Literature DB >> 28732030

Identification of odorant binding proteins and chemosensory proteins in Microplitis mediator as well as functional characterization of chemosensory protein 3.

Yong Peng1,2, Shan-Ning Wang2, Ke-Ming Li2,3, Jing-Tao Liu2, Yao Zheng2, Shuang Shan2,4, Ye-Qing Yang1,2, Rui-Jun Li1, Yong-Jun Zhang2, Yu-Yuan Guo2.   

Abstract

Odorant binding proteins (OBPs) and chemosensory proteins (CSPs) play important roles in transporting semiochemicals through the sensillar lymph to olfactory receptors in insect antennae. In the present study, twenty OBPs and three CSPs were identified from the antennal transcriptome of Microplitis mediator. Ten OBPs (MmedOBP11-20) and two CSPs (MmedCSP2-3) were newly identified. The expression patterns of these new genes in olfactory and non-olfactory tissues were investigated by real-time quantitative PCR (qPCR) measurement. The results indicated that MmedOBP14, MmedOBP18, MmedCSP2 and MmedCSP3 were primarily expressed in antennae suggesting potential olfactory roles in M. mediator. However, other genes including MmedOBP11-13, 15-17, 19-20 appeared to be expressed at higher levels in body parts than in antennae. Focusing on the functional characterization of MmedCSP3, immunocytochemistry and fluorescent competitive binding assays were conducted indoors. It was found that MmedCSP3 was specifically located in the sensillum lymph of olfactory sensilla basiconca type 2. The recombinant MmedCSP3 could bind several types of host insects odors and plant volatiles. Interestingly, three sex pheromone components of Noctuidae insects, cis-11-hexadecenyl aldehyde (Z11-16: Ald), cis-11-hexadecanol (Z11-16: OH), and trans-11-tetradecenyl acetate (E11-14: Ac), showed high binding affinities (Ki = 17.24-18.77 μM). The MmedCSP3 may be involved in locating host insects. Our data provide a base for further investigating the physiological roles of OBPs and CSPs in M. mediator, and extend the function of MmedCSP3 in chemoreception of M. mediator.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28732030      PMCID: PMC5521769          DOI: 10.1371/journal.pone.0180775

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

In insects, behaviors of host identification, mating-partners, and locating oviposition sites are regulated largely by volatile chemical cues [1, 2]. These odor molecules are usually perceived by chemosensory sensilla located on their antennae [3]. In insect olfaction model, odorants enter the chemosensory sensilla through cuticular pores, dissolved in the sensillum lymph and are captured by soluble carrier proteins, then activate sensory neurons [4, 5]. Two major classes of soluble proteins, odorant binding proteins (OBPs) and chemosensory proteins (CSPs) play essential roles in transferring semiochemicals to the membrane-bonded receptors, and may contribute to the activation of olfactory receptor neurons [6, 7]. OBPs and CSPs were synthesized in non-neuronal support cells and secreted in the lymph of chemosensilla at extraordinarily high concentrations [8]. Both OBPs and CSPs are small (12–18 kDa) and soluble proteins which have capacities to bind reversibly small molecules [9, 10]. OBPs were usually classified in different type depend on the motif of conserved cysteines, and subdivide as typical OBPs, “Plus-C” OBPs, “Minus-C” OBPs, Dimer OBPs and Atypical OBPs. Normal OBP include pheromone binding proteins (PBPs), general odorant binding proteins (GOBPs) and antennal specific proteins (ASPs) or antennal-binding protein x (ABPx) [4, 11]. The first OBP was identified from Antheraea polyphemus and named ApolPBP1 [12]. Since then lots of OBPs and CSPs were identified and characterized in insect species [13, 14]. Generally, most of OBPs are considered to be antenna-specific, whereas CSPs are more widely distributed in different tissues of the insect body suggesting their multi-roles [15-17]. Microplitis mediator (Hymenoptera: Braconidae) is a polyphagous solitary larval endoparasitoid that parasitizes approximately 40 species of Lepidoptera insects [18]. Several odor carrier proteins including ten OBPs (MmdeOBP1–10) and one CSP (MmedCSP1) of M. mediator were identified in our previous work [19, 20]. The binding characteristics of these proteins were also investigated by using fluorophore displacement assays [20, 21]. However, some plant volatiles, such as the (Z)-3-hexenyl acetate and (E)-2-hexenal, which could elicit electrophysiological and behavioral responses of M. mediator showed no any binding affinity to above mentioned MmedOBPs and MmedCSPs [22, 23]. Thus, we suspected that there may be more OBPs and CSPs unexplored in the antennae of M. mediator, which could bind more potential semiochemicals. Encouragingly, the development of new sequencing technology provides a strong support for the discovery of these genes. In the current study, ten OBPs (MmedOBP11–20) and two CSPs (MmedCSP2–3) were newly identified from the antennal transcriptome of M. mediator. The tissue- and sex- specific expression profile was investigated by using quantitative real-time PCR (qPCR). Focusing on the functional characterization of MmedCSP3, immunocytochemistry and fluorescent competitive binding assays were performed indoors. Our results will provide a theoretical basis for further investigating the physiological roles of OBPs and CSPs in M. mediator.

Materials and methods

Insects

A colony of M. mediator was obtained from the Institute of Plant Protection, Hebei Academy of Agriculture and Forestry, China. Emerged adult parasitoids were fed with a 10% honey solution in a growth chamber under the conditions of 28 ± 1°C, 75% relative humidity, and a 16: 8 (Light: Dark) photoperiod [24]. Female antennae, male antennae, heads (without antennae), thoraxes, abdomens, legs and wings from two to three days old adult wasps were excised and immediately frozen in liquid nitrogen, then stored at –80°C before qPCR analysis.

Total RNA extraction

Total RNA was extracted from different tissue samples by using Trizol reagent (Invitrogen Carlsbad, CA, USA). The integrity of extracted RNA was checked by using 1.2% agarose gel electrophoresis, and quantified using a ND-2000 spectrophotometer (NanoDrop, Wilmington, DE, USA) at OD260 nm. The total RNA was treated with RQ1 RNase-Free DNase (Promega, Madison, USA) at 37°C for 30 min to remove residual DNA. The cDNAs were synthesized using the Fast Quant RT Kit (TianGen, Beijing, China).

Identification of OBPs and CSPs

The tBLASTn program was utilized with available sequences of OBPs and CSPs from Hymenoptera species as “query” sequences to identify candidate unigenes that encode OBPs and CSPs in M. mediator [25]. All candidate transcripts were manually checked by using BLASTx program of the NCBI website (http://blast.ncbi.nlm.nih.gov/Blast.cgi) [26]. Gene-specific primers were designed with the Beacon Designer 7 (PREMIER Bio-soft International) to amplify the sequences of MmedOBP11–20 and MmedCSP2–3 (Table 1). Each reaction (25 μl volume) containing 200 ng of cDNA from different tissues was used as a template. The cycling parameters were: 95°C for 3 min; with 35 cycles as follows: 94°C for 45 sec, 58°C for 1 min, 72°C for 1 min; and a final extension step of 10 min at 72°C. The PCR product was gel-purified and sub-cloned into the pEasy-T3 vector (TransGen, Beijing, China) and then sequencing validation was performed.
Table 1

Primers used in this study.

Primer nameForward (5'—3')Reverse (5'—3')
For sequencing
MmedOBP11ACATGGGGACTCAGTAATTTGTAAGCCATAATTTATGACATCATTGCATAGTCG
MmedOBP12CTGAAGGTAATAAGACAAGATATGGCTTAATTATATATTTTATCCTGATGCACATCC
MmedOBP13ATGAAAATAATCGCTGTTATATTCGCTGTCAGGCGCTCCTTGGAGATGGC
MmedOBP14ATGAAGGGTGTAAAAAGTATCCCTTTAATTATGGATAAAAGTAACTCGGTGCATCC
MmedOBP15ATGAAGAATATTTTATTAGGGATTTGTATCAAAATAAGTAATACGTCTTTGGTGATAC
MmedOBP16ATGAAATTATTCGCTGTATTATTCGCCTTACGAGCTCTTTTCAGTAATTATCTTAGTG
MmedOBP17GTGCTGATTTGTATCTACACCACAACCGACAGAATTTCGTAGTCACATGAAG
MmedOBP18TTCATCATTGCTATACTAGCGTTAGAAACATGTCCGTTAAACTCAGTAGTCG
MmedOBP19CCTATCTGATAGTAAAACTTCAATCAAGTTTAATTCCACCGGATAC
MmedOBP20ATGCAGATGCAAGTGAATGCTGACATTATACAAATGACACGCTCTTGAGCAC
MmedCSP2CATCAATGCTAAATAGACTGGCACCTTCAAATTTTACAAACTGCCGAG
MmedCSP3CTATAAGGAATATTTTTAACCAGACAAGACTAATTGGTGATTGACAGATTTGC
For qPCR
MmedOBP11GAAGATAGGCGACGAAGTGCATTATCATGGTGGCGGTCTC
MmedOBP12TCATGGGGGATTCAAAGTTCACCTTTTCCCAGCAGACAGA
MmedOBP13ACCTTTTCCCAGCAGACAGAGCGTGACACTTAGCCATCAA
MmedOBP14TGCAAGAGTGACGAAAGTTTTTTATCGCTGCACGAGAACAAA
MmedOBP15CCCAGTTTCGTGTCTGATGAGACTCTGGCCACTGTCCATT
MmedOBP16GAATGGTTGATGGACGACCTCTTGCGAGCTTTCTCTTCGT
MmedOBP17CGACCTTAAGCTTCGGTGTTGCCATCCTCTTGCGAGTTAT
MmedOBP18TTCCGATGCTGAATCAAGTGCCTCATTGTCAGCGTTCTCA
MmedOBP19TGACTGCAGACGGTTCTTTGGCCACATGATCTGATTGCAC
MmedOBP20GCCTTTAATGCCTGTCGGTAGCCTTTAATGCCTGTCGGTA
MmedCSP2TCTCTGCGGAGGCTGTAAATGCAGGGTTTCTCGTCCATTA
MmedCSP3TAAAGGGCCATGTGGAGAAGGTGTACCAGTCGGCGATTTT
β-actinCCGTGCTTTCTCTCTACGCTAGGTAGAGCGTAACCCTCGT
For recombinant expression
MmedCSP3TACTCACCATGGGAGACGAACTTTATTCAGATAAATATGTACTCACTCGAGTCATTTCCTGCTATCGCCGA

Note: the restriction enzyme sites used for recombinant expression are underlined.

Note: the restriction enzyme sites used for recombinant expression are underlined.

Sequence analysis

The putative N-terminal signal peptides of OBPs and CSPs were predicted using the SignalP 4.0 server (http://www.cbs.dtu.dk/services/SignalP/). The open reading frames (ORFs) and the associated amino acid sequences were determined by using GeneDoc 2.7.0 software. The phylogenetic tree for OBP and CSP was constructed based on MmedOBP/CSP sequences and orthologues in other Hymenoptera species [15, 27–29]. Amino acid sequences were aligned using the program Clustal X 2.0 [30]. A neighbor-joining tree was constructed using the MEGA 5.0 program [31] with a p-distance model and a pairwise deletion of gaps. Bootstrapping was performed by the re-sampling amino acid positions of 1000 replicates.

qPCR analysis

The relative transcript abundance of MmedOBP and MmedCSP genes in different tissue samples were evaluated by using qPCR measurement on an ABI Prism 7500 Fast Detection System (Applied Biosystems, Carlsbad, CA). The reference gene β-actin (GenBank accession number: KC193266) of M. mediator was used as the endogenous control to normalize the target gene expression and correct for any sample-to-sample variation. The primers (Table 1) of the target and reference genes were designed by Primer 3.0 program. The specificity of each primer set was validated by melt-curve analysis, and the efficiency was calculated by analyzing standard curves with a five-fold cDNA dilution series. Each qPCR reaction was conducted in a 20 μl mixture containing 10 μl of 2 × SuperReal PreMix Plus (TianGen, Beijing, China), 0.6 μl of each primer (10 μM), 0.4 μl of 50 × Rox Reference Dye, 1 μl of sample cDNA, 7.4 μl of sterilized H2O. The qPCR cycling parameters consisted of 95°C for 15 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec, and melt curves stages at 95°C for 15 sec, 60°C for 1 min, and 95°C for 15 sec. The experiments for the test samples, endogenous control and negative control were performed in triplicate to ensure reproducibility. Relative quantification was performed using the comparative 2-ΔΔCt method [32]. All of the data were normalized to endogenous β-actin levels from the same tissue samples. The cycle threshold (CT) values of OBPs and CSPs in different tissues are listed in S1 Table.

Expression and purification of recombinant MmedCSP3

MmedCSP3 was PCR-amplified using gene-specific primers (Table 1). The sample cDNA of the antennae was used as the template. The PCR product was first cloned into a pEASY-T3 Vector (Takara, Dalian, China) and then excised and cloned into an expression vector pET-30a (+) for expression in prokaryotic BL21 (DE3) cells (Takara, Dalian, China). The transformation of the strain with pET-30a (+) / MmedCSP3 was incubated in 500 mL of LB medium with 100 μg / ml kanamycin at 37°C. When the OD of the culture reached 0.4–0.6, the protein was induced with 1 mM isopropylthio-β-galactoside (IPTG) at 16°C and vibrated for 16 h at 200 rpm. The cultures were harvested by centrifugation at 12000 × g for 25 min at 4°C. The supernatant was obtained by sonication, purified by Ni ion affinity chromatography (ÄKTA avant 25, GE Healthcare, USA). Soon after the His-tag was removed with recombinant enterokinase (Novoprotein, Shanghai, China), followed by a second purification mentioned above. A 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis was conducted to check the size and purity of recombinant MmedCSP3.

Western blot analysis

Polyclonal antiserum against recombinant MmedCSP3 was obtained by injecting robust adult rabbits subcutaneously and intramuscularly with the highly purified recombinant MmedCSP3 proteins. The protein was emulsified with an equal volume of Freund’s complete adjuvant (Sigma, St. Louis, MO, USA) for the first injection (500 μg of recombinant protein) and incomplete adjuvant for the three additional injections (300 μg each time). The interval between each injection was approximately half a month, and rabbit blood was collected seven days after the last injection and centrifuged at 6000 rpm for 20 min. The serum was further purified using a MAb Trap kit (GE Healthcare, Milwaukee, WI, USA) following the manufacturer’s instructions. The rabbits were maintained in large cages at room temperature, and all of the operations were performed according to ethical guidelines to minimize the pain and discomfort of the animals. The purified recombinant MmedCSP3 were separated by 15% SDS-PAGE and then transferred to a polyvinylidene fluoride (Millipore, Carrigtwohill, Ireland) membrane. Subsequently, the membrane was blocked with 5% skimmed milk in phosphate-buffered saline (PBS) containing 0.05% Tween-20 (PBST) overnight at 4°C. After washing thrice with PBST (10 min each time), the blocked membrane was incubated with the purified rabbit anti-MmedCSP3 antiserum (dilution 1: 5,000) for 1 h at room temperature. After washings thrice with PBST, the membrane was incubated with goat anti-rabbit IgG horseradish peroxidase (HRP) conjugate and HRP-streptavidin complex (Promega, Madison, WI, USA) at a dilution of 1: 10,000 for 1 h. The membrane was then incubated with the Easy-See Western Blot kit (TransGen Biotech, Beijing, China), and exposed by Image-Quant LAS 4000 mini (GE Healthcare Bio-Sciences AB, Uppsala, Sweden).

Immunocytochemical localization

Male or female antennae of two- or three-day-old adult wasps were fixed in a mixture of paraformaldehyde (4%) and glutaraldehyde (2%) in 0.1 M PBS (pH 7.4) at room temperature for 24 h, dehydrated in an ethanol series, and embedded in LR white resin (Taab, Aldermaston, Berks, UK) for polymerization at 60°C. Ultrathin sections (60–80 nm) were cut using a diamond knife on a Reichert Ultracut ultramicrotome (Reichert Company, Vienna, Austria). For immunocytochemical assay, the grids were subsequently floated in 25 μl droplets of PBSG (PBS containing 50 mM glycine) and PBGT (PBS containing 0.2% gelatin, 1% bovine serum albumin, and 0.02% Tween-20) and incubated with purified rabbit anti-MmedCSP3 antiserum (dilution 1: 2,000) at 4°C overnight. After washing six times with PBGT, the sections were incubated with secondary antibody (anti-rabbit IgG) coupled with 10 nm colloidal gold granules (Sigma, St. Louis, MO, USA) at a dilution of 1: 20 at room temperature for 90 min. Before being observed with a Hitachi H-7500 TEM (Hitachi Ltd., Tokyo, Japan), the sections were subjected to optional silver intensification for 15 min and stained with 2% uranyl acetate to increase the contrast. The serum supernatant from an un-injected healthy rabbit at the same dilution rate acted as the negative control. Three male and female adult antennae were respectively used in immunocytochemical assays.

Fluorescence binding test

The binding abilities of MmedCSP3 to 102 candidate chemicals were measured on a fluorescence spectrometer (F-380, Tianjin, China) in a 1 cm light path quartz cuvette with 10 nm slits for both excitation and emission. The 4, 4’-dianilino-1,1’-binaphthyl-5,5’-sulfonic acid (bis-ANS, Sigma, Riedstr, Steinheim, Germany) as fluorescent probe was excited at 365 nm and emission spectra were recorded from 435 to 620 nm. The bis-ANS and all compounds were dissolved in HPLC purity-grade methanol with a concentration of 1 mM. 2 μM solution of the protein in 50 mM Tris-HCl (pH 7.4) was titrated with aliquots of bis-ANS prepared in advance to final concentrations of 2–16 μM to measure the affinity of bis-ANS to the protein. The affinities of other ligands were measured in competitive binding assays with the protein and bis-ANS at 2 μM in the presence of each competitor at 2–40 μM. The fluorescence intensities at the maximum fluorescence emission between 435 to 620 nm were plotted against the free ligand concentration to determine the binding constants. The bound chemical was evaluated based on its fluorescence intensity with the assumption that the protein was 100% active with a stoichiometry of 1: 1 (protein: ligand) saturation. The binding curves were linearized using a Scatchard plot, and the dissociation constants of the competitors were calculated from the corresponding IC50 values based on the following equation: Ki = [IC50] / (1 + [bis-ANS] / Kbis-ANS), where [bis-ANS] is the free concentration of bis-ANS and Kbis-ANS is the dissociation constant of the complex protein / bis-ANS [33].

Statistical analysis

Data analysis was performed using SPSS Statistics 18.0 software (SPSS Inc., Chicago, IL, USA). ANOVA and Tukey HSD new multiple range test (P < 0.05) were used to compare the expression of each target gene among various tissues.

Results

In the present study, a total of twenty MmedOBPs and three MmedCSPs were identified from antennal transcriptome of M. mediator. The BLASTx results indicated that ten OBPs and two CSPs were newly identified (Table 2), which were named as MmedOBP11–20 and MmedCSP2–3, respectively, based on our previous work [20]. Besides MmedOBP12, MmedOBP14 and MmedOBP20, all other proteins had intact ORFs and encoded polypeptides with signal peptide (Fig 1A). All the twenty MmedOBPs had six conserved cysteine residues, while three MmedCSPs had four conserved cysteine residues (Fig 1B). After sequencing, all sequences of newly identified MmedOPBs and MmedCSPs were deposited in GenBank with the accession numbers listed in Table 2. The phylogenetic tree showed that OBPs and CSPs almost clustered in two distinct groups. Fourteen MmedOBPs are clustered in four species-specific clades, whereas six MmedOBPs were significantly divergent from each other and clustered together with their orthologs in other species (Fig 2). Each of the MmedCSPs was clustered together with the CSPs from other Hymenoptera species.
Table 2

OBPs and CSPs newly identified in antennae of M. mediator.

GenesORFLength (aa)Accession numberSignal Peptide (aa)Best BLASTx hit
SpeciesProtein IDE-valueIdentity
MmedOBP11423141KU3425731–17Microplitis demolitorXP_008548248.12e-4155
MmedOBP12402134KU342574NDM. demolitorAJM71483.11e-1731
MmedOBP13420140KU3425751–17M. demolitorXP_008548248.11e-5969
MmedOBP14450150KU342576NDM. demolitorXP_008543322.12e-2940
MmedOBP15435145KU3425771–17M. demolitorXM_008561265.17e-8798
MmedOBP16420140KU3425781–17M. demolitorXP_008548247.13e-6983
MmedOBP17420140KU3425791–17M. demolitorXP_008548248.18e-7393
MmedOBP18468156KU3425801–21M. demolitorXP_008543433.15e-3449
MmedOBP19414138KU3425811–19Fopius arisanusXP_011312148.18e-2842
MmedOBP20348116KU342582NDM. demolitorXP_008546277.13e-78100
MmedCSP2453151KU3425831–23Camponotus japonicusBAS29778.11e-4267
MmedCSP3357119KU3425841–18Apis ceranaACI03402.12e-2745

Note: aa, amino acids; ND, not detected.

Fig 1

Sequence alignment of all identified OBPs and CSPs in M. mediator.

A: Sequence alignment of OBPs, six conserved cysteine residues are marked in black; B: Sequence alignment of CSPs, four conserved cysteine residues are marked in black. Predicted signal peptides are boxed in the figure.

Fig 2

Phylogenetic tree of OBPs and CSPs from Hymenoptera species.

Mmed (red): M. mediator; Ccun (purple): Chouioia cunea; Ssp (green): Sclerodermus sp.; Amel (blue): Apis mellifera.

Sequence alignment of all identified OBPs and CSPs in M. mediator.

A: Sequence alignment of OBPs, six conserved cysteine residues are marked in black; B: Sequence alignment of CSPs, four conserved cysteine residues are marked in black. Predicted signal peptides are boxed in the figure.

Phylogenetic tree of OBPs and CSPs from Hymenoptera species.

Mmed (red): M. mediator; Ccun (purple): Chouioia cunea; Ssp (green): Sclerodermus sp.; Amel (blue): Apis mellifera. Note: aa, amino acids; ND, not detected.

Tissue expression profiles of MmedOBPs and MmedCSPs

The qPCR results showed that only two OBPs, MmedOBP14 and MmedOBP18, were highly expressed in antennae (Fig 3). MmedOBP14 was specific expressed in antennae of male wasps, while MmedOBP18 had slightly high expressions in antennae of female adults. Interestingly, some MmedOBPs were mainly expressed in non-olfactory tissues. MmedOBP15 was mainly expressed in the heads of wasps, MmedOBP19 was primarily expressed in the legs rather than in the antennae, MmedOBP20 was only detected in the abdomen, MmedOBP12 and MmedOBP13 were primarily expressed in the heads and thoraxes; while three OBPs (MmedOBP11, 16, 17) were highly enriched in the thoraxes. Two MmedCSPs were mainly expressed in the antennae of adult wasps. The transcript level of MmedCSP2 was higher in females than in males, while MmedCSP3 showed high expressions in antennae of both male and female wasps.
Fig 3

qPCR analysis of MmedOBPs and MmedCSPs expression in different tissues.

The error bars represent standard error and the different small letters above each bar indicate significant differences in transcript abundances (P < 0.05).

qPCR analysis of MmedOBPs and MmedCSPs expression in different tissues.

The error bars represent standard error and the different small letters above each bar indicate significant differences in transcript abundances (P < 0.05).

Location of MmedCSP3 in antennae

Focusing on MmedCSP3, the anti-MmedCSP3 antiserums were used to mark the cellular localization of MmedCSP3 in antennal sensilla of M. mediator. Western blot analysis showed that the antibody could specifically bind to the purified recombinant MmedCSP3 (Fig 4). Immunolocalization results indicated that MmedCSP3 could be labeled in the sensilla basiconca type 2 (Fig 5A and 5B). The gold granules were concentrated at the sensillum lymph in the sensillum hair lumen and the cavity below the hair base. However, there was no MmedCSP3 labeled in the sensilla placodea. Immunolocalization data of MmedCSP3 in antennal sensilla of males were consistent with that in female antennae.
Fig 4

SDS-PAGE and western blot analysis of recombinant MmedCSP3.

M: Molecular weight marker; 1: Non-induced pET-30a (+) / MmedCSP3; 2: Induced pET-30a (+) / MmedCSP3; 3: pET-30a (+) / MmedCSP3 supernatant; 4: pET-30a (+) / MmedCSP3 pellet; 5: Purified MmedCSP3 with His-tag; 6: Purified MmedCSP3 without His-tag; 7: Western blot analysis of MmedCSP3.

Fig 5

Immunocytochemical localization of MmedCSP3 in sensilla on female antennae.

(A): The sensilla basiconica type 2 was labeled strongly, whereas the sensilla placodea were not labeled. (B): The sensillum lymph in the sensilla basiconica type 2 was strong labeled. sp, s. placodea; st, s. trichodea; c, cavity; d, dendrites; p, pore; w, sensillum wall.

SDS-PAGE and western blot analysis of recombinant MmedCSP3.

M: Molecular weight marker; 1: Non-induced pET-30a (+) / MmedCSP3; 2: Induced pET-30a (+) / MmedCSP3; 3: pET-30a (+) / MmedCSP3 supernatant; 4: pET-30a (+) / MmedCSP3 pellet; 5: Purified MmedCSP3 with His-tag; 6: Purified MmedCSP3 without His-tag; 7: Western blot analysis of MmedCSP3.

Immunocytochemical localization of MmedCSP3 in sensilla on female antennae.

(A): The sensilla basiconica type 2 was labeled strongly, whereas the sensilla placodea were not labeled. (B): The sensillum lymph in the sensilla basiconica type 2 was strong labeled. sp, s. placodea; st, s. trichodea; c, cavity; d, dendrites; p, pore; w, sensillum wall.

Fluorescence binding assay

The relative affinities of the recombinant MmedCSP3 with 102 candidate compounds were evaluated by fluorescence binding assays (Table 3). The candidate compounds were selected from known plant volatiles and some specific host insect odorants. The dissociation constant of the MmedCSP3 / bis-ANS complexes was 1.75 ± 0.42 μM (Fig 6A). Among the tested compounds, only nine chemicals showed certain affinities with MmedCSP3. The selected plant volatiles, (3E, 7E)-4, 8, 12-trimethyltrideca-1, 3, 7, 11-tetraene (TMTT), 1, 1-dimethyl-2-[4-(5-nitrofuran-2-yl)-1,3-thiazol-2-yl] hydrazine (DMNT), ethyl butyrate, and medthyl salicylate exhibited relatively weak binding abilities with MmedCSP3, and the Ki values ranged from 26.79 μM to 39.22 μM (Fig 6B). Interestingly, octadecenoic acid, palmitic acid, three sex pheromone components of Noctuidae insects, cis-11-hexadecenyl aldehyde (Z11-16: Ald), cis-11-hexadecanol (Z11-16: OH), and trans-11-tetradecenyl acetate (E11-14: Ac), displayed high binding abilities, and the Ki values ranged from 17.24 μM to 22.20 μM (Fig 6C and 6D).
Table 3

Binding affinities of selected ligands with recombinant MmedCSP3.

LigandsCAS NumberKi (μM)
cis-11-hexadecanol a56683-54-617.55 ± 1.19
cis-11-hexadecenyl Aldehyde a53939-28-917.24 ± 1.67
trans-11-tetradecenyl acetate a33189-72-918.77 ± 2.06
Ethyl butyrate b105-54-432.87 ± 7.43
Methyl salicylate b119-36-839.22 ± 0.25
TMTT b62235-06-726.79 ± 1.27
DMNT b26049-69-428.41 ± 1.05
Octadecenoic acid c112-80-118.21 ± 1.74
Palmitic acid c57-10-322.2 ± 1.82

Note:

, sex pheromone components of Noctuidae insects.

, plant volatiles

, volatiles of both plants and insects.

Ki, dissociation constant, affinities (mean ± SD) measured in μM.

More potential ligands were tested, but the remaining 93 potential ligands did not bind the MmedCSP3. These compounds were 12-bromododecan-1-ol, 1,8-cineole, carveol, citronellol, (E, E)-farnesol, geraniol, hexanol, 2-hexanol, 3-hexanol, (E)-2-hexen-1-ol, (Z)-3-hexen-1-ol, (E)-3-hexen-1-ol, isooctan-1-ol, linalool, nerol, nerolidol, 1-octanol, pentanol, phytol, cis-9-tetradecenyl acetate, benzaldehyde, citral, decanal, 3,4-dimethyl-benzaldehyde, 4-ethylbenzaldehyde, hexanal, (E)-2-hexen-1-al, cis-9-hexadecenal, heptanal, (Z)-9-tetradecenal, nonanal, octanal, valeric aldehyde, amyl butyrate, butyl butyrate, butyl formate, cis-5-decenylacetate, (Z)-8-dodecenyl acetate, (Z)-7-dodecenyl acetate, ethyl caprylate, ethyl heptanoate, ethyl laurate, ethyl phenylacetate, geranyl acetate, heptyl acetate, hexyl hexanoate, (Z)-11-hexadecenyl acetate, hexyl acetate, (Z)-3-hexenyl acetate, (Z)-3-hexenyl hexanoate, (Z)-3-hexenyl butyrate, (E)-2-hexenyl butyrate, linalyl acetate, methyl jasmonate, methyl phenylacetate, nonanyl acetate, octadecyl acetate, octyl acetate, pentyl acetate, 2-phenylethyl acetate, cis-9-tetradecenyl acetate, (Z, E)-9, 11-tetradecadienyl acetate, (Z, E)-9, 12-tetradecenyl acetate, 2-heptanone, 2-hexanone, 3-hexanone, β-ionone, 2-nonanone, 2-octanone, carvacrol, indole, 2-methylnaphthalene, naphthalene, m-xylene, camphene, (1S)-(+)-3-carene, β-caryophyllene, α-farnesene, α-humulene, (S)-(-)-limonene, myrcene, β-ocimene, (-)-α-phellandrene, β-pinene, α-terpinene, terpinolene, decane, dodecane, octane, tridecane, undecane, linolic acid, and stearic acid.

Fig 6

Binding characteristic of selected ligands to MmedCSP3.

(A) Binding curve and relative Scatchard plot of bis-ANS to MmedCSP3. (B) Competitive binding curves of four selected plant volatiles to MmedCSP3 (C) Competitive binding curves of three sex pheromone components to MmedCSP3. (D) Competitive binding curved of two fatty acids to MmedCSP3.

Binding characteristic of selected ligands to MmedCSP3.

(A) Binding curve and relative Scatchard plot of bis-ANS to MmedCSP3. (B) Competitive binding curves of four selected plant volatiles to MmedCSP3 (C) Competitive binding curves of three sex pheromone components to MmedCSP3. (D) Competitive binding curved of two fatty acids to MmedCSP3. Note: , sex pheromone components of Noctuidae insects. , plant volatiles , volatiles of both plants and insects. Ki, dissociation constant, affinities (mean ± SD) measured in μM. More potential ligands were tested, but the remaining 93 potential ligands did not bind the MmedCSP3. These compounds were 12-bromododecan-1-ol, 1,8-cineole, carveol, citronellol, (E, E)-farnesol, geraniol, hexanol, 2-hexanol, 3-hexanol, (E)-2-hexen-1-ol, (Z)-3-hexen-1-ol, (E)-3-hexen-1-ol, isooctan-1-ol, linalool, nerol, nerolidol, 1-octanol, pentanol, phytol, cis-9-tetradecenyl acetate, benzaldehyde, citral, decanal, 3,4-dimethyl-benzaldehyde, 4-ethylbenzaldehyde, hexanal, (E)-2-hexen-1-al, cis-9-hexadecenal, heptanal, (Z)-9-tetradecenal, nonanal, octanal, valeric aldehyde, amyl butyrate, butyl butyrate, butyl formate, cis-5-decenylacetate, (Z)-8-dodecenyl acetate, (Z)-7-dodecenyl acetate, ethyl caprylate, ethyl heptanoate, ethyl laurate, ethyl phenylacetate, geranyl acetate, heptyl acetate, hexyl hexanoate, (Z)-11-hexadecenyl acetate, hexyl acetate, (Z)-3-hexenyl acetate, (Z)-3-hexenyl hexanoate, (Z)-3-hexenyl butyrate, (E)-2-hexenyl butyrate, linalyl acetate, methyl jasmonate, methyl phenylacetate, nonanyl acetate, octadecyl acetate, octyl acetate, pentyl acetate, 2-phenylethyl acetate, cis-9-tetradecenyl acetate, (Z, E)-9, 11-tetradecadienyl acetate, (Z, E)-9, 12-tetradecenyl acetate, 2-heptanone, 2-hexanone, 3-hexanone, β-ionone, 2-nonanone, 2-octanone, carvacrol, indole, 2-methylnaphthalene, naphthalene, m-xylene, camphene, (1S)-(+)-3-carene, β-caryophyllene, α-farnesene, α-humulene, (S)-(-)-limonene, myrcene, β-ocimene, (-)-α-phellandrene, β-pinene, α-terpinene, terpinolene, decane, dodecane, octane, tridecane, undecane, linolic acid, and stearic acid.

Discussion

In the present study, we obtained 20 OBPs and 3 CSPs from the antennal transcriptome of M. mediator, among them 10 OBPs and 2 CSPs were newly reported. There are 52 OBPs and 4 CSPs identified in Drosophila melanogaster [34], 45 OBPs and 16 CSPs in Bombyx mori [35], while Apis mellifera has 21 OBPs and 6 CSPs [15, 27], C. cunea has 25 OBPs and 11 CSPs [28]. The total number of OBPs and CSPs in M. mediator is smaller than in D. melanogaster and B. mori, but similar to those in A. mellifera and C. cunea. We suspected that there was less OBPs and CSPs in Hymenoptera insects. Of course, some potential OBPs and CSPs may not able to be identified in M. mediator due to low expressions level in the antennae or specific expression in other tissues. Both MmedOBP1–10 and MmedCSP1 have been reported highly abundant or specific in the antennae of M. mediator [19, 20]. In the current study, MmedOBP14, MmedOBP18 and MmedCSP2–3 were abundantly expressed in the antennae of wasps. Antennae-enriched odor carrier proteins of M. mediator play important roles in detecting mates and locating suitable hosts. In insects, most OBPs are specifically or mainly expressed in chemosensory organs, whereas some OBPs are also expressed in non-chemosensory organs suggesting their potential non-olfactory functions. For example, MmedOBP20 was highly expressed in abdomen, which might be involved in the physiological process of reproduction. Generally, CSPs are considered to be widely distributed throughout the body of insects. However, antenna-specific CSPs were also reported in the Adelphocoris lineolatus [16, 33]. MmedCSP2–3 were mainly expressed in antennae of both sexes suggesting important roles in chemoreception of M. mediator. There are six types of sensilla including sensilla basiconica identified in antennae of M. mediator [36, 37]. Sensilla basiconica are multiporous chemosensilla [38]. MmedCSP3 had high level in sensillar lymph of sensilla basiconica type 2 indicating its roles in olfactory perception of M. mediator. In fluorescence competitive binding assays, MmedOBP3 showed certain binding affinities with selected plant volatiles. TMTT and methyl salicylate are components of herbivore induced plant volatiles (HIPVs), which are considered dependable cues for foraging parasitoids [39, 40]. Palmitic acid and octadecenoic acid are long-chain free fatty acids, which are commonly found both in plants and insects [41]. It was demonstrated that female Cotesia glomerata could use fatty acids from host-damaged leaves to search host insects [42]. MmedOBP3 of M. mediator may play important roles in detecting plant volatiles, and we proposed that M. mediator could use plant volatiles or insect odors to locate hosts or sexual partners. Two semiochemicals, Z11-16: Ald and Z11-16: OH are main sex pheromone components of cotton bollworm [43, 44], E11-14: Ac is a sex pheromone component of Spodoptera litura [45]. Interestingly, in the present study, MmedCSP3 displayed high binding affinities with these three chemicals. It was reported that cotesia plutellae could be attracted by the sex pheromones of its host, plutella xylostella [46]. MmedCSP3 may be involved in perception of host insect sex pheromones. M. mediator could locate host insects by the detection of insect sex pheromones. Therefore, MmedCSP3 may play important roles in chemoreception of M. mediator. The MmedCSP3 could be used as a potential target to regulate the olfactory behavior of parasitic wasps. However, gene editing and behavioral assays need to be further performed to verify the roles of this protein.

The cycle threshold (CT) value of OBPs and CSPs in different tissues.

(DOC) Click here for additional data file.
  36 in total

1.  Binding characterization of recombinant odorant-binding proteins from the parasitic wasp, Microplitis mediator (Hymenoptera: Braconidae).

Authors:  Shuai Zhang; Li-Zhen Chen; Shao-Hua Gu; Jin-Jie Cui; Xi-Wu Gao; Yong-Jun Zhang; Yu-Yuan Guo
Journal:  J Chem Ecol       Date:  2010-12-24       Impact factor: 2.626

2.  Using CLUSTAL for multiple sequence alignments.

Authors:  D G Higgins; J D Thompson; T J Gibson
Journal:  Methods Enzymol       Date:  1996       Impact factor: 1.600

3.  Identification and binding characterization of three odorant binding proteins and one chemosensory protein from Apolygus lucorum (Meyer-Dur).

Authors:  Jin-Feng Hua; Shuai Zhang; Jin-Jie Cui; Dao-Jie Wang; Chun-Yi Wang; Jun-Yu Luo; Li-Min Lv
Journal:  J Chem Ecol       Date:  2012-10-02       Impact factor: 2.626

4.  Olfactory responses of Plutella xylostella natural enemies to host pheromone, larval frass, and green leaf cabbage volatiles.

Authors:  G V P Reddy; J K Holopainen; A Guerrero
Journal:  J Chem Ecol       Date:  2002-01       Impact factor: 2.626

5.  Identification and expression pattern of putative odorant-binding proteins and chemosensory proteins in antennae of the Microplitis mediator (Hymenoptera: Braconidae).

Authors:  Shuai Zhang; Yong-Jun Zhang; Hong-Hua Su; Xi-Wu Gao; Yu-Yuan Guo
Journal:  Chem Senses       Date:  2009-06-04       Impact factor: 3.160

6.  Cloning and expression profile of ionotropic receptors in the parasitoid wasp Microplitis mediator (Hymenoptera: Braconidae).

Authors:  Shan-Ning Wang; Yong Peng; Zi-Yun Lu; Khalid Hussain Dhiloo; Yao Zheng; Shuang Shan; Rui-Jun Li; Yong-Jun Zhang; Yu-Yuan Guo
Journal:  J Insect Physiol       Date:  2016-05-18       Impact factor: 2.354

7.  Pheromone binding and inactivation by moth antennae.

Authors:  R G Vogt; L M Riddiford
Journal:  Nature       Date:  1981 Sep 10-16       Impact factor: 49.962

8.  Structure of Bombyx mori chemosensory protein 1 in solution.

Authors:  Séverine Jansen; Josef Chmelík; Lukás Zídek; Petr Padrta; Petr Novák; Zbynek Zdráhal; Jean-François Picimbon; Christer Löfstedt; Vladimír Sklenár
Journal:  Arch Insect Biochem Physiol       Date:  2007-11       Impact factor: 1.698

9.  Functional differentiation of pheromone-binding proteins in the common cutworm Spodoptera litura.

Authors:  Nai-Yong Liu; Cheng-Cheng Liu; Shuang-Lin Dong
Journal:  Comp Biochem Physiol A Mol Integr Physiol       Date:  2013-03-16       Impact factor: 2.320

10.  Identification of a distinct family of genes encoding atypical odorant-binding proteins in the malaria vector mosquito, Anopheles gambiae.

Authors:  P X Xu; L J Zwiebel; D P Smith
Journal:  Insect Mol Biol       Date:  2003-12       Impact factor: 3.585

View more
  12 in total

1.  Spatial Expression Analysis of Odorant Binding Proteins in Both Sexes of the Aphid Parasitoid Aphidius gifuensis and Their Ligand Binding Properties.

Authors:  Xin Jiang; Yaoguo Qin; Jun Jiang; Yun Xu; Frédéric Francis; Jia Fan; Julian Chen
Journal:  Front Physiol       Date:  2022-05-04       Impact factor: 4.755

2.  Silencing of Chemosensory Protein Gene NlugCSP8 by RNAi Induces Declining Behavioral Responses of Nilaparvata lugens.

Authors:  Muhammad I Waris; Aneela Younas; Muhammad T Ul Qamar; Liu Hao; Asif Ameen; Saqib Ali; Hazem Elewa Abdelnabby; Fang-Fang Zeng; Man-Qun Wang
Journal:  Front Physiol       Date:  2018-04-12       Impact factor: 4.566

Review 3.  Odorant Receptors and Odorant-Binding Proteins as Insect Pest Control Targets: A Comparative Analysis.

Authors:  Herbert Venthur; Jing-Jiang Zhou
Journal:  Front Physiol       Date:  2018-08-24       Impact factor: 4.566

4.  Genome of the Parasitoid Wasp Diachasma alloeum, an Emerging Model for Ecological Speciation and Transitions to Asexual Reproduction.

Authors:  Eric S Tvedte; Kimberly K O Walden; Kyle E McElroy; John H Werren; Andrew A Forbes; Glen R Hood; John M Logsdon; Jeffrey L Feder; Hugh M Robertson
Journal:  Genome Biol Evol       Date:  2019-10-01       Impact factor: 3.416

5.  Molecular characterization and expression of sensory neuron membrane proteins in the parasitoid Microplitis mediator (Hymenoptera: Braconidae).

Authors:  Shuang Shan; Shan-Ning Wang; Xuan Song; Adel Khashaveh; Zi-Yun Lu; Khalid Hussain Dhiloo; Rui-Jun Li; Xi-Wu Gao; Yong-Jun Zhang
Journal:  Insect Sci       Date:  2019-03-14       Impact factor: 3.262

6.  Antennal transcriptome sequencing and identification of candidate chemoreceptor proteins from an invasive pest, the American palm weevil, Rhynchophorus palmarum.

Authors:  Francisco Gonzalez; Jibin Johny; William B Walker; Binu Antony; Qingtian Guan; Sara Mfarrej; Jernej Jakše; Nicolas Montagné; Emmanuelle Jacquin-Joly; Abdulaziz A Alqarni; Mohammed Ali Al-Saleh; Arnab Pain
Journal:  Sci Rep       Date:  2021-04-15       Impact factor: 4.379

7.  Identification and characterization of soluble binding proteins associated with host foraging in the parasitoid wasp Diachasmimorpha longicaudata.

Authors:  Juan P Wulff; Diego F Segura; Francisco Devescovi; Irina Muntaabski; Fabian H Milla; Alejandra C Scannapieco; Jorge L Cladera; Silvia B Lanzavecchia
Journal:  PLoS One       Date:  2021-06-17       Impact factor: 3.240

8.  Identification, Expression Patterns, and Functional Characterization of Chemosensory Proteins in Dendroctonus armandi (Coleoptera: Curculionidae: Scolytinae).

Authors:  Zhumei Li; Lulu Dai; Honglong Chu; Danyang Fu; Yaya Sun; Hui Chen
Journal:  Front Physiol       Date:  2018-03-27       Impact factor: 4.566

9.  Characterization of antennal chemosensilla and associated odorant binding as well as chemosensory proteins in the parasitoid wasp Microplitis mediator (Hymenoptera: Braconidae).

Authors:  Shan-Ning Wang; Shuang Shan; Jing-Tao Liu; Rui-Jun Li; Zi-Yun Lu; Khalid Hussain Dhiloo; Adel Khashaveh; Yong-Jun Zhang
Journal:  Sci Rep       Date:  2018-05-16       Impact factor: 4.379

10.  The whole body transcriptome of Coleophora obducta reveals important olfactory proteins.

Authors:  Dongbai Wang; Jing Tao; Pengfei Lu; Youqing Luo; Ping Hu
Journal:  PeerJ       Date:  2020-04-10       Impact factor: 2.984

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.