Visceral adiposity confers significant risk for developing metabolic disease in obesity whereas preferential expansion of subcutaneous white adipose tissue (WAT) appears protective. Unlike subcutaneous WAT, visceral WAT is resistant to adopting a protective thermogenic phenotype characterized by the accumulation of Ucp1+ beige/BRITE adipocytes (termed 'browning'). In this study, we investigated the physiological consequences of browning murine visceral WAT by selective genetic ablation of Zfp423, a transcriptional suppressor of the adipocyte thermogenic program. Zfp423 deletion in fetal visceral adipose precursors (Zfp423loxP/loxP; Wt1-Cre), or adult visceral white adipose precursors (PdgfrbrtTA; TRE-Cre; Zfp423loxP/loxP), results in the accumulation of beige-like thermogenic adipocytes within multiple visceral adipose depots. Thermogenic visceral WAT improves cold tolerance and prevents and reverses insulin resistance in obesity. These data indicate that beneficial visceral WAT browning can be engineered by directing visceral white adipocyte precursors to a thermogenic adipocyte fate, and suggest a novel strategy to combat insulin resistance in obesity.
Visceral adiposity confers significant risk for developing metabolic disease in obesity whereas preferential expansion of subcutaneous white adipose tissue (WAT) appears protective. Unlike subcutaneous WAT, visceral WAT is resistant to adopting a protective thermogenic phenotype characterized by the accumulation of Ucp1+ beige/BRITE adipocytes (termed 'browning'). In this study, we investigated the physiological consequences of browning murinevisceral WAT by selective genetic ablation of Zfp423, a transcriptional suppressor of the adipocyte thermogenic program. Zfp423 deletion in fetal visceral adipose precursors (Zfp423loxP/loxP; Wt1-Cre), or adult visceral white adipose precursors (PdgfrbrtTA; TRE-Cre; Zfp423loxP/loxP), results in the accumulation of beige-like thermogenic adipocytes within multiple visceral adipose depots. Thermogenic visceral WAT improves cold tolerance and prevents and reverses insulin resistance in obesity. These data indicate that beneficial visceral WAT browning can be engineered by directing visceral white adipocyte precursors to a thermogenic adipocyte fate, and suggest a novel strategy to combat insulin resistance in obesity.
Entities:
Keywords:
Zfp423; beige adipocytes; diabetes; human biology; medicine; mouse; mural cells; obesity; white adipocytes
Adipocytes are critical regulators of energy balance and nutrient homeostasis. White adipocytes serve as the principal site for energy storage in mammals. These cells are characterized by a large unilocular lipid droplet and have the capacity to store or release energy depending on metabolic demand. White adipocytes also produce and secrete numerous cytokines and hormones that impact several aspects of physiology (Rosen and Spiegelman, 2014). Eutherian mammals also contain a second major class of adipocytes that function to catabolize stored lipids and produce heat. These thermogenic adipocytes, consisting of brown and beige/BRITE adipocytes, are characterized by their multilocular lipid droplet appearance, high mitochondrial content, and expression of uncoupling protein 1 (Ucp1) (Cohen and Spiegelman, 2015; Harms and Seale, 2013). Brown/beige adipocytes have promising therapeutic potential as their activation in the setting of obesity has a profound impact on metabolic health.White adipose depots are broadly categorized as either subcutaneous or visceral adipose tissue, reflecting their anatomical location. Adipose tissue distribution is a strong predictor of metabolic outcome in obese individuals (Karpe and Pinnick, 2015; Lee et al., 2013). Visceral adiposity strongly correlates with the development of insulin resistance, diabetes, and cardiovascular disease (Kissebah et al., 1982; Krotkiewski et al., 1983; Ohlson et al., 1985; Vague, 1956). Preferential expansion of subcutaneous depots is associated with sustained insulin sensitivity (Manolopoulos et al., 2010). Engineered rodent models highlight the protective role of subcutaneous adipose tissue. Transgenic animals overexpressing adiponectin or mitoNEET develop extreme subcutaneous obesity; however, these animals remain metabolically healthy (Kim et al., 2007; Kusminski et al., 2012).In humans, the location of visceral adipose tissue itself likely mediates some of its detrimental effects on energy metabolism; lipids, metabolites, and cytokines can drain directly into the portal circulation and affect liver function (Rytka et al., 2011). Transplantation studies, cellular studies, and gene expression analyses, suggest that factors intrinsic to these depots may also determine their effect on nutrient homeostasis (Tran et al., 2008; Yamamoto et al., 2010). Anatomically distinct adipocytes are functionally unique, differing in their ability to undergo lipolysis, lipogenesis, and activate the thermogenic gene program (Lee et al., 2013; Macotela et al., 2012; Morgan-Bathke et al., 2015; Wu et al., 2012). Along these lines, lineage analyses reveal that anatomically distinct white adipocytes can originate from developmentally distinct precursor cells, and emerge at different times during development (Billon and Dani, 2012; Chau et al., 2014). As such, it is now widely believed that visceral and subcutaneous adipocytes represent distinct subtypes of fat cells.In mice, visceral and subcutaneous white adipose depots differ remarkably in their ability to remodel under physiological conditions (Hepler and Gupta, 2017). Upon high-fat diet feeding, visceral adipose depots of mice expand by both adipocyte hypertrophy and through the formation of new adipocytes (‘adipogenesis’) (Wang et al., 2013). Inguinal subcutaneous WAT expands predominantly through adipocyte hypertrophy. The differential capacity for adipogenesis is likely explained by factors present in the local microenvironment (Jeffery et al., 2016). Another notable difference between the inguinal and visceral adipose depots in rodents is the capacity to adopt a thermogenic phenotype. Various stimuli, including β3-adrenergic receptor-agonism and cold exposure, drive the rapid accumulation of beige adipocytes in subcutaneous depots (Vitali et al., 2012; Wu et al., 2012). Genetic stimulation of subcutaneous beige adipogenesis renders mice resistant to high-fat diet induced obesity and/or diabetes (Seale et al., 2011; Shao et al., 2016), while inhibition of subcutaneous beiging leads to an earlier onset of insulin resistance during obesity (Cohen et al., 2014). Most visceral depots in mice, particularly the gonadal and mesenteric adipose tissues, are relatively resistant to browning in response to physiological stimuli. With few exceptions (Kiefer et al., 2012), most engineered mouse models of white adipose tissue browning exhibit beige cell accumulation preferentially in subcutaneous WAT depots (Seale et al., 2011; Stine et al., 2016). Visceral WAT depots may harbor mechanisms to suppress thermogenesis to ensure its function as a white, energy-storing, depot.We previously established a critical role for the transcription factor, Zfp423, in the establishment and maintenance of the adipocyte lineage. Zfp423 is required for fetal differentiation of subcutaneous white adipocytes (Gupta et al., 2010; Shao et al., 2017). In adult mice, Zfp423 expression defines a subset of committed mural preadipocytes (Gupta et al., 2012; Vishvanath et al., 2016). Upon high-fat diet feeding, these mural cells undergo adipogenesis in visceral depots, contributing to adipocyte hyperplasia (Vishvanath et al., 2016). Zfp423 is also expressed in nearly all mature adipocytes; however, its expression is more abundant in white adipocytes than brown adipocytes (Shao et al., 2016). In the mature adipocyte, Zfp423 acts to maintain the energy-storing status of the white adipocyte through suppression of the thermogenic gene program (Shao et al., 2016). Zfp423 likely exerts this function by serving as a transcriptional co-repressor of the brown/beige lineage determining transcription factor, Ebf2. The loss of Zfp423 in mature white adipocytes triggers a robust conversion of white to beige adipocytes in subcutaneous WAT. Amongst the various adipose tissues, visceral WAT expresses the highest levels of Zfp423. Importantly, we observed that visceral adipocytes lacking Zfp423 were also capable of inducing their thermogenic gene program when animals were stimulated pharmacologically with a β3 adrenergic receptor agonist (Shao et al., 2016). This observation affords the possibility of examining whether the thermogenic capacity of visceral white adipose depots can be unlocked under physiological conditions, and whether thermogenic visceral WAT would be ultimately harmful or beneficial to systemic metabolic health.Here, we describe two mouse models of visceral adipose tissue browning derived through selective ablation of Zfp423 in visceral adipose precursors. We reveal that fetal visceral white preadipocytes can be redirected to a beige-like adipocyte fate through the loss of Zfp423, leading to visceral depot mass reduction and fat redistribution towards subcutaneous depots. The browning of visceral depots improves cold tolerance and protects against the development of insulin resistance and hyperlipidemia in obesity. Moreover, we demonstrate that visceral mural preadipocytes in adult mice can also be directed to a thermogenic cell fate; this leads to beige-like, rather than white, adipocyte hyperplasia, in the expanding visceral WAT depots of diet-induced obese animals. Upon activation by β−3 adrenergic receptor agonism, these beige-like adipocytes can trigger an amelioration of insulin resistance in obese animals. Together, these data establish Zfp423 as a physiological suppressor of the thermogenic gene program in visceral WAT and provide proof of concept that the thermogenic capacity of visceral WAT can be induced under physiological conditions through removal of this molecular brake on the thermogenic gene program in adipose precursors. These data also highlight the potential of visceral WAT, much like subcutaneous WAT, to improve nutrient homeostasis in obesity when a thermogenic beige-like phenotype is induced.
Results
Selective ablation of Zfp423 in fetal visceral white adipocyte precursors leads to the formation of thermogenic visceral adipose depots
We hypothesized that the thermogenic capacity of visceral white adipose depots can be unlocked under physiological conditions through removal of Zfp423, and that engineered visceral thermogenic adipocytes can drive improvements in systemic metabolic health. To test this, we derived a mouse model in which Zfp423 is selectively inactivated in visceral, but not subcutaneous, WAT depots or classic brown adipose tissue depots (BAT). These animals were generated by breeding transgenic mice expressing Cre recombinase under the control of the Wilms Tumor one locus (Wt1-Cre) to animals carrying the floxed Zfp423 alleles (Zfp423loxP/loxP) (Figure 1A) (Zfp423loxP/loxP; Wt1-Cre animals, herein ‘Vis-KO’ mice). Wt1-Cre mice targets Wt1-expressing cells of the embryonic mesothelium, as well as descending cells, which include, adult mesothelial cells and intra-abdominal stromal cells within or surrounding visceral organs. Hastie and colleagues revealed that visceral white adipocytes, but not subcutaneous or classic brown adipocytes, descend from Wt1-expessing progenitors and are targeted by Wt1-Cre (Chau et al., 2014). Specifically, Wt1-Cre targets the majority of gonadal adipocyte precursors and variable numbers of precursors in other visceral depots, including the mesenteric and retroperitoneal depots. Analysis of mRNA expression from multiple fat depots in Vis-KO mice confirmed the deletion of Zfp423 was selective to visceral WAT depots (Figure 1B).
Figure 1.
Deletion of Zfp423 in fetal visceral white adipocyte precursors leads to the formation of thermogenic adipocytes in visceral depots.
(A) A mouse model of visceral WAT selective ablation of Zfp423 (Visceral-Knockout or ‘Vis-KO’) was derived by breeding animals expressing the gene encoding Cre recombinase under the control of the Wilms Tumor 1 (WT1) promoter to animals carrying floxed Zfp423 alleles (Zfp423loxP/loxP). Littermates carrying only Zfp423loxp/loxP alleles were used as control animals. (B) Fold change in mRNA levels within brown (BAT), inguinal (iWAT), gonadal (gWAT), mesenteric (mWAT), or retroperitoneal (rWAT) adipose tissue of control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 6 mice. (C) Body weight of control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. n = 6 mice. (D) Fat pad weight (normalized to body weight) of control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 6 mice. (E– F) Fold change in mRNA levels of mature adipocyte genes (E) and thermogenic genes (F) isolated from whole adipose tissue from control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 6 mice. (G) mRNA levels (normalized to Rps18) of Ucp1 isolated from whole adipose tissue from control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 6 mice. (H–K) Relative basal oxygen consumption rates (OCRs) within diced gWAT (H), mWAT (I), rWAT (J), and iWAT (K) from control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 4 independent replicates pooled from two mice. (L–O) Representative immunofluorescence staining of Perilipin (green) and DAPI (blue) in mWAT sections obtained from control (L, M) and Vis-KO (N, O) mice at 8 weeks of age. Scale bar, 200 μM. Panels M and O represent digital enhancements of the boxed regions shown in L and N, respectively.
DOI:
http://dx.doi.org/10.7554/eLife.27669.003
Scale bar = 200 μM. Panels B,D,F,H,J, and L represent digital enhancements of the boxed regions shown in A, C, E, G, I, and K, respectively.
DOI:
http://dx.doi.org/10.7554/eLife.27669.004
Deletion of Zfp423 in fetal visceral white adipocyte precursors leads to the formation of thermogenic adipocytes in visceral depots.
(A) A mouse model of visceral WAT selective ablation of Zfp423 (Visceral-Knockout or ‘Vis-KO’) was derived by breeding animals expressing the gene encoding Cre recombinase under the control of the Wilms Tumor 1 (WT1) promoter to animals carrying floxed Zfp423 alleles (Zfp423loxP/loxP). Littermates carrying only Zfp423loxp/loxP alleles were used as control animals. (B) Fold change in mRNA levels within brown (BAT), inguinal (iWAT), gonadal (gWAT), mesenteric (mWAT), or retroperitoneal (rWAT) adipose tissue of control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 6 mice. (C) Body weight of control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. n = 6 mice. (D) Fat pad weight (normalized to body weight) of control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 6 mice. (E– F) Fold change in mRNA levels of mature adipocyte genes (E) and thermogenic genes (F) isolated from whole adipose tissue from control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 6 mice. (G) mRNA levels (normalized to Rps18) of Ucp1 isolated from whole adipose tissue from control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 6 mice. (H–K) Relative basal oxygen consumption rates (OCRs) within diced gWAT (H), mWAT (I), rWAT (J), and iWAT (K) from control (white bar) and Vis-KO (red bar) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 4 independent replicates pooled from two mice. (L–O) Representative immunofluorescence staining of Perilipin (green) and DAPI (blue) in mWAT sections obtained from control (L, M) and Vis-KO (N, O) mice at 8 weeks of age. Scale bar, 200 μM. Panels M and O represent digital enhancements of the boxed regions shown in L and N, respectively.DOI:
http://dx.doi.org/10.7554/eLife.27669.003
(A–L) Representative images of gonadal (gWAT), retroperitoneal (rWAT), and inguinal WAT (iWAT) from control and Vis-KO mice immunostained with antibodies raised against Perilipin (green).
Scale bar = 200 μM. Panels B,D,F,H,J, and L represent digital enhancements of the boxed regions shown in A, C, E, G, I, and K, respectively.DOI:
http://dx.doi.org/10.7554/eLife.27669.004Vis-KO mice were born in the expected Mendelian ratio and appeared grossly indistinguishable from controls. We did not observe a difference in body weight between eight weeks-old Vis-KO mice and littermate controls; however, we did observe a noticeable difference in body fat distribution (Figure 1C). In comparison to control animals, Vis-KO mice had smaller gonadal WAT depots and larger subcutaneous inguinal WAT (Figure 1D). mRNA levels of adipocyte-selective genes in visceral adipose depots from the Vis-KO were comparable to levels found in control animals (Figure 1E); these data suggest that visceral adipocyte differentiation per se does not depend on Zfp423. However, in all visceral depots examined, there was a marked increase in the expression of key genes involved in adipocyte thermogenesis, including Ucp1 (Figure 1F–G). This was accompanied by an increase in basal O2 consumption rates in explanted WAT depots (Figure 1H–J). Furthermore, some visceral depots (mesenteric and retroperitoneal) lacking Zfp423 exhibit a multilocular appearance typical of thermogenic adipocytes (Figure 1L–O, Figure 1—figure supplement 1A–L). Taken together, these results indicate that inactivation of Zfp423 in fetal visceral white adipocyte precursors leads to the widespread accumulation of beige-like thermogenic adipocytes within visceral adipose depots. Interestingly, despite the fact that Zfp423 was not inactivated in the subcutaneous inguinal WAT of Vis-KO animals, the thermogenic capacity of this depot was also enhanced (Figure 1F,G,K).
Figure 1—figure supplement 1.
(A–L) Representative images of gonadal (gWAT), retroperitoneal (rWAT), and inguinal WAT (iWAT) from control and Vis-KO mice immunostained with antibodies raised against Perilipin (green).
Scale bar = 200 μM. Panels B,D,F,H,J, and L represent digital enhancements of the boxed regions shown in A, C, E, G, I, and K, respectively.
DOI:
http://dx.doi.org/10.7554/eLife.27669.004
Zfp423-deficient visceral adipose precursors differentiate into functional thermogenic adipocytes in vitro
We next asked whether the browning of WAT depots in the Vis-KO animals may occur in a cell-autonomous manner. We isolated the adipose stromal vascular fraction (SVF) from control and Vis-KO mice and performed in vitro adipocyte differentiation assays. SVF cultures obtained from the inguinal WAT of control and Vis-KO animals differentiated to a similar degree, and no significant differences in levels of Zfp423 or thermogenic genes were observed (Figure 2A–C). This is consistent with lack of Cre activity in this depot, and suggests that the increased inguinal WAT beiging in Vis-KO mice in vivo occurs secondary to inactivation of Zfp423 in the Wt1 lineage.
Figure 2.
Zfp423-deficient visceral adipose precursors differentiate into functional thermogenic adipocytes in vitro.
(A) Oil Red O staining of adipocytes differentiated in vitro from inguinal and gonadal SVF of control and Vis-KO mice. (B) Fold change in mRNA levels of adipocyte-selective genes in inguinal adipocyte cultures differentiated as shown in A. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (C) Fold change in mRNA levels of thermogenic genes in inguinal adipocyte cultures differentiated as shown in A and treated with vehicle or forskolin (10 µm) for 3 hr. n = 4 replicates from two mice. (D) Fold change in mRNA levels of adipocyte-selective genes in gonadal adipocyte cultures as shown in A. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (E) Fold change in mRNA levels of thermogenic genes in gonadal adipocyte cultures differentiated as shown in A and treated with vehicle or forskolin (10 µm) for 3 hr. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (F) Oxygen consumption rates (OCRs) within differentiated cultures of control (white bars) or Zfp423-deficient (red bars) gonadal adipocytes in the basal state, and in response to sequential additions of oligomycin (ATP synthase inhibitor), FCCP (chemical uncoupler), and rotenone/antimycin A (complex I and complex III inhibitor). * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (G) Percent uncoupled respiration of differentiated cultures of control (white bar) or Zfp423-deficient (red bar) gonadal adipocytes as determined by basal and uncoupled (oligomycin) respiration data from Figure 2F. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (H) Fold change in mRNA levels of white-, beige-, and brown-selective genes in differentiated cultures of control (white bars) or Zfp423-deficient (red bars) gonadal adipocytes. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.005
Zfp423-deficient visceral adipose precursors differentiate into functional thermogenic adipocytes in vitro.
(A) Oil Red O staining of adipocytes differentiated in vitro from inguinal and gonadal SVF of control and Vis-KO mice. (B) Fold change in mRNA levels of adipocyte-selective genes in inguinal adipocyte cultures differentiated as shown in A. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (C) Fold change in mRNA levels of thermogenic genes in inguinal adipocyte cultures differentiated as shown in A and treated with vehicle or forskolin (10 µm) for 3 hr. n = 4 replicates from two mice. (D) Fold change in mRNA levels of adipocyte-selective genes in gonadal adipocyte cultures as shown in A. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (E) Fold change in mRNA levels of thermogenic genes in gonadal adipocyte cultures differentiated as shown in A and treated with vehicle or forskolin (10 µm) for 3 hr. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (F) Oxygen consumption rates (OCRs) within differentiated cultures of control (white bars) or Zfp423-deficient (red bars) gonadal adipocytes in the basal state, and in response to sequential additions of oligomycin (ATP synthase inhibitor), FCCP (chemical uncoupler), and rotenone/antimycin A (complex I and complex III inhibitor). * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (G) Percent uncoupled respiration of differentiated cultures of control (white bar) or Zfp423-deficient (red bar) gonadal adipocytes as determined by basal and uncoupled (oligomycin) respiration data from Figure 2F. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice. (H) Fold change in mRNA levels of white-, beige-, and brown-selective genes in differentiated cultures of control (white bars) or Zfp423-deficient (red bars) gonadal adipocytes. * denotes p<0.05 from unpaired Student’s t-test. n = 4 replicates from two mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.005Cultures of gonadal WAT SVF from control and mutant animals also underwent adipogenesis to a similar degree under the differentiation conditions utilized (dexamethasone, IMBX, insulin, and rosiglitazone). This was evident by comparable lipid accumulation and mRNA levels of adipocyte-selective genes in differentiated cultures (Figure 2A,D). Importantly, Zfp423 mRNA was almost entirely absent from these cultures, reflecting the activity of the Wt1-Cre line in this depot. Cultures of gonadal white adipocytes lacking Zfp423 robustly activate their thermogenic gene program upon stimulation with forskolin (Figure 2E). These changes were accompanied by increased basal, uncoupled (oligomycin), and maximal (FCCP) respiration in differentiated gonadal adipocyte cultures from mutant animals (Figure 2F,G). These data indicate that Zfp423-deficient visceral adipose precursors can differentiate into functional thermogenic adipocytes in a cell-autonomous manner. The cellular phenotype of Zfp423-deficient visceral adipocytes is reminiscent of the characterized phenotype of subcutaneous beige adipocyte cultures (Wu et al., 2012); therefore, we examined whether Zfp423-deficient visceral adipocyte cultures are enriched in the expression of beige-selective transcripts. Zfp423-deficient visceral adipocytes expressed lower levels of white adipocyte-selective genes; however, we did not observe a clear pattern of gene expression changes that would indicate a conversion of Zfp423-deficient visceral adipocytes to either subcutaneous beige or classic brown fat cells (Figure 2H).
Thermogenic Zfp423-deficient visceral adipose tissue is largely distinct from subcutaneous beige adipose tissue
Prior studies of the beige adipocyte determination factor, Prdm16, revealed that genetic ablation of Prdm16 in adipose tissue leads to the loss of subcutaneous beige adipocytes, with inguinal WAT acquiring the molecular properties of visceral fat. Thus, we next asked whether the loss of Zfp423 reprograms visceral WAT into subcutaneous WAT. Alternatively, visceral WAT lacking Zfp423 may retain a global visceral phenotype but adopt a thermogenic phenotype reminiscent of classical brown or subcutaneous beige adipose tissues. In order to address this question we obtained and compared global gene expression profiles of adipose depots from control and Vis-KO animals through RNA sequencing (RNA-seq). For this experiment, we treated all animals with a β−3 adrenergic receptor agonist (CL316,243), or vehicle, for 3 days at thermoneutrality. This treatment allowed us to capture the global gene expression profile of thermogenic adipose depots in their fully active state. CL316,243 treatment led to a much greater increase in mRNA levels of Ucp1 and most other thermogenic genes examined in visceral WAT depots of Vis-KO mice than in control animals (Figure 3A,B). Levels of Ucp1 mRNA in the visceral depots lacking Zfp423 nearly reached levels of Ucp1 found in inguinal WAT following CL316,243 treatment (i.e. subcutaneous beige adipose tissue) (Figure 3A). This was accompanied by the widespread appearance of multilocular cells in gonadal WAT with readily detectable Ucp1 protein expression (Figure 3C–F). We again assayed the mRNA levels of genes commonly used as white, beige, and classic brown, adipocyte markers. Similar to results obtained from cultured Zfp423-deficient visceral adipocytes, the expression of some white adipocyte-selective genes examined were lower in Vis-KO gWAT; however, we once again did not observe a clear pattern of gene expression changes that would indicate a conversion of Zfp423-deficient gWAT to either subcutaneous beige or classic brown adipose tissue (Figure 3G).
Figure 3.
Visceral adipose tissue deletion of Zfp423 leads to enhanced visceral browning upon β−3 adrenergic receptor agonism at thermoneutrality.
(A) Control and Vis-KO mice were housed at room temperature (22°C) until 6 weeks of age then transferred to thermoneutral housing conditions (30°C) for 2 weeks. After 2 weeks at thermoneutrality, mice were treated with PBS (vehicle) or CL316,243 (1 mg/kg, intraperitoneal) daily for 3 days. On the 4thday, tissues were harvested for analysis. mRNA levels (relative to Rps18) of Ucp1 in iWAT, gWAT, and rWAT obtained from control and Vis-KO mice treated with vehicle or CL316,243 (CL) for 3 days at thermoneutrality. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (B) Fold change in mRNA levels of thermogenic genes in gWAT obtained from control and Vis-KO mice treated with vehicle or CL316,243 (CL) for 3 days at thermoneutrality. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (C–F) Representative brightfield images of Ucp1 immunoreactivity (brown staining) in gWAT sections obtained from control or Vis-KO mice treated with vehicle (C,D) or CL316,243 (E,F). (G) Fold change in mRNA levels of white-, beige-, and brown-selective genes in gWAT obtained from control and Vis-KO mice treated with vehicle or CL316,243 (CL) for 3 days at thermoneutrality. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.006
Visceral adipose tissue deletion of Zfp423 leads to enhanced visceral browning upon β−3 adrenergic receptor agonism at thermoneutrality.
(A) Control and Vis-KO mice were housed at room temperature (22°C) until 6 weeks of age then transferred to thermoneutral housing conditions (30°C) for 2 weeks. After 2 weeks at thermoneutrality, mice were treated with PBS (vehicle) or CL316,243 (1 mg/kg, intraperitoneal) daily for 3 days. On the 4thday, tissues were harvested for analysis. mRNA levels (relative to Rps18) of Ucp1 in iWAT, gWAT, and rWAT obtained from control and Vis-KO mice treated with vehicle or CL316,243 (CL) for 3 days at thermoneutrality. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (B) Fold change in mRNA levels of thermogenic genes in gWAT obtained from control and Vis-KO mice treated with vehicle or CL316,243 (CL) for 3 days at thermoneutrality. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (C–F) Representative brightfield images of Ucp1 immunoreactivity (brown staining) in gWAT sections obtained from control or Vis-KO mice treated with vehicle (C,D) or CL316,243 (E,F). (G) Fold change in mRNA levels of white-, beige-, and brown-selective genes in gWAT obtained from control and Vis-KO mice treated with vehicle or CL316,243 (CL) for 3 days at thermoneutrality. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.006Principal component analysis and unsupervised hierarchical clustering analysis of RNA-Seq data suggest that the global gene expression profile of Zfp423-deficient gWAT is distinct from subcutaneous beige adipose tissue and classic BAT. Instead, the Zfp423-deficient visceral WAT more closely resembles gWAT from control animals (Figure 4A–B). We next compared the list of transcripts that are differentially expressed between β3-agonist treated Zfp423-deficient gWAT and β3-agonist treated gWAT of control animals (i.e. genes whose expression reflect engineered thermogenic gWAT, Figure 4—source data 1) to the list of transcripts that are differentially regulated between β-agonist treated iWAT and vehicle-treated iWAT of control animals (i.e. genes whose expression reflects beige inguinal adipose tissue, Figure 4—source data 2). Zfp423-deficiency led to the differential expression of 1735 transcripts in gWAT (FDR < 0.05) (Figure 4C). Of these 1735 transcripts, 207 genes (12%) overlap with genes differentially regulated following β3-agonist treatment of iWAT (Figure 4—source data 3). Functional classification of these 207 genes by gene ontology analysis indicated that nearly all of these genes are related to mitochondrial function and biogenesis, a hallmark of thermogenic adipocytes (Figure 4D,E). These data suggest that Zfp423-deficient adipocytes present in Vis-KO animals are visceral adipocytes expressing at least a portion of the thermogenic gene program characteristic of subcutaneous beige adipocytes.
Figure 4.
Thermogenic Zfp423-deficient visceral adipose tissue is largely distinct from subcutaneous beige adipose tissue.
(A) RNA-sequencing was performed on mRNA libraries derived from gonadal WAT (gWAT) of vehicle- and β3 agonist (CL)-treated control and Vis-KO mice, as well as from inguinal WAT and interscapular BAT of vehicle- and CL-treated control mice. Principle component (PC) analysis of sequencing data obtained from CL-treated animals. n = 3 sequenced libraries for each condition. (B) Unsupervised clustering dendogram of adipose depot samples. (C) Venn diagram depicting overlap in 1) transcripts that are differentially expressed between β3-agonist treated Zfp423-deficient gWAT and β3-agonist treated gWAT of control animals, and 2) transcripts that are differentially regulated between β-agonist treated iWAT and vehicle-treated iWAT of wild-type animals. See Figure 4—source data 1, Figure 4—source data 2, Figure 4—source data 3. (D) Gene ontology analysis (GOTERM_CC_FAT) of the 207 overlapping genes shown in D. (E) Heatmap of top 50 induced genes of the 207 highlighted in C.
DOI:
http://dx.doi.org/10.7554/eLife.27669.007
DOI:
http://dx.doi.org/10.7554/eLife.27669.008
DOI:
http://dx.doi.org/10.7554/eLife.27669.009
DOI:
http://dx.doi.org/10.7554/eLife.27669.010
Thermogenic Zfp423-deficient visceral adipose tissue is largely distinct from subcutaneous beige adipose tissue.
(A) RNA-sequencing was performed on mRNA libraries derived from gonadal WAT (gWAT) of vehicle- and β3 agonist (CL)-treated control and Vis-KO mice, as well as from inguinal WAT and interscapular BAT of vehicle- and CL-treated control mice. Principle component (PC) analysis of sequencing data obtained from CL-treated animals. n = 3 sequenced libraries for each condition. (B) Unsupervised clustering dendogram of adipose depot samples. (C) Venn diagram depicting overlap in 1) transcripts that are differentially expressed between β3-agonist treated Zfp423-deficient gWAT and β3-agonist treated gWAT of control animals, and 2) transcripts that are differentially regulated between β-agonist treated iWAT and vehicle-treated iWAT of wild-type animals. See Figure 4—source data 1, Figure 4—source data 2, Figure 4—source data 3. (D) Gene ontology analysis (GOTERM_CC_FAT) of the 207 overlapping genes shown in D. (E) Heatmap of top 50 induced genes of the 207 highlighted in C.DOI:
http://dx.doi.org/10.7554/eLife.27669.007
Genes whose expression is significantly altered in gonadal WAT of Vis-KO CL316,243 treated mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.008
Genes whose expression is significantly altered in Inguinal WAT of CL316,243 treated mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.009
List of 207 genes highlighted in Figure 4C.
DOI:
http://dx.doi.org/10.7554/eLife.27669.010
Thermogenic visceral adipose tissue confers improved cold tolerance and protection from insulin resistance in obesity
Subcutaneous beige adipocytes exert beneficial effects on nutrient homeostasis and can increase energy expenditure. The Vis-KO model affords the opportunity to explore the systemic benefits of unlocking the thermogenic phenotype of visceral adipose depots. To this end, we tested the ability of Vis-KO mice to maintain body temperature in response to cold challenge. Following 1 week of cold exposure, visceral WAT depots of the Vis-KO mice activated their thermogenic gene program (Figure 5A,B) and accumulated Ucp1+ multilocular adipocytes (Figure 5C–J) to a much greater extent than control animals. We did not observe a significant difference in core body temperature during an acute cold tolerance test of control and Vis-KO animals (Figure 5K); however, after four weeks of cold acclimation, the Vis-KO mice maintain higher core body temperature (Figure 5L). Collectively, these data demonstrate that inactivation of Zfp423 is sufficient to unlock the thermogenic activity of visceral WAT depots under postnatal physiological conditions, and that browning of these depots can functionally enhance adaptive thermogenesis.
Figure 5.
Zfp423-deficiency enables cold-induced visceral WAT browning.
(A) Control and Vis-KO mice were housed at room temperature (22°C) until 6 weeks of age then transferred to thermoneutral housing (30°C) for 2 weeks. After 2 weeks at thermoneutrality, animals were transferred to 6°C or left at thermoneutrality for seven full days. On the 8th day, tissues were harvested for analysis. mRNA levels (relative to Rps18) of Ucp1 in iWAT, gWAT, and rWAT from control and Vis-KO mice cold exposed (CE) or housed at thermoneutrality (TN) for 7 days. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (B) Fold change in mRNA levels of thermogenic genes in rWAT and gWAT from control and Vis-KO mice cold exposed (CE) or housed at thermoneutrality (TN) for 7 days. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (C–J) Brightfield images of Ucp1 immunostaining (brown) within rWAT (C–F) and gWAT (G–J) sections obtained from control or Vis-KO mice following cold exposure (CE) or housing at thermoneutrality (TN). (K) Body temperature at indicated time points following transfer of mice from thermoneutrality to cold (6°C). n = 4–5 mice. (L) Body temperature at indicated time points during a cold tolerance test after 4 weeks of acclimation to cold (6°C). * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.011
Zfp423-deficiency enables cold-induced visceral WAT browning.
(A) Control and Vis-KO mice were housed at room temperature (22°C) until 6 weeks of age then transferred to thermoneutral housing (30°C) for 2 weeks. After 2 weeks at thermoneutrality, animals were transferred to 6°C or left at thermoneutrality for seven full days. On the 8th day, tissues were harvested for analysis. mRNA levels (relative to Rps18) of Ucp1 in iWAT, gWAT, and rWAT from control and Vis-KO mice cold exposed (CE) or housed at thermoneutrality (TN) for 7 days. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (B) Fold change in mRNA levels of thermogenic genes in rWAT and gWAT from control and Vis-KO mice cold exposed (CE) or housed at thermoneutrality (TN) for 7 days. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (C–J) Brightfield images of Ucp1 immunostaining (brown) within rWAT (C–F) and gWAT (G–J) sections obtained from control or Vis-KO mice following cold exposure (CE) or housing at thermoneutrality (TN). (K) Body temperature at indicated time points following transfer of mice from thermoneutrality to cold (6°C). n = 4–5 mice. (L) Body temperature at indicated time points during a cold tolerance test after 4 weeks of acclimation to cold (6°C). * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.011We also asked whether the thermogenic visceral WAT present in Vis-KO animals confers protection against diet-induced obesity and/or impaired nutrient homeostasis. We administered 8 weeks-old male mice chow or high-fat diet (HFD) (60% calories from fat) for 20 weeks. Over this period, we did not observe a significant difference in body weight between Vis-KO mice and controls (Figure 6A). At the time of analysis (8 weeks of HFD feeding), we did not observe a significant difference in adiposity (% body fat), lean mass, or fat distribution (Figure 6B,C). Gene expression analysis of dissected tissues revealed that the loss of Zfp423 expression remained restricted to visceral depots (Figure 6D). Levels of Ucp1 and other genes related to thermogenesis were significantly increased in visceral depots of obese Vis-KOmice (Figure 6E,F); however, mRNA levels of adipocyte-selective genes did not appear to be impacted by the loss of Zfp423 (Figure 6G). The later suggests that Zfp423-deficiency did not impact de novo visceral adipocyte differentiation that occurs over this period of HFD feeding. The increase in thermogenic gene expression appeared functionally significant; rates of basal and maximal oxygen consumption were significantly elevated in the visceral depots of obese Vis-KOmice when compared to controls (Figure 6H–J). We again observed a slight increase in the expression of thermogenic genes in the inguinal WAT of mutant animals; however, the metabolic activity of the inguinal WAT depot did not significantly differ from inguinal WAT of obese control mice (Figure 6K).
(A) Weekly measurements of body weights of 8 weeks-old control and Vis-KO mice fed a standard chow diet (Chow) or high fat diet (HFD) for 20 weeks. n = 6–7 mice per group. (B) Total fat mass, lean mass, and water mass (normalized to body weight) of control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. n = 6–7 mice. (C) Fat depot mass (normalized to body weight) of control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. n = 6–7 mice. (D) Relative mRNA levels of Zfp423 in BAT, iWAT, gWAT, mWAT, and rWAT isolated from control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice per group. (E) mRNA levels (normalized to Rps18) of Ucp1 within adipose depots of control (white bars) and Vis-KO (red bars) mice after 8 weeks of chow or HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (F–G) Relative mRNA levels of thermogenic genes (F) and adipocyte-selective genes (G) in iWAT, gWAT, mWAT, and rWAT isolated from control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (H–K) Relative basal oxygen consumption rates (OCRs) within gWAT (H), mWAT (I), rWAT (J), and iWAT (K) isolated from control (white bars) and Vis-KO (red bars) mice after 8 weeks of chow or HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 4 independent replicates pooled from two mice.
(A) Weekly measurements of body weights of 8 weeks-old control and Vis-KO mice fed a standard chow diet (Chow) or high fat diet (HFD) for 20 weeks. n = 6–7 mice per group. (B) Total fat mass, lean mass, and water mass (normalized to body weight) of control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. n = 6–7 mice. (C) Fat depot mass (normalized to body weight) of control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. n = 6–7 mice. (D) Relative mRNA levels of Zfp423 in BAT, iWAT, gWAT, mWAT, and rWAT isolated from control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice per group. (E) mRNA levels (normalized to Rps18) of Ucp1 within adipose depots of control (white bars) and Vis-KO (red bars) mice after 8 weeks of chow or HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (F–G) Relative mRNA levels of thermogenic genes (F) and adipocyte-selective genes (G) in iWAT, gWAT, mWAT, and rWAT isolated from control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (H–K) Relative basal oxygen consumption rates (OCRs) within gWAT (H), mWAT (I), rWAT (J), and iWAT (K) isolated from control (white bars) and Vis-KO (red bars) mice after 8 weeks of chow or HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 4 independent replicates pooled from two mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.012We also examined whether the observed increase in visceral WAToxygen consumption impacts whole-body levels of energy expenditure. We assessed energy expenditure and food intake in control and knockout animals fed HFD for 8 weeks. At this point, body weights and body composition were comparable between the two groups of animals (Figure 7A,B); however, we observed a modest, but statistically significant, increase in O2 consumption, heat production, and CO2 production, in the Zfp423-deficient mice (Figure 7C–F). We observed a slight increase in food intake over the dark cycle; however, these differences did not reach statistical significance (Figure 7G). Moreover, overall locomotor activity measurements and respiratory exchange ratios were similar between control and knockout animals (Figure 7H,I). These new data indicate that visceral WAT deletion of Zfp423, and subsequent visceral browning, enhances energy expenditure, albeit not a strong enough degree to drive a robust difference in body weight.
Figure 7.
Browning of visceral adipose tissues is associated with increased energy expenditure.
(A) Body weight of control (white bar) and Vis-KO (red bar) mice after 8 weeks of high fat diet feeding. n = 4–5 mice. (B) Total fat mass, lean mass, and water mass (normalized to body weight) of control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. n = 4–5 mice. (C) O2 consumption during two complete 12 hr light-dark cycles of control and Vis-KO mice following 8 weeks of high fat diet feeding. n = 4–5 mice. (D–G) Average O2 consumption (D), heat production (E), CO2 production (F), and food intake (G) during the 24 hr, day, and night cycle in control (white bars) and Vis-KO (red bars) mice following 8 weeks of high fat diet. Bars represent averages from over the course of the 5 day measurement. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (H) Average 24 hr X-beam, Y-beam, and Z-beam breaks of control (white bars) and Vis-KO (red bars) mice following 8 weeks of high fat diet. Bars represent averages from over the course of the 5 day measurement. n = 4–5 mice. (I) Average RER during the 24 hr, day, and night cycle in control (white bars) and Vis-KO (red bars) mice following 8 weeks of high fat diet. Bars represent averages from over the course of the 5 day measurement. n = 4–5 mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.013
Browning of visceral adipose tissues is associated with increased energy expenditure.
(A) Body weight of control (white bar) and Vis-KO (red bar) mice after 8 weeks of high fat diet feeding. n = 4–5 mice. (B) Total fat mass, lean mass, and water mass (normalized to body weight) of control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. n = 4–5 mice. (C) O2 consumption during two complete 12 hr light-dark cycles of control and Vis-KO mice following 8 weeks of high fat diet feeding. n = 4–5 mice. (D–G) Average O2 consumption (D), heat production (E), CO2 production (F), and food intake (G) during the 24 hr, day, and night cycle in control (white bars) and Vis-KO (red bars) mice following 8 weeks of high fat diet. Bars represent averages from over the course of the 5 day measurement. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (H) Average 24 hr X-beam, Y-beam, and Z-beam breaks of control (white bars) and Vis-KO (red bars) mice following 8 weeks of high fat diet. Bars represent averages from over the course of the 5 day measurement. n = 4–5 mice. (I) Average RER during the 24 hr, day, and night cycle in control (white bars) and Vis-KO (red bars) mice following 8 weeks of high fat diet. Bars represent averages from over the course of the 5 day measurement. n = 4–5 mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.013Further metabolic phenotyping of control and mutant animals revealed that the beige-like phenotype of visceral WAT in diet-induced obese Vis-KOmice was associated with striking improvements in nutrient homeostasis. Obese Vis-KOmice exhibited significantly better glucose tolerance test than obese control animals; excursions in blood glucose and serum insulin following glucose challenge were substantially lower in Vis-KO animals (Figure 8A,B). Insulin tolerance tests suggest greater systemic insulin sensitivity in the Vis-KO mice (Figure 8C). We further explored the impact of visceral WAT browning on systemic glucose metabolism by performing hypersulinemic-euglycemic clamp assays. The glucose infusion rate needed to maintain euglycemia (~138 mg/dl) was increased in Vis-KO mice (Figure 8D). This demonstrates an increase in whole-body insulin sensitivity, consistent with the aforementioned insulin tolerance tests. Importantly, endogenous glucose output was suppressed much more efficiently during the basal and clamped states in Vis-KO mice, likely reflecting improved insulin sensitivity at the level of the liver (Figure 8E). These data are supported by liver gene expression analysis from a separate cohort of animals. The mRNA levels of key gluconeogenic genes in the Vis-KO livers are significantly lower than corresponding levels in livers from control animals after 8 weeks of HFD feeding (Figure 8F). Furthermore, visceral adipose-selective browning phenotype is associated with lower serum triglyceride levels (Figure 8G). 14C-2-deoxyglucose tracing revealed that the rate of whole-body glucose disposal did not significantly differ between control and Vis-KO mice (Figure 8H); however, glucose uptake was enhanced in the visceral rWAT depot, correlating with where the largest degree of visceral beiging is observed in this model (Figure 8I). All together, these data demonstrate visceral deletion of Zfp423 leads to enhanced insulin sensitivity and reduced hepatic glucose output. Moreover, these data suggest that engineered thermogenic visceral adipose tissue, much like subcutaneous beige adipose tissue, can defend against the development of impaired glucose and lipid homeostasis in obesity.
Figure 8.
Mice lacking visceral adipose Zfp423 are protected against insulin resistance in obesity.
(A) Intraperitoneal glucose tolerance tests of control and Vis-KO mice after 8 weeks of chow or HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (B) Serum insulin levels of control and Vis-KO mice after 8 weeks of HFD feeding during the glucose tolerance test shown in A. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (C) Insulin tolerance tests of control and Vis-KO mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (D–E) Glucose infusion rate (D) and basal and clamped hepatic glucose production (E) during hyperinsulinemic-euglycemic clamp experiments performed on conscious, unrestrained control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 5–6 mice. (F) Relative mRNA levels of gluconeogenic genes in the livers of control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (G) Serum triglyceride levels in control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (H) Glucose disappearance rate during hyperinsulinemic-euglycemic clamp experiments performed on conscious, unrestrained control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. n = 5–6 mice. (I) 2-deoxyglucose uptake quantification of iWAT, gWAT, rWAT, and mWAT during hyperinsulinemic-euglycemic clamp experiments performed on conscious, unrestrained control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 5–6 mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.014
Mice lacking visceral adipose Zfp423 are protected against insulin resistance in obesity.
(A) Intraperitoneal glucose tolerance tests of control and Vis-KO mice after 8 weeks of chow or HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (B) Serum insulin levels of control and Vis-KO mice after 8 weeks of HFD feeding during the glucose tolerance test shown in A. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (C) Insulin tolerance tests of control and Vis-KO mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (D–E) Glucose infusion rate (D) and basal and clamped hepatic glucose production (E) during hyperinsulinemic-euglycemic clamp experiments performed on conscious, unrestrained control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 5–6 mice. (F) Relative mRNA levels of gluconeogenic genes in the livers of control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (G) Serum triglyceride levels in control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 6–7 mice. (H) Glucose disappearance rate during hyperinsulinemic-euglycemic clamp experiments performed on conscious, unrestrained control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. n = 5–6 mice. (I) 2-deoxyglucose uptake quantification of iWAT, gWAT, rWAT, and mWAT during hyperinsulinemic-euglycemic clamp experiments performed on conscious, unrestrained control (white bars) and Vis-KO (red bars) mice after 8 weeks of HFD feeding. * denotes p<0.05 from unpaired Student’s t-test. n = 5–6 mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.014
Inactivation of Zfp423 in adult mural cells leads to beige, rather than white, adipocyte hyperplasia in diet-induced obesity
We previously demonstrated that adipocytes emerging in expanding visceral, but not subcutaneous, WAT depots of diet-induced obesemice arise through de novo adipocyte differentiation from mural progenitors expressing Pdgfrb (Hepler et al., 2017; Vishvanath et al., 2016). Whether these preadipocytes can be redirected to a thermogenic adipocyte fate, thereby driving beige-like adipocyte hyperplasia rather than white adipocyte hyperplasia, has been unclear. To address this, we generated a model that allows for doxycycline-inducible inactivation of Zfp423 in Pdgfrb-expressing mural cells (inducible mural cell Zfp423 knockout, or ‘iMural-KO’) (Figure 9A). The iMural-KO model was achieved by breeding PdgfrbrtTA transgenic mice to animals expressing Cre recombinase under the control of a tetracycline responsive element (TRE-Cre) and carrying floxed Zfp423 alleles (Zfp423loxP/loxP). We also bred the Cre-dependent Rosa26R loxP-mtdTomato-loxP-mGFP (mT/mG) fluorescent reporter allele into the model; this allowed for the fate-mapping of targeted mural cells. Treatment of adult animals with doxycycline leads to Cre dependent inactivation of mural cell Zfp423 (Figure 9B), and permanent fluorescent-tagging (mGFP) of Pdgfrβ+ cells. Importantly, mature adipocytes present at the time of doxycycline treatment are not targeted (Figure 9B). Only those adipocytes that descend from mural cells following HFD feeding are Zfp423-deficient and will express mGFP.
Figure 9.
Adult mural cell deletion of Zfp423 does not impact visceral white adipogenesis associated with high fat diet feeding.
(A) Doxycycline (Dox) inducible deletion of Zfp423 in adult mural cells (inducible-Mural-Knockout or ‘iMural-KO’) is achieved by breeding PdgfrbrtTA transgenic mice to animals expressing Cre recombinase under the control of a tetracycline response element (TRE-Cre), the Rosa26R loxP-mtdTomato-loxP-mGFP (mT/mG) fluorescent reporter allele, and the floxed Zfp423 alleles (Zfp423loxP/loxP). Animals carrying only PdgfrbrtTA, TRE-Cre, and Rosa26RmT/mG alleles were used as controls. (B) Validation of the iMural-KO model. Relative mRNA levels of Zfp423 in purified adipocytes and purified Pdgfrβ+ cells from WAT obtained from control (white bars) and iMural-KO (red bars) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (C) Mice were maintained at room temperature and fed standard chow diet until 6 weeks of age. Animals were then switched to Dox-containing chow diet for 9 days in order to induce Zfp423 deletion and mGFP expression in mural cells. Animals were then maintained on a Dox-containing high-fat diet (HFD) for 8 weeks then sacrificed for analysis. (D) Weekly body weight measurements of control and iMural-KO mice during HFD feeding. n = 6–8 mice. (E–J) Confocal images of immunostained gWAT obtained from control (E–G) and iMural-KO (H–J) mice fed high fat diet for 8 weeks. (K) Quantification of mGFP-expressing adipocytes (mGFP+; perlipin+) observed in randomly chosen 10X magnification fields of gWAT sections obtained from control (black circles) and iMural-KO (red squares) mice following 8 weeks of HFD feeding. n = 6 mice. (L) Glucose tolerance tests of control and iMural-KO mice after 8 weeks of HFD feeding. n = 6–8 mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.015
Adult mural cell deletion of Zfp423 does not impact visceral white adipogenesis associated with high fat diet feeding.
(A) Doxycycline (Dox) inducible deletion of Zfp423 in adult mural cells (inducible-Mural-Knockout or ‘iMural-KO’) is achieved by breeding PdgfrbrtTA transgenic mice to animals expressing Cre recombinase under the control of a tetracycline response element (TRE-Cre), the Rosa26R loxP-mtdTomato-loxP-mGFP (mT/mG) fluorescent reporter allele, and the floxed Zfp423 alleles (Zfp423loxP/loxP). Animals carrying only PdgfrbrtTA, TRE-Cre, and Rosa26RmT/mG alleles were used as controls. (B) Validation of the iMural-KO model. Relative mRNA levels of Zfp423 in purified adipocytes and purified Pdgfrβ+ cells from WAT obtained from control (white bars) and iMural-KO (red bars) mice at 8 weeks of age. * denotes p<0.05 from unpaired Student’s t-test. n = 4–5 mice. (C) Mice were maintained at room temperature and fed standard chow diet until 6 weeks of age. Animals were then switched to Dox-containing chow diet for 9 days in order to induce Zfp423 deletion and mGFP expression in mural cells. Animals were then maintained on a Dox-containing high-fat diet (HFD) for 8 weeks then sacrificed for analysis. (D) Weekly body weight measurements of control and iMural-KO mice during HFD feeding. n = 6–8 mice. (E–J) Confocal images of immunostained gWAT obtained from control (E–G) and iMural-KO (H–J) mice fed high fat diet for 8 weeks. (K) Quantification of mGFP-expressing adipocytes (mGFP+; perlipin+) observed in randomly chosen 10X magnification fields of gWAT sections obtained from control (black circles) and iMural-KO (red squares) mice following 8 weeks of HFD feeding. n = 6 mice. (L) Glucose tolerance tests of control and iMural-KO mice after 8 weeks of HFD feeding. n = 6–8 mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.015Following doxycycline treatment, we fed control and iMural-KO mice a HFD for 8 weeks (Figure 9C). After 8 weeks of HFD feeding, the body weights of mutant animals were indistinguishable from controls (Figure 9D). De novo white adipocyte differentiation occurred in gWAT of both control and mutant animals; newly derived adipocytes were indicated by the expression of mGFP (Figure 9E–J). However, we did not observe a statistically significant difference in the number of mGFP+ adipocytes between control and iMural-KO mice (Figure 9K). Overall, ~5–15% of gonadal adipocytes present in the gWAT of these obese animals descended from mural cells. Despite the fact that Zfp423 expression identifies mural adipose progenitors, these data suggest that adult mural progenitors do not require Zfp423 in vivo for their ability to undergo adipocyte differentiation in response to HFD feeding.Zfp423-deficient adipocytes originating from mural progenitors in the obese iMural-KO model were readily identified by mGFP expression; however, these cells were not multilocular (Figure 9H,I,J). Moreover, the glucose tolerance of obese iMural-KO mice was similar to that of control animals (Figure 9L). Our previous study revealed that the thermogenic activity of Zfp423-deficient adipocytes was dependent on active β-adrenergic signaling (Shao et al., 2016); it is well appreciated that rodent obesity is associated with augmented β-adrenergic receptor signaling (Collins et al., 1999; Collins and Surwit, 2001). Therefore, we reasoned that the Zfp423-deficient adipocytes present in these in obesemice would require a stimulus to fully activate their thermogenic function in this setting. To test this, we utilized osmotic pumps to deliver the β3-adrenergic receptor agonist, CL316,243, daily at a dose of 1 mg/kg/day for four continuous weeks. The agonist was given to obese control and iMural-KO mice after 8 weeks of HFD feeding (Figure 10A). During the 4 weeks of the β3-agonist treatment, both control and iMural-KO animals exhibited a similarly mild decrease in body weight (Figure 10B). However, after four weeks of β3-agonist treatment, the gonadal adipose depot mass of iMural-KO mice was significantly smaller than the gWAT mass of treated control mice (Figure 10C). Immunohistochemistry for mGFP expression revealed that β3-agonist treatment did not induce the formation of any additional gonadal or inguinal adipocytes from the Pdgfrb lineage (Figure 10D–H, Figure 10—figure supplement 1A,B). We again did not observe a difference in the numbers of mGFP-labelled adipocytes between control and knockout animals (Figure 10—figure supplement 1A,B). Mural-cell derived adipocytes in the β3-agonist treated control animals remained unilocular; however, most mGFP+ adipocytes present in β3-agonist treated knockout mice were now multilocular (Figure 10D–H). On average, ~6% of gonadal adipocytes appeared multilocular in the iMural-KO animals; very few, if any, gonadal multilocular adipocytes were present in β3-agonist treated control mice (Figure 10—figure supplement 1C). Levels of Ucp1 mRNA were strongly elevated in visceral depots of the β3-agonist treated iMural-KO mice (Figure 10—figure supplement 1E). On the other hand, the percentage of inguinal adipocytes appearing multilocular appeared low (~3%) and comparable between control and knockout animals (Figure 10—figure supplement 1D). However, despite the low and comparable levels of mural cell adipogenesis, the iWAT from β3-agonist treated knockout animals had relatively higher levels of Ucp1 mRNA in comparison to controls (Figure 10—figure supplement 1E). The recruitment of this relatively low number of beige-like adipocytes appeared sufficient to drive an increase in basal respiration of adipose tissues (Figure 10—figure supplement 1F). This active thermogenic phenotype of the visceral WAT correlated with markedly improved glucose tolerance and insulin sensitivity observed in β3-agonist iMural-KO mice (Figure 10I–K). All together, these data indicate that visceral mural preadipocytes in adult mice can be directed to a dormant beige-like phenotype in the expanding visceral WAT depots of diet-induced obese animals. Upon activation by β3 adrenergic receptor agonism, these beige-like adipocytes appear to drive an improvement in insulin sensitivity in obese animals.
Figure 10.
Inactivation of Zfp423 in adult mural cells leads to beige, rather than white, adipocyte hyperplasia in diet-induced obesity.
(A) Chow-fed 6 weeks-old animals were first administered Dox-containing chow for 9 days in order to inactive Zfp423 and induce permanent mGFP expression in Pdgfrb+ cells. Mice were then switched to a high-fat diet (HFD) containing Dox. After 8 weeks of Dox-HFD, the mice were treated daily with CL316,243 (1 mg/kg/24 hr) or vehicle (PBS) for 4 weeks. (B) Weekly body weight measurements of obese control and iMural-KO mice following vehicle or CL316,243 administration. n = 6–8 mice. (C) Fat depot weights (normalized to body weight) of control and iMural-KO mice after vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice. (D–G) Representative confocal images of Perilipin (red), mGFP (green) and DAPI (blue) immunostaining of gWAT sections obtained from control and iMural-KO mice administered vehicle (D, E), or CL316,243 (F, G). (H) Digital enhancement of region outlined in (G). (I) Glucose tolerance tests of control and iMural-KO mice following vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice. (J) Serum insulin levels measured during intraperitoneal glucose tolerance tests of control and iMural-KO mice following vehicle or CL316,243 administration. n = 6–8 mice. (K) Insulin tolerance tests of control and iMural-KO mice following vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.016
(A–B) Quantification of mGFP-expressing adipocytes (mGFP+; perlipin+) observed in randomly chosen 10X magnification fields of gWAT (A) or iWAT (B) sections of obese control and iMural-KO mice following vehicle or CL316,243 administration. n = 7 mice. (C) Percentage of all perilipin+ adipocytes counted in (A) that are multilocular. * denotes p<0.05 from unpaired Student’s t-test. n = 7 mice. (D) Percentage of all perilipin+ adipocytes counted in (B) that are multilocular. n = 7 mice. (E) Relative mRNA levels of Ucp1 in indicated WAT depots obtained from control and iMural-KO mice following vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice. (F) Relative basal oxygen consumption rates (OCRs) of isolated WAT depots from control and iMural-KO mice. * denotes p<0.05 from unpaired Student’s t-test. n = 4 independent replicates pooled from two mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.017
Figure 10—figure supplement 1.
Quantification of beige adipocyte hyperplasia in iMural-KO mice.
(A–B) Quantification of mGFP-expressing adipocytes (mGFP+; perlipin+) observed in randomly chosen 10X magnification fields of gWAT (A) or iWAT (B) sections of obese control and iMural-KO mice following vehicle or CL316,243 administration. n = 7 mice. (C) Percentage of all perilipin+ adipocytes counted in (A) that are multilocular. * denotes p<0.05 from unpaired Student’s t-test. n = 7 mice. (D) Percentage of all perilipin+ adipocytes counted in (B) that are multilocular. n = 7 mice. (E) Relative mRNA levels of Ucp1 in indicated WAT depots obtained from control and iMural-KO mice following vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice. (F) Relative basal oxygen consumption rates (OCRs) of isolated WAT depots from control and iMural-KO mice. * denotes p<0.05 from unpaired Student’s t-test. n = 4 independent replicates pooled from two mice.
DOI:
http://dx.doi.org/10.7554/eLife.27669.017
Inactivation of Zfp423 in adult mural cells leads to beige, rather than white, adipocyte hyperplasia in diet-induced obesity.
(A) Chow-fed 6 weeks-old animals were first administered Dox-containing chow for 9 days in order to inactive Zfp423 and induce permanent mGFP expression in Pdgfrb+ cells. Mice were then switched to a high-fat diet (HFD) containing Dox. After 8 weeks of Dox-HFD, the mice were treated daily with CL316,243 (1 mg/kg/24 hr) or vehicle (PBS) for 4 weeks. (B) Weekly body weight measurements of obese control and iMural-KO mice following vehicle or CL316,243 administration. n = 6–8 mice. (C) Fat depot weights (normalized to body weight) of control and iMural-KO mice after vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice. (D–G) Representative confocal images of Perilipin (red), mGFP (green) and DAPI (blue) immunostaining of gWAT sections obtained from control and iMural-KO mice administered vehicle (D, E), or CL316,243 (F, G). (H) Digital enhancement of region outlined in (G). (I) Glucose tolerance tests of control and iMural-KO mice following vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice. (J) Serum insulin levels measured during intraperitoneal glucose tolerance tests of control and iMural-KO mice following vehicle or CL316,243 administration. n = 6–8 mice. (K) Insulin tolerance tests of control and iMural-KO mice following vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.016
Quantification of beige adipocyte hyperplasia in iMural-KO mice.
(A–B) Quantification of mGFP-expressing adipocytes (mGFP+; perlipin+) observed in randomly chosen 10X magnification fields of gWAT (A) or iWAT (B) sections of obese control and iMural-KO mice following vehicle or CL316,243 administration. n = 7 mice. (C) Percentage of all perilipin+ adipocytes counted in (A) that are multilocular. * denotes p<0.05 from unpaired Student’s t-test. n = 7 mice. (D) Percentage of all perilipin+ adipocytes counted in (B) that are multilocular. n = 7 mice. (E) Relative mRNA levels of Ucp1 in indicated WAT depots obtained from control and iMural-KO mice following vehicle or CL316,243 administration. * denotes p<0.05 from unpaired Student’s t-test. n = 6–8 mice. (F) Relative basal oxygen consumption rates (OCRs) of isolated WAT depots from control and iMural-KO mice. * denotes p<0.05 from unpaired Student’s t-test. n = 4 independent replicates pooled from two mice.DOI:
http://dx.doi.org/10.7554/eLife.27669.017
Discussion
It is now certain that adult humans have appreciable amounts of thermogenic adipose tissue consisting of brown and beige adipocytes (Cypess et al., 2013; Shinoda et al., 2015; van Marken Lichtenbelt et al., 2009; Virtanen et al., 2009). Upon activation, thermogenic adipose tissue in lean adults can impact glucose and lipid homeostasis (Chondronikola et al., 2014, 2016; Cypess et al., 2015); however, it still remains unclear as to whether sufficient amounts of thermogenic adipose tissue are present in obese individuals to exert beneficial therapeutic effects, even when fully activated. As such, there is tremendous interest in identifying strategies to increase the mass of functional thermogenic adipose tissue in obesepatients with metabolic syndrome. To this end, a number of studies have now identified pathways/factors that can drive the natural formation of subcutaneous beige adipocytes or classic brown adipocytes (Harms and Seale, 2013). The negative impacts of visceral expansion during obesity on metabolic health make visceral fat a prime target for therapeutic intervention; however, effective strategies to improve the health of visceral WAT health have yet to emerge. In particular, whether browning of visceral depots, much like the browning of subcutaneous adipose tissue, would exert beneficial metabolic effects has been unclear.We recently reported that Zfp423 is a suppressor of the thermogenic gene program in adipocytes. Using this discovery as a tool, we reveal here that the thermogenic potential of visceral adipose depots in mice can be unlocked through removal of Zfp423. Importantly, these data provide proof of concept that white adipose precursors in adult animals can be redirected to a beige-like adipocyte fate and improve insulin sensitivity in obesity. Overall, we observed beneficial effects of visceral WAT browning on nutrient homeostasis and cold tolerance. Nevertheless, we cannot exclude the possibility that inducing the thermogenic capacity of these depots may have detrimental effects under other physiological conditions not examined. Elevated expression of Zfp423 in visceral white adipocytes provides one explanation as to how visceral WAT depots resist adopting a thermogenic phenotype; however, it remains unclear as to why visceral WAT depots would adopt these anti-thermogenic mechanisms.Inactivation of Zfp423 in visceral WAT gives rise to thermogenic adipocytes that share properties of subcutaneous beige adipocytes and classic brown adipocytes. In particular, Zfp423 deletion in visceral WAT unlocks a functionally significant portion of the thermogenic gene program characteristic of activated (β3 adrenergic receptor activated) beige adipose tissue. Nevertheless, global gene expression profiling suggests that Zfp423-deficient visceral WAT largely retains a visceral WAT molecular signature, rather than adopting the global molecular program characteristic of subcutaneous WAT. Additional gene expression studies of isolated visceral and inguinal Ucp1+ adipocytes will be needed to fully characterize the similarities and differences between the anatomically distinct thermogenic fat cells. During preparation of this manuscript, Kirichok and colleagues reported the existence of two distinct types of thermogenic beige adipocytes present in visceral depots of mice stimulated with the β3-adrenergic receptor agonist for 10 days (Bertholet et al., 2017). In particular, Bertholet et al. revealed that most thermogenic adipocytes in visceral WAT are devoid of Ucp1 protein and instead employ futile creatine cycling for thermogenesis. Zfp423-deficient visceral adipocytes express Ucp1 protein; however, the precise contribution of Ucp1-mediated uncoupling vs. creatine cycling in these cells remains unclear.Our data here highlight the ability of thermogenic adipocytes, even within the visceral compartment, to drive vast improvements in nutrient homeostasis in obesemice, without impacting body weight. Moreover, the mural cell knockout model of Zfp423 even suggests that a relatively low frequency of activated multilocular Zfp423-deficient visceral adipocytes (5–10% of adipocytes in β3-agonist treated obese iMural-KO mice) can lead to improved insulin sensitivity. This is surprising given the opinion that such small numbers of beige cells are not likely to confer significant benefit (Kalinovich et al., 2017). We, of course, cannot rule out the possibility that Zfp423deficiency may impact the visceral adipose phenotype in a multitude of ways that influence energy metabolism. It is notable that in the Vis-KO model, the data largely point to the liver as a major site of improved insulin sensitivity. Previously reported work on Prdm16 and subcutaneous WAT beiging suggest a strong connection between subcutaneous beige cells and liver health (Cohen et al., 2014). For the field at large, it remains an open question as to how brown/beige adipocytes exert beneficial effects on systemic metabolism, independent of their impact on body weight. This unique model may serve as a tool to explore the mechanisms of how visceral WAT browning leads to improved glucose metabolism.We consistently observed a modest, yet statistically significant, induction of the thermogenic gene program in the inguinal WAT depots of both genetic models. There is a limit to our ability to interpret these results from the iMural-KO mice. Inguinal adipocyte differentiation is not impacted in this model; however, Zfp423 is still inactivated in mural cells of this depot. It is not possible to exclude additional roles for Zfp423 in mural cells of iWAT or other tissues. Nevertheless, the dependency of the improved insulin sensitivity in obese iMural-KO mice on β3-adrenergic receptor activation does suggest that the increased numbers of thermogenic visceral adipocytes, at least in part, contribute to the phenotypes observed here. In the Vis-KO model, inactivation of Zfp423 is limited to visceral WAT depots. The subcutaneous WAT phenotype in this model is thus not cell autonomous and appears secondary to the visceral phenotype. It is possible that Zfp423-deficient visceral adipocytes produce circulating adipokines that influence systemic metabolism and thermogenesis. In fact, more and more ‘Batokines’ have recently emerged (Lynes et al., 2017; Svensson et al., 2016; Thomou et al., 2017; Villarroya et al., 2017). It is also possible that secondary browning of subcutaneous WAT may be triggered through central effects mediated by a visceral WAT to brain neural relay.A multitude of studies now support the idea that visceral adipocytes are developmentally, molecularly, and functionally, distinct from subcutaneous adipocytes. Our prior work revealed a critical role for Zfp423 in 3T3-L1 adipogenesis and in the regulation of Pparg and the fetal formation of subcutaneous white adipocytes in vivo (Gupta et al., 2010; Shao et al., 2017). Our work here reveals that Zfp423 is dispensable for the differentiation of visceral adipocytes within those visceral depots examined. Thus, Zfp423 expression defines mural white preadipocytes within visceral depots of adult mice; however, other factors can compensate for its absence in the initial stages of adipocyte differentiation, but not in suppressing the thermogenic gene program. The lack of impact on adipocyte differentiation was unexpected; however, this result is perhaps not surprising in light of recent studies of another pro-adipogenic transcription factor, Cebpa. In vitro, Cebpa is amongst the most critical adipogenesis factors; however, in vivo, it appears essential for postnatal, but not fetal, terminal differentiation of fat cells (Wang et al., 2015). Thus, despite the expression of Cebpa throughout the adipose lineage, there appears to be temporal requirements for this particular factor. These data, along with other studies, highlight the emerging concept that distinct transcriptional regulatory mechanisms govern fetal vs. adult adipogenesis (Jeffery et al., 2015; Wang et al., 2015). Our data here further highlight the complexity in the regulation of adipogenesis in vivo by demonstrating the depot-specific requirements of pro-adipogenic transcription factors.Zfp423 expression in the adipose lineage appears highly regulated. Levels of Zfp423 in white adipocytes are reduced following cold exposure and β-adrenergic receptor agonism, and increased in brown adipose depots undergoing a ‘whitening’ transformation with age or in obesity (Shao et al., 2016). The dynamic expression of Zfp423, along with the loss of function data from our genetic mouse models, reveals Zfp423 as a critical physiological suppressor of the adipocyte thermogenic gene program. Future studies into the regulation of Zfp423 expression in adipocytes and/or mural adipose precursors may lead to novel strategies to unlock the thermogenic potential of visceral adipose tissue and combat the chronic metabolic defects associated with visceral obesity.
Materials and methods
Animals
All animal experiments were performed according to procedures approved by the UTSW Animal Care and Use Committee. PdgfrbrtTA transgenic mice (C57BL/6-Tg(Pdgfrb-rtTA)58Gpta/J; JAX 028570; RRID:IMSR_JAX:028570) were previously described (Vishvanath et al., 2016). TRE-Cre (B6.Cg-Tg(tetO-cre)1Jaw/J; JAX 006234; RRID:IMSR_JAX:006234), Rosa26RmT/mG (B6.129(Cg)-Gt(ROSA)26Sor/J; JAX 007676; RRID:IMSR_JAX:007676), and WT1-Cre (Wt1/J; JAX 010911; RRID:IMSR_JAX:010911) mice were obtained from Jackson Laboratories. Zfp423loxP/loxP mice were a gift from Dr. S. Warming (Genentech) (Warming et al., 2006). Mice were maintained on a 12-hr light/dark cycle in a temperature-controlled environment (room temperature, 22°C; thermoneutrality, 30°C; cold exposure, 6°C). Mice were given free access to food and water, and maintained on a standard chow diet, Dox-containing chow (600 mg/kg doxycycline, Bio-Serv, S4107), or a dox-containing HFD (600 mg/kg dox, 60% kcal% fat, BioServ, S5867). For acute β−3 adrenergic agonist administration, mice were transferred to 30°C chambers for two weeks then injected intraperitoneally with vehicle or CL316243 (1 mg/kg/day) for 3 days. For chronic β−3 adrenergic agonist administration, mice were anesthetized by 2% isoflurane, and Alzet osmotic minipumps filled with vehicle (PBS) or CL 316243 (1mg/kg/24 hr) were implanted subcutaneously in the dorsal region of the animals.
Histological analysis
Adipose tissues were harvested from perfused (4% paraformaldehyde) adult mice. Paraffin processing and embedding was performed by the Molecular Pathology Core Facility at UTSW. Indirect immunofluorescence was performed as previously described (Vishvanath et al., 2016). Antibodies used for immunofluorescence include: anti-GFP 1:700 (Abcam ab13970, RRID:AB_300798), anti-perilipin 1:1500 (Fitzgerald 20R-PP004, RRID:AB_1288416), anti-chicken Alexa 488 1:200 (Invitrogen, RRID:AB_142924), anti-guinea pig Alexa 647 1:200 (Invitrogen, RRID:AB_141882), and anti-guinea pig Alexa 488 1:200 (Invitrogen, RRID:AB_142018). For Ucp1 immunohistochemistry, paraffin-embedded sections were incubated with anti-Ucp1 (Abcam ab10983; 1:500, RRID:AB_2241462), followed by secondary and tertiary signal amplification and detection using biotinylated anti-rabbit secondary (Vector BA-1100, RRID:AB_2336201), HRP-conjugated streptavidin (Dako), and DAB substrate (Thermo). For quantification of adipocyte hyperplasia, paraffin sections were stained with perilipin and GFP by indirect immunofluorescence. The number of GFP+ perilipin+ and GFP- perilipin+ adipocytes were counted on 8–10 randomly selected 10X images of stained WAT depots. A total of 3,000–5,000 perilipin+ adipocytes were counted from each mouse. Each data point represents the percentage of GFP+ perilipin+ adipocytes from one mouse.
Isolation of adipose tissue SVF and FACS
SVF was isolated as previously described (Shao et al., 2016). Briefly, minced adipose tissue was placed in digestion buffer (100 mM HEPES pH 7.4, 120 mM NaCl, 50 mM KCl, 5 mM glucose, 1 m CaCl2, 1.5% BSA, and 1 mg/mL collagenase D (Roche 11088882001) and incubated in a 37°C shaking water bath for 2 hr. The mixture was then passed sequentially through a 100 µm cell strainer then a 40 µm cell strainer. Cells were blocked in 2% FBS/PBS containing anti-mouseCD16/CD32 Fc Block (clone 2.4G2; 1:200; RRID:AB_394657), then incubated with primary antibodies (anti-CD31 clone 390 1:200, RRID:AB_312903; anti-CD45 clone 30-F11 1:200, RRID:AB_312971; anti-CD140b clone APB5 3:200, RRID:AB_2268091). Cells were sorted using a FACSAriaTM flow cytometer (UTSW Flow Cytometry Core Facility).
Adipocyte differentiation assays
Adipose tissue SVF was isolated as described above. Cells were plated onto collagen-coated dishes and incubated at 10% CO2. Gonadal SVF was maintained in growth media (60% pH7–7.4 low glucoseDMEM, 40% pH 7.25 MCDB201 (Sigma M6770)), supplemented with 2% FBS (Fisher Scientific 03-600-511 Lot FB-002) 1% ITS premix (Insulin-Transferrin-Selenium) (BD Bioscience 354352), 0.1 mM L-ascorbic acid-2-2phosphate (Sigma A8960-5G), 10 ng/mL FGF basic (R&D systems 3139-FB-025/CF), Pen/Strep, and gentamicin. Inguinal SVF was maintained in DMEM/F12 (Invitrogen) supplemented with Glutamax, 10% FBS, Pen/Strep, and gentamicin. Upon reaching confluence, cultures were incubated with the adipogenesis induction cocktail (growth media supplemented with 5 mg/ml insulin, 1 μM dexamethasone, 0.5 mM isobutylmethyxanthine, and 1 μM rosiglitazone) for 48 hr. After 48 hr, the cells were maintained in growth media supplemented with 5 mg/ml insulin and 1 μM rosiglitazone until harvest.
Oil red O staining
Differentiated cells were fixed in 4% PFA for 15 min at room temperature then washed twice with water. Cells were incubated in Oil Red O working solution (2 g Oil red O in 60% isopropanol) for 10 min to stain accumulated lipids. Cells were then washed three times with water before bright field images were acquired.
Gene expression analysis
Relative mRNA levels were determined by quantitative PCR using SYBR Green chemistry. Values were normalized to Rps18 levels using the ΔΔ-Ct method. Unpaired Student's t-test was used to evaluate statistical significance. All primer sequences are listed in Table 1. mRNA library preparation and RNA-sequencing was performed by the McDermott Center Sequencing Core at UT Southwestern. Total RNA used for library preparation was extracted from gonadal, inguinal, and brown adipose tissues of Control and Vis-KO mice after 3 days of treatment with CL-316,243 at thermoneutrality, as described above. Sequencing was performed on an Illumina HiSeq 2500 and reads were mapped to the mouse genome (mm10). Analysis was performed by the UT Southwestern McDermott Bioinformatics Core using Cufflinks/Cuffdiff software. Genes with an FDR < 0.05 were considered significantly differentially expressed between groups compared. Heatmaps were generated using the Pheatmap package in RStudio (v3.3). The cluster dendogram was generated using Hierarchical Cluster Analysis in RStudio (v3.3). Gene Ontology analysis was performed using the DAVID Functional Annotation tool (https://david.ncifcrf.gov/) on differentially expressed genes between groups compared. Functional annotation for gene ontology using the GOTERM_CC_FAT category was selected and biological processes were assessed for statistical significance. All raw sequencing data has been deposited to Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE98132).
Table 1.
qPCR primer sequences utilized for gene expression analysis
DOI:
http://dx.doi.org/10.7554/eLife.27669.018
Gene
Forward 5'−3'
Reverse 5'−3'
Adipoq
AGATGGCACTCCTGGAGAGAA
TTCTCCAGGCTCTCCTTTCCT
Adipsin
CTACATGGCTTCCGTGCAAGT
AGTCGTCATCCGTCACTCCAT
Cidea
TCCTATGCTGCACAGATGACG
TGCTCTTCTGTATCGCCCAGT
Cited1
AACCTTGGAGTGAAGGATCGC
GTAGGAGAGCCTATTGGAGATGT
Dio2
CATTGATGAGGCTCACCCTTC
GGTTCCGGTGCTTCTTAACCT
Ear2
CCACAAAGCAGACAGGGAAAC
GCATGAGGCAAGCATTAGGAC
Elovl3
GTGTGCTTTGCCATCTACACG
CTCCCAGTTCAACAACCTTGC
Fabp4
GATGAAATCACCGCAGACGAC
ATTCCACCACCAGCTTGTCAC
Foxo1
GGCACTCCAAAACAGGACTTG
AAGAAATGGCAGAGGGAGGAG
G6pc
GGGCTGTTTGAGGAAAGTGTG
TATCCGACAGGAGGCTGGTAA
Gsta3
AGATCGACGGGATGAAACTGG
CAGATCCGCCACTCCTTCT
Hoxa9
CCCCGACTTCAGTCCTTGC
GATGCACGTAGGGGTGGTG
Lhx8
GAGCTCGGACCAGCTTCA
TTGTTGTCCTGAGCGAACTG
Pck1
TGTCTGTCCCATTGTCCACAG
AAGGTAAGGAAGGGCGGTGTA
Pgc1α
GCACCAGAAAACAGCTCCAAG
CGTCAAACACAGCTTGACAGC
Pparg2
GCATGGTGCCTTCGCTGA
TGGCATCTCTGTGTCAACCATG
Prdm16
ACACGCCAGTTCTCCAACCTGT
TGCTTGTTGAGGGAGGAGGTA
Resistin
AAGAACCTTTCATTTCCCCTCCT
GTCCAGCAATTTAAGCCAATGTT
Rps18
CATGCAAACCCACGACAGTA
CCTCACGCAGCTTGTTGTCTA
Tcf21
CCCTGAAAGTGGACTCCAACA
GCTGAGCGGGCTTTTCTTAGT
Tle3
GAGACTGAACACAATCCTAGCC
GGAGTCCACGTACCCCGAT
Tmem26
AGGGGCTTCCTTAGGGTTTTC
CCGTCTTGGATGAAGAAGCTG
Ucp1
TCTCAGCCGGCTTAATGACTG
GGCTTGCATTCTGACCTTCAC
Wt1
ATAGGCCAGGGCATGTGTATG
CTGGTGCCTTGCTCTCTGATT
Zfp423
CAGGCCCACAAGAAGAACAAG
GTATCCTCGCAGTAGTCGCACA
Zic1
CTGTTGTGGGAGACACGATG
CCTCTTCTCAGGGCTCACAG
qPCR primer sequences utilized for gene expression analysisDOI:
http://dx.doi.org/10.7554/eLife.27669.018
Metabolic phenotyping
Metabolic cage studies were conducted using TSE Phenomaster cages (TSE Systems, Chesterfield, Missouri) at the USTW Metabolic Phenotyping Core. Mice were acclimated in the metabolic chambers for 5 days before the start of the experiments. Food intake, movement, and CO2 and O2 levels were measured every 60 min for each mouse over a period of 5 days. For glucose tolerance tests, mice were fasted overnight and then administered glucose by intraperitoneal injection (1 g/kg body weight, Sigma). For insulin tolerance tests, mice were fasted for 4 hr and then administered insulin by intraperitoneal injection (0.75 U/kg body weight humaninsulin, Eli Lilly). At the indicated time-points, tail blood was collected. Hyperinsulinemic euglycemic clamps were performed on conscious, unrestrained mice as previously described (Holland et al., 2011). Blood glucose was measured using Bayer Contour glucometers. Serum triglycerides were measured using Infinity Triglycerides Reagent (Thermo Fisher Scientific). Serum insulin was measured using Ultra Sensitive MouseInsulin ELISA (Crystal Chem).
Cold exposure
Mice 8 weeks of age were transferred to a 30°C chamber (thermoneutrality) for two weeks. One week before cold exposure, IPTT-300 temperature transponders (Bio Medic Data Systems) were implanted subcutaneously in the dorsal region of the mice. Body temperature was assessed using a DAS-7006/7 s reader (Bio Medic Data Systems). The mice were then transferred to the cold chamber (6°C) or maintained at thermoneutrality. For the acute cold tolerance test, food was removed from the cages upon transfer to the cold chamber and body temperature was measured at the indicated time points. For the acclimated cold exposure test, food was removed from the cages after 4 weeks of acclimation to cold and body temperature was measured at the indicated time points.
Mitochondrial function and respiration
Adipose tissue fragments or cultured adipocytes were assayed for oxygen consumption rate (OCR) using an XF24 Extracellular Flux Analyzer (Seahorse Bioscience, MA). Assays of mitochondrial function and respiration rates in whole adipose tissues or cells were performed as previously described (Shao et al., 2016). In brief, adipose tissue was cut into 5–10 mg pieces and locked into an XF24 islet-capture Microplate (Seahorse Bioscience). Adipose tissues or cultured adipocytes were equilibrated for 1 hr at 37°C in a CO2-free incubator in XF Assay Medium (Modified DMEM, 0 mM Glucose; Seahorse Bioscience) (pH 7.4), supplemented with 1 mM sodium pyruvate, 1 mM L- Glutamine and 7 mM glucose. Tissues or cells were subjected to a 10 min equilibration period and three assay cycles to measure the basal rate, comprising a 3 min mix, a 2 min wait and a 3 min measure period each. For cells, compounds were then added by automatic pneumatic injection followed by assay cycles after each, comprising of 3 min mix, 2 min wait and a 3 min measure period. OCR measurements were obtained following sequential additions of oligomyin (3 µM final concentration), FCCP (9 µM) and antimycinA/rotenone (3 µM/30 nM). OCR measurements were recorded at set interval time points. All compounds and materials above were obtained from Sigma-Aldrich.
Statistical analysis
All data were expressed as the mean ± SEM. We used GraphPad Prism 7.0 (GraphPad Software, Inc., La Jolla, CA, USA) to perform the statistical analyses. Each experiment was performed at least twice and representative data are shown. For comparisons between two independent groups, a Student’s t-test was used and p<0.05 was considered statistically significant. The sample size estimation was determined as described below. All the detailed sample sizes, statistical test methods, and p-values are listed in Table 2. Longitudinal metabolic cohorts were designed to detect a 25% improvement of glucose tolerance or a similar magnitude of insulin resistance with an assumed 15% standard deviation of the group means at a power of 80% and an alpha of 0.05. This predicted approximately six animals per test group. All animals in the cohort were subsequently used for downstream assays (gene expression, IHC, western blot) to eliminate selection bias. We estimated the approximate effect size based on independent preliminary studies. Studies designed to characterize an in vitro difference in metabolic flux were estimated to have a slightly larger effect size of 30% with assumed 15% standard deviation of group means. To detect this difference at a power of 80% and an alpha of 0.05, we predicted we would need four independent replicates per group. We estimated this effect size based on independent preliminary studies.
Table 2.
Statistical information.
DOI:
http://dx.doi.org/10.7554/eLife.27669.019
Figure
N(sample size)
Statistical test method
Description
p-value
1B
Control n = 6
Unpaired Student’s t test
gWAT
4.56E-08
Vis-KO n = 6
mWAT
0.0019
rWAT
0.0002
1D
Control n = 6
Unpaired Student’s t test
iWAT
0.0043
Vis-KO n = 6
gWAT
0.0051
1E
Control n = 6
Unpaired Student’s t test
iWAT
Adipoq
0.0111
Vis-KO n = 6
gWAT
Adipsin
0.004
1F
Control n = 6
Unpaired Student’s t test
iWAT
Cidea
0.012678087
Vis-KO n = 6
Dio2
0.015258263
Elovl3
0.035976522
Prdm16
0.043549713
gWAT
Cidea
6.91848E-06
Dio2
0.017046004
Prdm16
9.5932E-05
mWAT
Cidea
0.008754783
Dio2
0.013198702
Prdm16
0.018964447
rWAT
Cidea
4.6109E-07
Dio2
0.000934576
Prdm16
0.000260661
1G
Control n = 6
Unpaired Student’s t test
iWAT
0.019621248
Vis-KO n = 6
gWAT
0.002534473
mWAT
0.000189507
rWAT
7.14636E-06
1H
Control n = 4
Unpaired Student’s t test
gWAT
Basal
0.02847
Vis-KO n = 4
1I
Control n = 4
Unpaired Student’s t test
mWAT
Basal
0.00457
Vis-KO n = 4
1J
Control n = 4
Unpaired Student’s t test
rWAT
Basal
0.04901
Vis-KO n = 4
1K
Control n = 4
Unpaired Student’s t test
iWAT
Basal
0.03254
Vis-KO n = 4
2B
Control n = 4
Unpaired Student’s t test
Inguinal
Adipoq
0.00251
Vis-KO n = 4
2D
Control n = 4
Unpaired Student’s t test
Gonadal
Zfp423
2.1E-06
Vis-KO n = 4
2E
Control n = 4
Unpaired Student’s t test
Gonadal
Cidea (red bar)
3.1573E-06
Vis-KO n = 4
Cidea (blue bar)
0.028888184
Dio2
0.039314815
Ppargc1a
0.00022784
Ucp1 (red bar)
0.004431674
Ucp1 (blue bar)
0.000356176
2F
Control n = 4
Unpaired Student’s t test
Gonadal
Basal
6.73733E-05
Vis-KO n = 4
Oligo.
0.000488801
FCCP
0.02909696
2G
Control n = 4
Unpaired Student’s t test
Gonadal
0.03356
Vis-KO n = 4
2H
Control n = 4
Unpaired Student’s t test
Gonadal
Gsta3
0.019517318
Vis-KO n = 4
Tcf21
0.014978261
Wt1
0.000632618
Ear2
0.009978141
Hoxa9
0.000427928
Tmem26
0.004299176
Zic1
0.034783957
3A
Control n = 5
Unpaired Student’s t test
gWAT
0.000759641
Vis-KO n = 4
rWAT
0.001739073
3B
Control n = 5
Cidea
0.000155141
Vis-KO n = 4
Dio2
0.009600651
Prdm16 (red bar)
0.002457629
Prdm16 (blue bar)
7.9394E-05
3G
Control n = 5
Unpaired Student’s t test
gWAT
Gsta3
0.044793954
Vis-KO n = 4
Resistin
0.002421899
Tmem26
0.011651978
5A
Control n = 5
Unpaired Student’s t test
gWAT
Ucp1
0.011438323
Vis-KO n = 4
rWAT
Ucp1
0.001188624
5B
Control n = 5
Unpaired Student’s t test
rWAT
Cidea
0.000780591
Vis-KO n = 4
Dio2
0.002682038
Elovl3
0.01642267
Prdm16 (red bar)
0.042213109
Prdm16 (blue bar)
0.000810897
gWAT
Dio2
0.0221
Prdm16
0.0127
5L
Control n = 5
Unpaired Student’s t test
t = 4 hr
0.014972958
Vis-KO n = 4
t = 5 hr
0.035138826
6D
Control n = 7
Unpaired Student’s t test
gWAT
Zfp423
0.002716658
Vis-KO n = 6
mWAT
Zfp423
0.042346922
rWAT
Zfp423
0.018568608
6E
Control n = 7
Unpaired Student’s t test
iWAT
Ucp1
0.002716658
Vis-KO n = 6
gWAT
Ucp1
0.042346922
rWAT
Ucp1
0.018568608
6F
Control n = 7
Unpaired Student’s t test
iWAT
Cidea
0.044864901
Vis-KO n = 6
gWAT
Cidea
0.011872021
Prdm16
0.046343663
6H
Control n = 4
Unpaired Student’s t test
gWAT
0.00648
Vis-KO n = 4
6I
Control n = 4
Unpaired Student’s t test
mWAT
0.03908
Vis-KO n = 4
6J
Control n = 4
Unpaired Student’s t test
rWAT
0.03982
Vis-KO n = 4
7D
Control n = 4
Unpaired Student’s t test
O2 Consumption
24 hr
0.020700477
Vis-KO n = 5
Dark
0.006034333
7E
Control n = 4
Unpaired Student’s t test
Heat Production
24 hr
0.022957861
Vis-KO n = 5
Dark
0.007378241
7F
Control n = 4
Unpaired Student’s t test
CO2 Production
24 hr
0.041576891
Vis-KO n = 5
Dark
0.017964281
8A
Control n = 7
Unpaired Student’s t test
t = 0 min
0.043779825
Vis-KO n = 6
t = 15 min
0.004769743
t = 30 min
0.012903721
t = 60 min
0.014915684
8B
Control n = 7
Unpaired Student’s t test
t = 0 min
0.009873322
Vis-KO n = 6
t = 30 min
0.01583899
8C
Control n = 7
Unpaired Student’s t test
t = 30 min
0.0426
Vis-KO n = 6
8D
Control n = 6
Unpaired Student’s t test
Glucose Infusion Rate
0.04689
Vis-KO n = 5
8E
Control n = 6
Unpaired Student’s t test
Hepatic Glucose Prod.
Basal
0.039627397
Vis-KO n = 5
Clamped
0.0346953
8F
Control n = 7
Unpaired Student’s t test
Liver
Foxo1
0.046418578
Vis-KO n = 6
G6Pc
0.024438785
Pck1
0.047698079
8G
Control n = 7
Unpaired Student’s t test
TAG
0.02449
Vis-KO n = 6
8I
Control n = 4
Unpaired Student’s t test
2-DG Uptake
rWAT
0.04023
Vis-KO n = 5
9B
Control n = 4
Unpaired Student’s t test
Pdgfrβ cells
1.1E-05
iMural-KO n = 5
10C
Control n = 8
Unpaired Student’s t test
gWAT
0.00276
iMural-KO n = 6
10I
Control n = 8
Unpaired Student’s t test
t = 30 min
0.003328841
iMural-KO n = 6
t = 60 min
0.048919491
10K
Control n = 8
Unpaired Student’s t test
t = 15 min
0.03752
iMural-KO n = 6
10-S1C
Control n = 7
Unpaired Student’s t test
gWAT
7.8E-08
iMural-KO n = 7
10-S1E
Control n = 8
Unpaired Student’s t test
iWAT
Ucp1
0.015960549
iMural-KO n = 6
gWAT
Ucp1
0.005703268
rWAT
Ucp1
0.011883251
10-S1F
Control n = 5
Unpaired Student’s t test
iWAT
0.00019253
Vis-KO n = 5
gWAT
0.042623514
mWAT
0.017424031
rWAT
0.00228672
Statistical information.DOI:
http://dx.doi.org/10.7554/eLife.27669.019In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Directing Visceral White Adipocyte Precursors to a Thermogenic Adipocyte Fate Improves Insulin Sensitivity in Obesity" for consideration by eLife. Your article has been favorably evaluated by Fiona Watt as the Senior Editor, Peter Tontonoz as the Reviewing Editor, and two reviewers.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission..Summary:The manuscript by Zhang et al. provides compelling evidence that visceral white fat-selective deletion of ZFP423 causes a "browning" of white fat and improves glucose homeostasis. The authors utilized two mouse models to reveal a role for Zfp423 in visceral WAT browning. They deleted Zfp423 specifically in visceral WAT depots by crossing Zfp423-floxed mice with Wt1-Cre mice and generated mice with inducible Zfp423 deletion in Pdgfrβ-expressing mural cells. They also showed in cultured cell experiments that deletion of ZFP423 caused the white adipocyte browning in a cell-autonomous manner. Although the visceral WAT browning in response to ZFP423 inactivation did not affect adiposity under a high-fat diet, the KO mice exhibited improved glucose tolerance and insulin tolerance.Given that subcutaneous WAT is considered the major site for WAT browning, the novelty of this study resides in discovery of the potential for visceral adipose tissue to undergo a thermogenic phenotype switch as a result of genetic manipulation.The reviewers were in agreement that the work was interesting and potentially of interest to the general audience of eLife. The studies were judged to be technically sound and the reviewers believed that the majority of the conclusions drawn were supported by the data. At the same time, the review process identified several opportunities to strengthen the work.Essential revisions:1) The data in Figure 5 are convincing that glucose tolerance is improved in KO mice. It would be interesting to test the extent to which glucose uptake in the adipose tissues is enhanced, or other tissues like the skeletal muscle may be involved. It would also be insightful to test insulin sensitivity or insulin signaling in the liver and muscle.2) In Figure 1, it is intriguing that tissue respiration among the WAT depots are similar despite the large difference in UCP1 expression (UCP1 mRNA in the inguinal WAT is much higher than those in visceral WAT depots). The authors should examine if the high OCR in the KO mice was due to uncoupling respiration (oligomycin-insensitive respiration) or not.3) In the context of therapy, how much could visceral WAT browning contribute to systemic energy expenditure? Figure 6—figure supplement 2C showed that only about 6% of all adipocytes are multilocular in iMural-KO mice after CL treatment. With such small numbers of multilocular cells, it is impressive that the authors observed large differences in GTT and ITTs. It would be helpful if the authors could provide whole-animal metabolic chamber data to support systemic metabolic improvement of these mice.4) The authors demonstrated that Wt1-Cre Zfp423 KO mice lost Zfp423 expression exclusively in visceral WAT depots. However, Figure 1F-1K showed upregulation of thermogenic genes and OCR in not only visceral WAT but also inguinal WAT depot. Similar results on Ucp1 expression were also observed after high-fat diet feeding (Figure 5D). Therefore, changes in systemic glucose metabolism and serum lipid levels shown later on in Figure 5 may not be entirely a direct result of visceral WAT browning.5) In Figure 6 and Figure 6—figure supplement 1, the authors showed enhanced thermogenic adaptation and improved glucose tolerance in the iMural-KO mice in response to CL treatment. However, Zfp423 deletion in this mouse model is not only in visceral WAT but also in subcutaneous WAT, because Pdgfrβ is expressed in the progenitor cells of both. Therefore, the improved metabolic phenotype cannot be exclusively attributed to loss of Zfp423 in visceral mural cells. Have the investigators examined any effects in iWAT, for example with similar studies shown in Figure 6—figure supplement 2A-C?Essential revisions:1) The data inThis is a great suggestion, particularly as this is a unique model of visceral WAT selective browning. The reviewer asks great questions that are best answered by the use of hyperinsulinemic euglycemic clamps; this assay is the gold standard for assessing insulin sensitivity in vivo. To further explore insulin sensitivity and glucose uptake in adipose depots and other tissues, we performed the clamp assays on control and Vis-KO mice after 8 weeks of high fat diet feeding (when glucose tolerance is improved and body weight is not altered).– The glucose infusion rate needed to maintain euglycemia (~137 mg/dl) was increased in Vis-KO mice. This demonstrates an increase in whole-body insulin sensitivity, consistent with our insulin tolerance tests.– Importantly, hepatic glucose output was suppressed much more efficiently during the basal and clamped states in Vis-KO mice. These data indicate improved insulin sensitivity at the level of the liver.– Tracer kinetics indicate that the rate of disposal of glucose was not significantly different between control and Vis-KO mice, suggesting minimal differences in insulin-stimulated glucose uptake by the muscle.– However, 2-DG uptake was enhanced in the visceral rWAT depots, correlating with where the largest degree of beiging is observed.All together these data demonstrate visceral deletion of Zfp423 leads to enhanced insulin sensitivity and reduced hepatic glucose output. These new data are presented in the new Figure 8 of the manuscript.2) InThe reviewers raise a good point. It is not our intention to make any comparisons across WAT depots. We only wish to compare controls to KO animals, within the same depots. For this reason, we plot OCRs from different depots in different graphs. Nevertheless, to answer the reviewers’ question we think that there are technical limitations when using whole tissue fragments in the Seahorse assay that prevent us from comparing OCRs across different depots. In particular, it is difficult to compare oxygen consumption rates between different depots when considering differences in cell composition and lipid content. We are unable to assume that the drug diffusion dynamics will be the same across depots in these assays. In order to better illustrate the comparisons that we wish to convey, we have now revised the OCR graphs throughout the manuscript to represent OCRs of KO whole adipose tissue relative to those from controls (i.e. normalized to 1). This, in fact, is how others have presented these types of data in the literature (1).More importantly, to address the question of whether elevated OCR in the KO mice is actually due to uncoupled respiration, we performed new and more comprehensive assays of adipocyte mitochondrial bioenergetics using 2D in vitro-derived cultured gonadal adipocytes.We have now included basal, uncoupled (oligomycin), maximal (FCCP), and non-mitochondrial (rotenone/antimycin A) respiration of control and Vis-KO cultured gonadal adipocytes in Figure 2. We observed higher uncoupled respiration in Vis-KO gonadal adipocyte cultures, consistent with the notion Zfp423-deficient visceral adipocytes are more brown/beige-like.3) In the context of therapy, how much could visceral WAT browning contribute to systemic energy expenditure? Figure 6—figure supplement 2C showed that only about 6% of all adipocytes are multilocular in iMural-KO mice after CL treatment. With such small numbers of multilocular cells, it is impressive that the authors observed large differences in GTT and ITTs. It would be helpful if the authors could provide whole-animal metabolic chamber data to support systemic metabolic improvement of these mice.Great suggestion. Ultimately, the logistics of the pump implantation complicate metabolic chamber experiments (IACUC protocol issues). Moreover, we find that the pump implantation complicates analysis of the data normalization to lean mass. To address this question and better understand what maximal visceral browning can do, we performed new metabolic cages studies with the Vis-KO model. We assessed parameters of energy expenditure and food intake of control and Vis-KO mice after 8 weeks of HFD feeding.– We do not detect significant differences in food intake or activity between control and Vis-KO mice.– However, O2 consumption, CO2 production, and heat production are all elevated in the KO animals. These new data demonstrate visceral WAT deletion of Zfp423 (and thus visceral browning) enhances energy expenditure, albeit not a strong enough degree to drive a robust difference in body weight.All of these new data are presented in a brand new Figure 7. As eluded to by the reviewers, these data highlight the idea that beige (or beige-like) cells are likely exerting beneficial effects on glucose homeostasis independent of their impact on body weight.4) The authors demonstrated that Wt1-Cre Zfp423 KO mice lost Zfp423 expression exclusively in visceral WAT depots. However,Point well-taken! Given that the genetic perturbation is selective to visceral WAT depots, we would still argue that these visceral depots are ultimately the driver of the phenotype, and that the impact on iWAT must be secondary. As we now discuss further in the manuscript (revised Discussion section), we cannot rule out the possibility that Zfp423 deficiency may impact the overall visceral adipose phenotype in a number of ways that influence energy metabolism. It is possible that Zfp423-deficient visceral adipocytes produce circulating adipokines that influence systemic metabolism and perhaps drive “secondary beiging” in other depots. The new clamp studies of Vis-KO mice (new Figure 8) shed some additional insight on this issue. First and foremost, glucose uptake is enhanced in the rWAT depots, correlating with where the visceral WAT browning is most prominent. Moreover, the data largely point to the liver as a major site of improved insulin sensitivity. Previously reported work on Prdm16 and subcutaneous WAT beiging suggest a strong connection between subcutaneous beige cells and liver health (2). For the field at large, it remains an open question as to how brown/beige adipocytes exert beneficial effects on systemic metabolism, independent of their impact on body weight. We intend to use this unique model as a tool to explore the mechanisms of how visceral WAT browning leads to improved glucose metabolism.5) In Figure 6—figure supplement 1, the authors showed enhanced thermogenic adaptation and improved glucose tolerance in the iMural-KO mice in response to CL treatment. However, Zfp423 deletion in this mouse model is not only in visceral WAT but also in subcutaneous WAT, because Pdgfrβ is expressed in the progenitor cells of both. Therefore, the improved metabolic phenotype cannot be exclusively attributed to loss of Zfp423 in visceral mural cells. Have the investigators examined any effects in iWAT, for example with similar studies shown in Figure 6—figure supplement 2A-C?We thank the reviewers for this question and the suggestion to further the analysis of this model. We now include the suggested iWAT analysis in the manuscript (new Figure 10—figure supplement 1). The new data, long with our prior publication of this model (3), illustrate important points regarding the emergence of adipocytes from the Pdgfrβ+ lineage:– In association with 12 weeks of HFD feeding, de novo adipocyte differentiation from the mural cell lineage is largely restricted to visceral WAT depots. Overall, ~10-15% of gonadal adipocytes within obesemice represent “new” adipocytes that emerge from Pdgfrβ+ precursors.– In the inguinal WAT depot, only 1-2% of adipocytes represent new adipocytes emerging from Pdgfrβ+ precursors. In fact, there is very little de novo adipogenesis (from any origin) occurring in the iWAT of male HFD-fed mice (4).– When obesemice (8 weeks HFD-fed) are treated with CL for 4 weeks, very little, if any, additional adipocytes emerge from Pdgfrβ+ precursors in either gWAT or iWAT.– In the iMural-KO model, Dox-administration induces deletion of Zfp423 in mural cells in all adipose tissue depots; however, this leads to the formation of Zfp423-deficient adipocytes predominantly in visceral WAT depots of obesemice.– Upon CL treatment of obese animals, we now observe the presence of multilocular adipocytes in KO visceral WAT (compared to barely any in control mice).– However, there is no difference in the number of multilocular inguinal adipocytes between CL treated control and KO animals.As such, inactivation of Zfp423 in the Pdgfrβ+ lineage leads to the formation of Zfp423-deficient visceral adipocytes that adopt a beige-like phenotype upon activation with the β3AR agonist. This selective induction of visceral browning upon β3AR treatment is associated with improved insulin sensitivity.Nevertheless, the reviewers raise a good point: In the iMural-KO model, Zfp423 is deleted in mural cells throughout the body. However, the dependency of the phenotype of β3AR activation does suggest that the beige cells are driving the improvements in glucose metabolism. When considered in combination with the data from the Vis-KO model, these data support the general conclusion that directing visceral adipocyte precursors to adopt a beige-like adipocyte phenotype leads to improved insulin sensitivity in obesity.We have now revised the Discussion section of the manuscript to highlight some of the limitations to these models.References1) Stine RR, Shapira SN, Lim HW, Ishibashi J, Harms M, Won KJ, Seale P. EBF2 promotes the recruitment of beige adipocytes in white adipose tissue. Mol Metab. 2016;5(1):57-65. doi: 10.1016/j.molmet.2015.11.001. PubMed PMID: 26844207; PMCID: PMC4703852.2) Cohen P, Levy JD, Zhang Y, Frontini A, Kolodin DP, Svensson KJ, Lo JC, Zeng X, Ye L, Khandekar MJ, Wu J, Gunawardana SC, Banks AS, Camporez JP, Jurczak MJ, Kajimura S, Piston DW, Mathis D, Cinti S, Shulman GI, Seale P, Spiegelman BM. Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell. 2014;156(1-2):304-16. doi: 10.1016/j.cell.2013.12.021. PubMed PMID: 24439384; PMCID: PMC3922400.3) Vishvanath L, MacPherson KA, Hepler C, Wang QA, Shao M, Spurgin SB, Wang MY, Kusminski CM, Morley TS, Gupta RK. Pdgfrbeta+ Mural Preadipocytes Contribute to Adipocyte Hyperplasia Induced by High-Fat-Diet Feeding and Prolonged Cold Exposure in Adult Mice. Cell Metab. 2016;23(2):350-9. doi: 10.1016/j.cmet.2015.10.018. PubMed PMID: 26626462; PMCID: PMC4749445.4) Wang QA, Tao C, Gupta RK, Scherer PE. Tracking adipogenesis during white adipose tissue development, expansion and regeneration. Nat Med. 2013;19(10):1338-44. doi: 10.1038/nm.3324. PubMed PMID: 23995282; PMCID: PMC4075943.
Authors: Lavanya Vishvanath; Karen A MacPherson; Chelsea Hepler; Qiong A Wang; Mengle Shao; Stephen B Spurgin; Margaret Y Wang; Christine M Kusminski; Thomas S Morley; Rana K Gupta Journal: Cell Metab Date: 2015-11-25 Impact factor: 27.287
Authors: Kosaku Shinoda; Ineke H N Luijten; Yutaka Hasegawa; Haemin Hong; Si B Sonne; Miae Kim; Ruidan Xue; Maria Chondronikola; Aaron M Cypess; Yu-Hua Tseng; Jan Nedergaard; Labros S Sidossis; Shingo Kajimura Journal: Nat Med Date: 2015-03-16 Impact factor: 53.440
Authors: Wouter D van Marken Lichtenbelt; Joost W Vanhommerig; Nanda M Smulders; Jamie M A F L Drossaerts; Gerrit J Kemerink; Nicole D Bouvy; Patrick Schrauwen; G J Jaap Teule Journal: N Engl J Med Date: 2009-04-09 Impact factor: 91.245
Authors: Ambre M Bertholet; Lawrence Kazak; Edward T Chouchani; Marta G Bogaczyńska; Ishan Paranjpe; Gabrielle L Wainwright; Alexandre Bétourné; Shingo Kajimura; Bruce M Spiegelman; Yuriy Kirichok Journal: Cell Metab Date: 2017-04-04 Impact factor: 27.287
Authors: Florian W Kiefer; Cecile Vernochet; Patrick O'Brien; Steffen Spoerl; Jonathan D Brown; Shriram Nallamshetty; Maximilian Zeyda; Thomas M Stulnig; David E Cohen; C Ronald Kahn; Jorge Plutzky Journal: Nat Med Date: 2012-06 Impact factor: 53.440
Authors: Thomas Thomou; Marcelo A Mori; Jonathan M Dreyfuss; Masahiro Konishi; Masaji Sakaguchi; Christian Wolfrum; Tata Nageswara Rao; Jonathon N Winnay; Ruben Garcia-Martin; Steven K Grinspoon; Phillip Gorden; C Ronald Kahn Journal: Nature Date: 2017-02-15 Impact factor: 49.962
Authors: Mengle Shao; Qiong A Wang; Anying Song; Lavanya Vishvanath; Napoleon C Busbuso; Philipp E Scherer; Rana K Gupta Journal: Diabetes Date: 2019-10 Impact factor: 9.461
Authors: Eun-Hee Koh; Natasha Chernis; Pradip K Saha; Liuling Xiao; David A Bader; Bokai Zhu; Kimal Rajapakshe; Mark P Hamilton; Xia Liu; Dimuthu Perera; Xi Chen; Brian York; Michael Trauner; Cristian Coarfa; Mandeep Bajaj; David D Moore; Tuo Deng; Sean E McGuire; Sean M Hartig Journal: Diabetes Date: 2018-07-12 Impact factor: 9.461