Melting of polymeric DNA double helix at elevated temperature: a molecular dynamics approach.

Genomic DNA of higher organisms exists as extremely long polymers, while in bacteria and other lower organisms it is circular with no terminal base pairs. Temperature-induced melting of the DNA double helix by localized strand separation has been unattainable by molecular dynamic simulations due to more rapid fraying of the terminal base pairs in oligomeric DNA. However, local-sequence-dependent unfolding of the DNA double helix is extremely important for understanding various biochemical phenomena, and can be addressed by simulating a model polymeric DNA duplex. Here, we present simulations of polymeric B-DNA of sequence d(CGCGCGCGAATTCGCGCGCG)2 at elevated temperatures, along with its equivalent oligomeric constructs for comparison. Initiation of temperature-induced DNA melting was observed with higher fluctuations of the central d(AATT) region only in the model polymer. The polymeric construct shows a definite melting start site at the weaker A/T stretch, which propagates slowly through the CG rich regions. The melting is reflected in the hydrogen bond breaking, i.e. basepair opening, and by disruption of stacking interaction between successive basepairs. Melting at higher temperature of the oligomer, however, was only through terminal fraying, as also reported earlier.