Literature DB >> 28702086

Transcriptome and key genes expression related to carbon fixation pathways in Chlorella PY-ZU1 cells and their growth under high concentrations of CO2.

Yun Huang1,2, Jun Cheng1, Hongxiang Lu1, Yong He1, Junhu Zhou1, Kefa Cen1.   

Abstract

BACKGROUND: The biomass yield of Chlorella PY-ZU1 drastically increased when cultivated under high CO2 condition compared with that cultivated under air condition. However, less attention has been given to the microalgae photosynthetic mechanisms response to different CO2 concentrations. The genetic reasons for the higher growth rate, CO2 fixation rate, and photosynthetic efficiency of microalgal cells under higher CO2 concentration have not been clearly defined yet.
RESULTS: In this study, the Illumina sequencing and de novo transcriptome assembly of Chlorella PY-ZU1 cells cultivated under 15% CO2 were performed and compared with those of cells grown under air. It was found that carbonic anhydrase (CAs, enzyme for interconversion of bicarbonate to CO2) dramatically decreased to near 0 in 15% CO2-grown cells, which indicated that CO2 molecules directly permeated into cells under high CO2 stress without CO2-concentrating mechanism. Extrapolating from the growth conditions and quantitative Real-Time PCR of CCM-related genes, the Km (CO2) (the minimum intracellular CO2 concentration that rubisco required) of Chlorella PY-ZU1 might be in the range of 80-192 μM. More adenosine triphosphates was saved for carbon fixation-related pathways. The transcript abundance of rubisco (the most important enzyme of CO2 fixation reaction) was 16.3 times higher in 15% CO2-grown cells than that under air. Besides, the transcript abundances of most key genes involved in carbon fixation pathways were also enhanced in 15% CO2-grown cells.
CONCLUSIONS: Carbon fixation and nitrogen metabolism are the two most important metabolisms in the photosynthetic cells. These genes related to the two most metabolisms with significantly differential expressions were beneficial for microalgal growth (2.85 g L-1) under 15% CO2 concentration. Considering the micro and macro growth phenomena of Chlorella PY-ZU1 under different concentrations of CO2 (0.04-60%), CO2 transport pathways responses to different CO2 (0.04-60%) concentrations was reconstructed.

Entities:  

Keywords:  15% CO2 concentration; CO2 fixation pathway; Carbonic anhydrase; Genes transcript sequences; Rubisco

Year:  2017        PMID: 28702086      PMCID: PMC5505034          DOI: 10.1186/s13068-017-0868-z

Source DB:  PubMed          Journal:  Biotechnol Biofuels        ISSN: 1754-6834            Impact factor:   6.040


Background

Global warming necessitates the reduction of accumulated CO2 in the atmosphere. Utilizing biological conversions by microalgae is a promising approach to reduce CO2 emissions [1, 2]. However, the current atmospheric CO2 concentration of ~0.04% is not enough for microalgae photosynthesis [3]. Moreover, the photosynthetic mechanism ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco), the first and stromal enzyme that catalyzes the entry of CO2 into the Calvin–Benson cycle, is adapted to the considerably higher CO2 concentrations encountered by C3 plants [4]. The K m for CO2 of microalgal rubisco, often exceed 25 μM [5]. However, the dissolved CO2 in freshwater is only ~15 μM when in equilibrium with air. However, rubisco has a poor apparent affinity with CO2 when the dissolved CO2 concentration is less than the K m (CO2) of rubisco, led to decrease in photosynthetic efficiency [6, 7]. To overcome this challenge, a number of prokaryotic and eukaryotic microalgae have developed a CO2-concentrating mechanism (CCM) to maximize photosynthesis under limited CO2 conditions [8]. Given that CO2 is the only form of dissolved inorganic carbon that rubisco can fix, the most likely evolutionary goal of the CCM process is to increase dissolved CO2 concentrations at rubisco locations for fixation [9]. A number of studies have been conducted on the mechanisms underlying the acclimation of microalgal cells to limited CO2 concentrations [7, 8, 10]. Carbonic anhydrase (CAs) and CCM play an important role in the efficient utilization of dissolved inorganic carbon under CO2-limited conditions. However, CCM requires more energy flow in PSI and leaves less energy available for the Calvin–Benson cycle, thus reducing microalgal growth and CO2 fixation efficiency [11]. Therefore, several studies have focused on CO2 fixation by microalgae from high concentrations of CO2 gas, such as flue gas, to increase CO2 fixation efficiency [12]. In our previous study, the biomass yield (2.78 g L−1) of Chlorella PY-ZU1 cultivated under 15% CO2 increased by 1.19-fold compared with that of microalgae cultivated under air (1.30 g L−1) [13]. However, less attention has been given to the photosynthetic mechanisms of microalgal response to different CO2 concentrations. And, the genetic reasons for the higher growth rate, CO2 fixation rate, and photosynthetic efficiency of domesticated microalgae cells under higher CO2 concentration remain unclear. Nevertheless, CCM models have clearly shown that CCM will work when microalgae cells are exposed to limited CO2 conditions [14]. There is still a lack of research on the exact conditions, including CO2 conditions and K m (CO2), and under which condition CCM would switch on. Moreover, the relationship between the diversity and evolutionary pathways of key carbon fixation-related genes and photosynthetic performance is still unknown because of their dependency on microalgae species [15]. Therefore, in the present study, we analyzed the transcriptome and gene expression of Chlorella PY-ZU1 cells cultivated under different CO2 concentrations and reconstructed the CO2 transport pathways into Chlorella PY-ZU1 responses to different CO2 concentrations. The growth conditions of Chlorella PY-ZU1 and DIC in the medium were also measured to extrapolate the value of K m (CO2).

Methods

Strains and media

This strain used in the present study was Chlorella PY-ZU1, a highly CO2-tolerant and fast-growing microalgal species that obtained from Chlorella pyrenoidosa after γ irradiation and high CO2 domestication [6]. The cells were maintained and cultivated in Brostol’s solution (also known as soil extract, SE) [1, 6].

Analysis of differentially expressed Chlorella PY-ZU1 genes under continuous aeration with 15% CO2 and air

Chlorella PY-ZU1 strains were cultivated in SE medium under 15% CO2 or air. Cells in the logarithmic phase (after cultivated 36 h) were collected by centrifugation for DNA extraction. The gene for full-length 18s rDNA was amplified to obtain the algal genome according to the protocol performed in Cheng’s study [16]. The following primers were utilized to amplify 18s rDNA: 18s-F, AACCTGGTTGATCCTGCCAGT and 18s-R, TGATCCTTCTGCAGGTTCACCT. The gene was inserted into the cloning vector, pMD19-T. Positive results were selected for sequencing. Total RNA was extracted by TRIzol reagent (Invitrogen) for cDNA library construction and Illumina sequencing. mRNA was separated by magnetic sand method, cleaved to synthesize double-stranded cDNA, and filled to plane. Poly (A) was added at the 3ʹ terminal end, and index connection was linked using TruSeq™ RNA Sample Preparation Kit. The target strip was enriched using polymerase chain reaction (PCR; 15 cycles) and recycled by 2% agarose gel. Quantitative determination was performed by TBS380 (Picogreen). Bridge amplification was conducted to generate cBot clusters. The 2*100 bp sequencing test was performed by HiSeq 2000 sequencing platform. Sequence assembly and annotation were similar to those performed in Cheng’s study [16].

Gene expression statistics and differential expression analysis

Total RNA extracted from algae grown in normal medium (under Air) and high-CO2 medium [15% (v/v) CO2] was used to prepare gene expression libraries using the Illumina Gene Expression Sample Prep Kit and then subjected to Illumina sequencing. The RNA-Seq reads were mapped to our transcriptome reference database, and transcript abundances were quantified by RSEM (http://deweylab.biostat.wisc.edu/rsem/). Genes with differential expression between these two samples were identified using the numbers of mapped reads as EdgeR inputs (http://www.bioconductor.org/packages/release/bioc/html/edgeR.html). Genes were defined as differentially expressed if they exhibited a 2-fold or greater change between the air and high-CO2 samples and a false discovery rate (FDR) of 5% or less. Differentially expressed genes were regarded as up-regulated if their expression levels in high-CO2 samples were significantly higher than those in air samples. Conversely, genes that showed lower expression levels in the high-CO2 samples were regarded as down-regulated. Gene set enrichment analyses were performed using goatools (https://github.com/tanghaibao/goatools) and KOBAS (http://kobas.cbi.pku.edu.cn/home.do).

Quantitative real-time PCR (qRT-PCR) validation

To investigate the developmental expression patterns of rubisco, CAs, and nitrate reductase, samples of microalgae cells cultivated for different durations under 15% CO2 or air were collected. Real-time reverse transcript polymerase chain reaction (real-time PCR, RT-PCR) was conducted with gene-specific primers pairs designed by PRIMER PREMIER5 software. The sequences of the specific primer sets are listed in Table 1. Total RNAwas extracted. qRT-PCR was performed with 20-μL reaction volumes containing 2 μL of 10-fold diluted cDNAs, 1 μM of each primer, and 10 μL SYBR Green Premix Ex Taq by the Bio-Rad Real-time PCR system (Bio-Rad, Hercules, CA, USA). The housekeeping gene for 18S ribosome DNA was used as a control. The 18 rDNA gene primers were as follows: algae sense 5′-ACGGCTACCACATCCAAG-3′ and antisense 5′-CCACCCGAAATCCAACTA-3′. The optimized qPCR program consisted of an initial denaturation step at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s, and 60 °C for 30 s. qPCR was repeated thrice per gene. Each replication was performed with an independently prepared RNA sample and consisted of three technical replicates . A relative quantitative method (ΔΔCt) was used to evaluate the quantitative variation [17].
Table 1

Sequences of specific primers used for real-time PCR

GeneEC no.SenseAntisense
Rubisco4.1.1.39CTCCACCCGCTCCGTCTAAGGACAAACTCGTGCGACATTCTT
Nitrate reductase1.7.1.1GGGATGGGCGACCTTGATGCCTCCCGAACCTTGAGAA
CA4.2.1.1TGTGAGCGGACAGCAACCAGGGACGAAGAGGAGAAGAGGG
Sequences of specific primers used for real-time PCR

Cultivation of microalgae under continuous aeration with different concentrations of CO2

All Chlorella PY-ZU1 cultivation experiments were performed in an artificial greenhouse at 27 °C. Initial biomass concentration was maintained at 0.2 g L−1. Microalgae were cultivated in the cylindrical photoreactors (BR) (160 × Ф56 mm; 300-mL working volume) with the optimized SE medium (SE* medium). SE* medium contained 1 g of NaNO3, 0.15 g of K2HPO4·3H2O, 0.15 g of MgSO4·7H2O, 0.025 g of CaCl2·2H2O, 0.025 g of NaCl, 40 mL of soil extract, 0.005 g of FeCl3·6H2O, 1 mL of Fe-EDTA, and 1 mL of A5 solution in 958 mL of deionized water [1]. Enriched CO2 gas [from 384 ppm to 60% (v/v)] was bubbled into the BR via a pipe at a rate of 30 mL min−1. Initial pH was adjusted to 6.5 by using 0.1 M HCl and 0.1 M NaOH. During incubation, light intensity of 6000 Lux was applied on the surface of the BR with four cool white lights and two plant lights (TLD 36 W; Philips) fixed above the BR. To obtain the dry biomass during cultivation, 10-mL samples were dewatered by centrifugation (Beckman Avanti J26-XP, USA) at 8500 rpm for 10 min and dried at 70 °C for 24 h. Biomass yield (g L−1) was calculated from the microalgae dry weight produced per liter. Chlorophyll was extracted by macerating microalgae in DMSO/80% acetone (1/2, V/V) and then measured [18]. NO3 − concentrations were analyzed by ion chromatography (MagIC, Metrohm, Switzerland). All experiments were performed in duplicate, and all data showed were reported as mean values and standard deviations (in figures) or standard errors (in tables) in this study.

Calculation of dissolved CO2 concentration

Dissolved inorganic carbon (DIC) and CO2 in the culture were calculated according to the CO2 dissolved process [17] as follows: During cultivation, the culture pH was 5.5–7.0, thus, The influent and effluent CO2 concentrations were monitored online by a CO2 analyzer (Servomex4100, UK). At a constant temperature of 27 °C, K H = 3.2 × 10−2 M atm−1 and K a1 = 4.3 × 10−7 M [19]. [H+] = 10−pH,

Reconstruction of inorganic carbon transport pathways

The microstructure of Chlorella PY-ZU1 was also measured by TEM in our previous study [20]. An apparent protein body (pyrenoid) was found inside the chloroplast in Chlorella PY-ZU1 from the image. The microstructure of Chlorella PY-ZU1 used in this work were compared with that of the green microalgae Chlorophyta, one species with the same genus of Chlorella PY-ZU1. In the Chlorophyta a pyrenoid is localized inside the chloroplast, starch often is accumulated around the pyrenoid and the presence of concentric thylakoid systems is visible around this starch sheath [21]. CCM goes on the pyrenoid model, and CA is in the pyrenoid that localized in chloroplast [22]. CCM goes on passive diffusion of CO2 through the plasmalemma and active bicarbonate transport into the chloroplast [8, 21]. Inorganic carbon transport pathways reconstructed based on de novo assembly and annotation of Chlorella PY-ZU1. The genes involved in these pathways in Chlorella PY-ZU1 were condensed and simplified according to their transcript abundances.

Results

Gene expression of carbonic anhydrase and rubisco under high CO2 stress

Chlorella PY-ZU1 had a higher biomass yield (2.85 g L−1) and shorter growth cycle (7 days) when cultivated in SE medium under continuous aeration with 15% (v/v) CO2 gas. This CO2 concentration is equivalent to that of flue gas from most coal-fired power plants. By contrast, the biomass concentration of Chlorella PY-ZU1 was only 1.30 g L−1 after 10 days of cultivation under air. It was previously reported that high CO2 induced algae growth [23]. Carbon fixation and nitrogen metabolism are the two most important aspects of primary cell metabolism. Therefore, we expected to observe significant differences in the expression of genes encoding enzymes of carbon fixation and nitrogen metabolism. When aerated into the microalgal suspension, CO2 first dissolves in the medium, and then transfers from the extracellular culture medium through the cell membrane to the intracellular chloroplast. Then, CO2 is converted by ribulose-1,5-bisphosphate (RuBP) upon the catalysis of RuBP carboxylase (rubisco) to 3-phosphoglycerate (PGA), the precursor of structural materials in microalgal cells [24]. Rubisco (rbcS, EC4.1.1.39), the first enzyme of the Calvin cycle, fixes CO2 into the three carbon atoms of RuBP (). The transcript abundance of RuBP increased slightly from 11,043.90 to 11,478.37 under high CO2 (15% CO2), whereas it was highly expressed under both high (15% CO2) and low (air) CO2 (Fig. 2). A 2-fold increase in transcript abundance was observed for PGK (EC2.7.2.3), which catalyzes the phosphorylation of 3-PGA to 1,3-bisphosphoglycerate. Moreover, triose phosphate isomerase (tpiA, EC5.3.1.1), which reversibly converts GAP into dihydroxyacetone phosphate (DHAP), increased by approximately 10.4-fold. The transcript abundance of a series of enzymes that converts GAP to sedoheptulose-7-phosphate (S7P), such as fructose-1,6-bisphosphatase aldolase (fbaB, EC4.1.2.13), increased more than 2-fold, whereas those of transketolase (tkt, EC2.2.1.1) and sedoheptulose-1,7-bisphosphatase (SBPase, EC3.1.3.37) improved slightly. Ribose-5-phosphate isomerase (rpiA, EC5.3.1.6), which converts R5P into ribulose-5-phosphate (Ru5P), increased by 7.8-fold. Phosphoribulokinase (prkB, EC2.7.1.19), which phosphorylates Ru5P into RuBP, increased by 4.0-fold. Therefore, almost all of the enzymes involved in the Calvin cycle had increased transcript abundances (Additional file 1) under high CO2. The results indicated that the whole carbon fixation process was driven by 15% CO2 gas. Therefore, the growth rate of Chlorella PY-ZU1 increased under 15% CO2 compared with under air (Fig. 1).
Fig. 2

Genes transcript abundance of reconstructed carbon fixation pathway in Chlorella PY-ZU1 cells cultivated with 15% CO2 gas versus air. Black dotted box indicated CO2 transfer process (CO2 concentrating mechanism), and red dotted box indicated Calvin cycle. Key enzymes of Calvin cycle are shown in boxes as enzyme commission (EC) numbers. Red box indicated an up-regulation, and black box indicated no significant changes

Fig. 1

Growth curves of Chlorella PY-ZU1 cultivated under continuous aeration with 15% CO2 gas versus air (CO2 = 384 ppm)

Growth curves of Chlorella PY-ZU1 cultivated under continuous aeration with 15% CO2 gas versus air (CO2 = 384 ppm) Moreover, rubisco was still highly expressed even Chlorella PY-ZU1 was cultivated under limited CO2, such as air. The high expression of rubisco was caused by CCM in microalgae cells. Rubisco is only activated when CO2 concentration is greater than its K m (CO2), because that CO2 is the only carbon source that rubisco can utilize. However, when aerated with air, 99% of carbon in the culture is in the form of HCO3 − [1]. CO2 concentration in the medium hardly meets the requirements of rubisco because of the low solubility of CO2. Gene transcript abundance of CAs in Chlorella PY-ZU1 pyrenoids increased to 5190 from 39 under cultivation with 15% CO2. CAs expression increased to maintain high CO2 concentration in pyrenoids. Furthermore, CCM was simultaneously activated as most of the dissolved inorganic carbon, HCO3 −, was transferred by pump through the chloroplast membrane into the internal pyrenoid; HCO3 was then converted by CAs to CO2 as function (2) in the chloroplast to meet the needs of rubisco (Fig. 2) [25]. However, CCM occurred at the cost of ATP. Increased CCM expression consumed more energy for CO2 transfer, thus decreasing the energy available for carbon fixation and other pathways of photosynthetic growth. Conversely, when cultivated under continuous aeration with 15% CO2, CAs was barely expressed in Chlorella PY-ZU1 pyrenoids. CCM was inactive. The CO2 that diffused directly into pyrenoids by high CO2 osmotic pressure was sufficient for rubisco. Therefore CO2 transfer pathway was simplified. Hence, more ATP was available for photosynthesis to promote growth. Genes transcript abundance of reconstructed carbon fixation pathway in Chlorella PY-ZU1 cells cultivated with 15% CO2 gas versus air. Black dotted box indicated CO2 transfer process (CO2 concentrating mechanism), and red dotted box indicated Calvin cycle. Key enzymes of Calvin cycle are shown in boxes as enzyme commission (EC) numbers. Red box indicated an up-regulation, and black box indicated no significant changes CAs and rubisco are the most important genes of carbon fixation pathways. To confirm the transcriptome results, the expression levels of genes encoding CA and rubisco were measured by qRT-PCR under different cultivation times (Fig. 3a). Under high CO2, the CAs transcript level was significantly reduced to 0 (The original data showed in Additional file 2), which is consistent with the transcriptome results (Fig. 2). Moreover, the study conducted by Fan et al. reported a similar, remarkably decreased CAs expression when oleaginous Chlorella cells were exposed to 5% CO2 [26]. This result is also consistent with previous reports that CO2 concentration significantly affects CAs activity in Chlorella pyrenoidosa cells, and that elevating CO2 concentration decreases CAs activity [27].
Fig. 3

qRT-PCR of carbonic anhydrase (a) and rubisco (b) in Chlorella PY-ZU1 cells that cultivated with 15% CO2 gas versus air

qRT-PCR of carbonic anhydrase (a) and rubisco (b) in Chlorella PY-ZU1 cells that cultivated with 15% CO2 gas versus air Rubisco expression levels increased under high CO2 (Fig. 3b). This result is consistent with the transcriptome results. Under 15% CO2, the enhanced rubisco expression of Chlorella PY-ZU1 cells might induce more CO2 to directly permeate intracellular pyrenoids for conversion into cellular energy storage molecules and to promote ATP conversion to glucose, thereby improving the photosynthetic efficiency of microalgae. Therefore, high CO2 concentrations reduced the ATP consumption of CO2 transfer. On the other hand, high CO2 concentrations improved CO2 conversion and photosynthetic efficiency, thus eventually reducing the growth cycle and increasing the biomass yield (2.85 g L−1) of Chlorella PY-ZU1. In addition, the time when rubisco had highest transcriptional level (24 h of high CO2 and 48 h of air) and the time CAs had lowest transcriptional level under air (48 h) were also the time when maximum microalgae growth rate was achieved (24 h of high CO2 and 48 h of air) (Fig. 1). That fully illustrated that CAs and rubisco had the ability to regulate microalgae growth.

Response of nitrogen metabolism and chlorophyll synthesis to high CO2 stress

Similar to carbon fixation, the transcript abundance of important enzymes in nitrogen metabolism, including those of nitrate reductase, nitrite reductase and glutamate dehydrogenase (ghdA), also increased under high CO2 (Fig. 4a). Nitrogen is an essential element for chlorophyll and protein synthesis. After nitrate reductase and nitrite reductase increased, nitrate ions absorbed by microalgae were immediately catalyzed to nitrite ions and then to ammonia through a series of reduction reactions to synthesize nitrogenous compounds, such as amino acids, which in turn increased the efficiency of nitrate ion uptake from the medium by microalgae cells. On the aspect of nitrogen source consumption (in this study, the nitrogen source was sodium nitrate), Chlorella PY-ZU1 consumed almost all of the 3 mM nitrate during the first 2 days, especially on the first day (Fig. 4b) when cultivated under continuous aeration with 15% CO2. By contrast, Chlorella PY-ZU1 only consumed 1.26 mM nitrate during the first 2 days, and nitrate was not completely consumed until the sixth day when cultivated under air. On the genetic level, the transcript abundance of nitrate reductase, the first enzyme in nitrogen metabolism, increased by approximately 10-fold by the 24th h and 8-fold by the 48th h under high CO2 compared with that under air (Fig. 4c). The higher transcript expression of nitrate reductase accelerated the transformation of nitrate to nitrite and O2 catalyzed by nitrate reductase (Function 3). This higher gene expression might manifest by the rapid consumption of nitrate. Furthermore, by the catalysis of the up-regulated nitrite reductase, more nitrite was converted to amino acid synthesis precursors, such as ammonia (Function 4), thereby accelerating the synthesis of proteinaceous materials, such as chlorophyll (Fig. 4d).
Fig. 4

Genes transcript abundance of nitrogen metabolism pathway in cells (a), nitrate consumption (b), qRT-PCR of nitrate reductase (c) and chlorophyll synthesis (d) of Chlorella PY-ZU1 cultivated under 15% CO2 versus air. Key enzymes of Calvin cycle were shown in boxes as enzyme commission (EC) numbers. Red box indicated an up-regulation, blue box indicated a down-regulation, and black box indicated no significant changes

Genes transcript abundance of nitrogen metabolism pathway in cells (a), nitrate consumption (b), qRT-PCR of nitrate reductase (c) and chlorophyll synthesis (d) of Chlorella PY-ZU1 cultivated under 15% CO2 versus air. Key enzymes of Calvin cycle were shown in boxes as enzyme commission (EC) numbers. Red box indicated an up-regulation, blue box indicated a down-regulation, and black box indicated no significant changes Under 15% (v/v) CO2, 23.65 mg L−1 of chlorophyll was produced during the first day of cultivation. Chlorophyll concentration remained stable in the range of 23–26 mg L−1. All of the 3 mM nitrate in the medium was consumed during the following 3 days (Fig. 4d). Chlorophyll was vital in photosynthesis and allowed Chlorella PY-ZU1 cells to absorb energy from light. Moreover, light conversion efficiency is linearly correlated with chlorophyll content [1, 28]. Increased chlorophyll provided more energy for photosynthetic reactions, thereby improving the photosynthetic growth rate of Chlorella PY-ZU1. However, the high nitrogen consumption during the first 3 days resulted in nitrogen deficiency in the following days under 15% CO2. Microalgae consumed its chlorophyll to maintain cell growth under nitrogen deficiency from the 4th day, and the chlorophyll content of Chlorella PY-ZU1 decreased. By contrast, chlorophyll content of Chlorella PY-ZU1 still increased when cultivated under air. Given that chlorophyll synthesis is almost directly proportional to nitrate concentration in the culture medium, the chlorophyll contents of Chlorella PY-ZU1 were almost the same under different CO2 conditions by the end of the cultivation period [1, 29]. However, during cultivation, the chlorophyll content of Chlorella PY-ZU1 cultivated under 15% CO2 was always higher than that of under air, which resulted in higher microalgae growth rate (Fig. 1).

Analysis of different concentrations of CO2 transport and fixation mechanisms

Figure 5 shows the biomass productivity of Chlorella PY-ZU1 cultivated in optimized SE medium under different CO2 concentrations. Excessively low (<1%) and high (>30%) CO2 concentration could restrain microalgae growth and resulted in lower biomass yield (<2 g L−1). However, when cultivated under 1% CO2, the biomass yield drastically increased by 130.2% to 3.73 g L−1 compared with the 1.62 g L−1 obtained by cultivation under 0.5% CO2. The drastically increased biomass yield in response to higher CO2 concentrations indicated some changes in the pathway of CO2 transfer and utilization by microalgae. CCM will work when microalgae is cultivated under limited CO2 conditions, such as air. However, it will not work if the CO2 that directly diffused to pyrenoids by extra- and intracellular CO2 osmotic pressure is sufficient for rubisco, more energy was concentrated for cell growth. Thus, biomass productivity was dramatically enhanced [11]. An external concentration of 0.5% CO2 was too low for Chlorella PY-ZU1 because it could not supply enough CO2 through osmosis to rubisco. However, 1% external CO2 could overcome diffusion resistance to enable CO2 flux from the external medium to the cytoplasm. Moreover, enough CO2 diffusion by high CO2 stress to the cytoplasm resulted in non-operational CCM. Therefore, >1% external CO2 concentration maintained enough CO2 in pyrenoids for rubisco only through direct diffusion, which is dependent on extra- and intra-cellular CO2 osmotic pressure. When cultivated under 3–30% CO2, Chlorella PY-ZU1 had stable, higher biomass yields of 4.60–4.78 g L−1. Therefore, 3–15% was ideal CO2 concentration for Chlorella PY-ZU1 growth. However, when CO2 concentration exceeded 30%, excess CO2 inhibited microalgal growth and sharply decreased biomass yield (1.89 g L−1). Therefore, >30% external CO2 is too high for Chlorella PY-ZU1 given the overly acidic culture after aeration with higher CO2 concentrations [26, 27].
Fig. 5

Biomass yield of Chlorella PY-ZU1 cultivated with optimized SE medium under various concentrations of CO2

Biomass yield of Chlorella PY-ZU1 cultivated with optimized SE medium under various concentrations of CO2

Discussion

The CCM process has a specific CAs to catalyze the conversion of HCO3 to CO2 at the expense of ATP [26]. For optimal efficiency, the carboxysomal CAs activity needs to match, as closely as possible, the maximal rate of CO2 fixation [4, 30] under limited CO2 conditions. The dissolved CO2 concentration increased from 6.14 μM to 4.60 mM as the aerated CO2 concentration increased from 384 ppm (air) to 15% (Table 2). K m (CO2) of rubisco is the critical point in the activation of rubisco [15] and allows cells to initiate the CCM process [31]. Therefore, microalgal growth rate and biomass yield will increase significantly when the dissolved CO2 concentration in the culture is higher than K m (CO2) of rubisco. The biomass yield of Chlorella PY-ZU1 cultivated under 1% CO2 increased sharply by 130.2% to 3.73 g L−1 compared with 1.62 g L−1 obtained from cultivation with 0.5% CO2. It is known that CCM is energy consumption process and K m is the critical point in the activation of rubisco. On one hand, if the intracellular CO2 concentration around rubisco is higher than K m, CCM would not work. More energy would be saved for microalgae growth. This is to say we can estimate whether CCM works from the microalgae growth condition. On the other hand, the mixed CO2 gas aerated into microalgae suspension as carbon source. The intracellular CO2 should be balanced with the dissolved CO2 in suspension without CCM after equilibrium of CO2 gas dissolving. The microalgae growth rate has a significant increase when the dissolved CO2 concentration in culture increased from 80 to 192 μM. It could be deduced CCM did not work under 192 μM of dissolved CO2 concentration but might still work under 80 μM. Therefore, the K m (CO2) value of rubisco in Chlorella PY-ZU1 might be in the range of 80–192 μM, which corresponds to 1% aerated CO2 concentration. These values are consistent with those of previous reports.
Table 2

pH and dissolved CO2 concentration of Chlorella PY-ZU1 culture aerated with various concentrations of CO2 gas

Aerated CO2 conc. %0.03840.5136153060
pH10.73 ± 0.159.86 ± 0.418.75 ± 0.107.88 ± 0.077.35 ± 0.056.96 ± 0.176.04 ± 0.585.63 ± 0.38
Dissolved CO2 conc. (μM)6.14 ± 0.0480 ± 2.0192 ± 1.8800 ± 201600 ± 324600 ± 209400 ± 3719,100 ± 56
pH and dissolved CO2 concentration of Chlorella PY-ZU1 culture aerated with various concentrations of CO2 gas Furthermore, we utilized de novo assembly and annotation to reconstruct the possible pathways in Chlorella PY-ZU1 cells for inorganic carbon transport to pyrenoids from the external medium in response to different aerated CO2 concentrations based on the pyrenoid model [22]. When cultivated under limited CO2, such as under air, the dissolved CO2 concentration of 6.14 μM in the culture could not meet the CO2 demands of rubisco. Therefore, Chlorella PY-ZU1 initiated CCM to localize CO2 in pyrenoids. However, >1% CO2 concentration supplied enough dissolved CO2 (>192 μM). Thus, the cell did not initiate CCM. The free CO2 molecules permeating to the pyrenoids were sufficient for direct use by rubisco. Increased CO2 accumulation increased the cell’s photosynthetic efficiency, resulting in a higher biomass yield of 3.73 g L−1. In addition, with the further increasing of CO2 concentration to 30%, the dissolved CO2 concentration increased to 9.4 mM. Although, the dissolved CO2 also could meet the demands of rubisco. Excessive CO2 could acidify the microalgae culture, resulting in cell “anesthesia” [32] and decreasing enzymatic activity [33, 34], which eventually drastically decreases Chlorella PY-ZU1 biomass yield. Therefore, <1% CO2 was too limited for Chlorella PY-ZU1. As a result, CCM was initiated to concentrate CO2. Therefore, 1–30% CO2 concentration is very suitable for Chlorella PY-ZU1 growth, whereas >30% CO2 is excessive for microalgae growth (Fig. 6).
Fig. 6

Reconstructed CO2 transport schematic pathway of Chlorella PY-ZU1 under various concentrations of CO2

Reconstructed CO2 transport schematic pathway of Chlorella PY-ZU1 under various concentrations of CO2

Conclusions

The biomass yield of Chlorella PY-ZU1 cultivated under 0.5% CO2 was only 1.62 g L−1. However, when cultivated under 1% CO2, the biomass yield drastically increased by 130.2% to 3.73 g L−1. The drastically increased biomass yield in response to higher CO2 concentration indicated some changes happened in CO2 transfer and utilization by microalgae. CAs in Chlorella PY-ZU1 cells cultivated under 15% CO2 barely expressed. That indicated CO2 could directly permeate into intra-cell for rubisco to fix without CCM working at the expense of ATP. While CCM in cells that cultivated under <1% CO2 conditions would work for CO2 transport. Carbon fixation and nitrogen metabolisms are the two most important aspects of primary cell metabolisms. Besides the improved expression of enzymes in carbon fixation pathways, the enzymes in nitrogen metabolism pathways, including nitrate reductase, nitrite reductase and glutamate dehydrogenase, also had an increased expression level under 15% CO2 condition. Further studies should be taken to determine CO2 distribution and verify the exact K m (CO2) of rubisco in microalgae cells. Additional file 1. Genes differental expression of Chlorella PY-ZU1 under 15% CO2 compared with that under air. Additional file 2. Original data of qRT-PCR.
  21 in total

1.  MORE EFFICIENT PLANTS: A Consequence of Rising Atmospheric CO2?

Authors:  Bert G. Drake; Miquel A. Gonzalez-Meler; Steve P. Long
Journal:  Annu Rev Plant Physiol Plant Mol Biol       Date:  1997-06

Review 2.  Perspectives on microalgal CO₂-emission mitigation systems--a review.

Authors:  Shih-Hsin Ho; Chun-Yen Chen; Duu-Jong Lee; Jo-Shu Chang
Journal:  Biotechnol Adv       Date:  2010-11-19       Impact factor: 14.227

3.  Acclimation of photosynthesis to increasing atmospheric CO2: The gas exchange perspective.

Authors:  R F Sage
Journal:  Photosynth Res       Date:  1994-03       Impact factor: 3.573

4.  Evidence for the occurrence of photorespiration in synurophyte algae.

Authors:  Shabana Bhatti; Brian Colman
Journal:  Photosynth Res       Date:  2011-03-26       Impact factor: 3.573

5.  Model of the carbon concentrating mechanism in chloroplasts of eukaryotic algae.

Authors:  S Thoms; M Pahlow; D A Wolf-Gladrow
Journal:  J Theor Biol       Date:  2001-02       Impact factor: 2.691

Review 6.  Inorganic carbon transporters of the cyanobacterial CO2 concentrating mechanism.

Authors:  G Dean Price
Journal:  Photosynth Res       Date:  2011-02-26       Impact factor: 3.573

7.  Optimization of culture conditions and comparison of biomass productivity of three green algae.

Authors:  Wonduck Kim; Jang Min Park; Geun Ho Gim; Sang-Hwa Jeong; Chang Min Kang; Duk-Jin Kim; Si Wouk Kim
Journal:  Bioprocess Biosyst Eng       Date:  2011-09-10       Impact factor: 3.210

Review 8.  Algal evolution in relation to atmospheric CO2: carboxylases, carbon-concentrating mechanisms and carbon oxidation cycles.

Authors:  John A Raven; Mario Giordano; John Beardall; Stephen C Maberly
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2012-02-19       Impact factor: 6.237

9.  Characterization and expression of genes from the RubisCO gene cluster of the chemoautotrophic symbiont of Solemya velum: cbbLSQO.

Authors:  Julie Schwedock; Tara L Harmer; Kathleen M Scott; Harm J Hektor; Angelica P Seitz; Matthew C Fontana; Daniel L Distel; Colleen M Cavanaugh
Journal:  Arch Microbiol       Date:  2004-07-28       Impact factor: 2.552

10.  Mutate Chlorella sp. by nuclear irradiation to fix high concentrations of CO2.

Authors:  Jun Cheng; Yun Huang; Jia Feng; Jing Sun; Junhu Zhou; Kefa Cen
Journal:  Bioresour Technol       Date:  2013-03-18       Impact factor: 9.642

View more
  2 in total

1.  Characterization and optimization of endogenous lipid accumulation in Chlorella vulgaris SDEC-3M ability to rapidly accumulate lipid for reversing nightly lipid loss.

Authors:  Feng Qi; Haiyan Pei; Ruimin Mu; Guixia Ma; Daoji Wu; Qiang Han
Journal:  Biotechnol Biofuels       Date:  2019-06-18       Impact factor: 6.040

2.  Transcriptional analyses reveal the molecular mechanism governing shade tolerance in the invasive plant Solidago canadensis.

Authors:  Miao Wu; Zeyu Li; Jianbo Wang
Journal:  Ecol Evol       Date:  2020-03-24       Impact factor: 2.912

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.