated by FOXA1 and FOXA/ESR1 extracted from multi-array analysis. RT-qPCR was performed from FOXA1 and FOXA1/ESR1-transfected samples in the T47D cell line. (A) Overexpression of FOXA1 and ESR1 was confirmed by RT-qPCR in FOXA1 and FOXA1/ESR1-co-transfected cells. (B) Effect of FOXA1 and FOXA1/ESR1 transfection on the target genes (CMYB, B-cell lymphoma 2, SIAH2 and PS2) at 24 h post-transient transfection in T47D cells. The bar diagram represents data derived from triplicate experiments. *P≤0.05, **P≤0.001, ***P≤0.001, ****P≤0.0001. CTRL, control; FOXA1, forkhead box protein A1; ESR1, estrogen receptor 1; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; OE, overexpression; PS2, trefoil factor 1; SIAH2, seven in absentia homolog 2; CMYB, cellular myeloblastosis viral oncogene homolog.