| Literature DB >> 28693157 |
Jiang Wu1, Yu Song2, Fei Chen1, Hui Xiao1.
Abstract
We explored the association between the HLA-II gene polymorphisms and the occurrence of leukemia. For this study, we selected 53 patients with leukemia treated at Zhongnan Hospital of Wuhan University from February 2014 to September 2015 and 46 healthy patients as the control group. We used polymerase chain reaction with sequence specific primers for DNA typing which was carried out to analyze the patients HLA-A/B gene polymorphism. We also used enzyme-linked immunosorbent assay and western blotting method to measure the protein expression of different genotypes and activity. Compared to the control group, HLA-A04, B08 gene frequencies were significantly lower than those of HLA-A04, B08 gene frequencies of the observation group; results were statistically significant (χ2=16.28, P<0.05; χ2=16.47, P<0.05). However, in the control group, the frequency of HLA-A09 gene was significantly higher than that of the observation group; there was a significant difference between the two groups (χ2=15.28, P<0.05). Through the measurement of the protein expression levels of the different genotypes in the control group and the observation group, it was found that in the observation group, HLA-A04, B08 protein contents (4.6 and 3.2 µg/l) were significantly higher than those of the control group (0.13 and 0.1 µg/l). While the control group HLA-A09 genotype protein content (3.7 µg/l) was significantly higher than that of the observation group (0.2 µg/l); there were significant differences between both (P<0.05). Therefore, there is a significant correlation between HLA-II gene polymorphism and leukemia that is higher than HLA-A04 and B08 gene frequency and can help promote the occurrence of leukemia. The higher frequency of HLA-A09 gene can help to suppress the occurrence of leukemia.Entities:
Keywords: HLA-A/B; HLA-II; blood disease; gene polymorphism; genotype frequency
Year: 2017 PMID: 28693157 PMCID: PMC5494818 DOI: 10.3892/ol.2017.6136
Source DB: PubMed Journal: Oncol Lett ISSN: 1792-1074 Impact factor: 2.967
Primer sequences.
| Primer | Sequences |
|---|---|
| HLA-A-F | GTGATCGTAGTGCTAGCTAGC |
| HLA-A-R | CGTCGTAGCTGATCGTAGCTAG |
| HLA-B-F | CTGCTAGTCGATCGGCATATACG |
| HLA-B-R | CTGATCGTAGCTAGCCTAGATCG |
F, forward; R, reverse.
HLA-A allele and gene frequency statistics of the observation group and the control group.
| Observation group (53) | Control group (46) | ||||
|---|---|---|---|---|---|
| HLA-A | No. | Frequency (%) | No. | Frequency (%) | χ2 |
| A01 | 2 | 3.8 | 1 | 2.2 | 6.04 |
| A02 | 2 | 3.8 | 3 | 6.5 | 0.12 |
| A03 | 3 | 5.7 | 1 | 2.2 | 0.18 |
| A04 | 26 | 49 | 3 | 6.5 | 0.24 |
| A05 | 3 | 5.7 | 4 | 8.7 | 0.64 |
| A06 | 3 | 5.7 | 1 | 2.2 | 0.116 |
| A07 | 1 | 1.8 | 1 | 2.2 | 0.19 |
| A08 | 3 | 5.7 | 2 | 4.3 | 0.13 |
| A09 | 2 | 3.8 | 26 | 57 | 4.07 |
| A10 | 2 | 3.8 | 1 | 2.2 | 0.26 |
| A11 | 3 | 5.7 | 1 | 2.2 | 0.32 |
| A12 | 3 | 5.7 | 2 | 4.3 | 0.48 |
P<0.05 indicates significant difference.
HLA-B allele and gene frequency statistics of the observation group and the control group.
| Observation group (53) | Control group (46) | ||||
|---|---|---|---|---|---|
| HLA-B | No. | Frequency (%) | No. | Frequency (%) | χ2 |
| B01 | 1 | 1.9 | 2 | 4.3 | 0.14 |
| B02 | 2 | 3.8 | 2 | 4.3 | 0.116 |
| B03 | 6 | 11.3 | 3 | 6.5 | 0.32 |
| B04 | 3 | 5.7 | 2 | 4.3 | 0.21 |
| B05 | 8 | 15.1 | 4 | 8.7 | 0.204 |
| B06 | 6 | 11.3 | 5 | 10.9 | 0.165 |
| B07 | 2 | 3.8 | 4 | 8.7 | 0.186 |
| B08 | 7 | 13.2 | 13 | 28.3 | 6.05 |
| B09 | 5 | 9.4 | 3 | 6.5 | 0.214 |
| B10 | 3 | 5.7 | 2 | 4.3 | 0.24 |
| B11 | 4 | 7.5 | 3 | 6.5 | 0.253 |
| B12 | 2 | 3.8 | 1 | 2.2 | 0.32 |
| B13 | 2 | 3.8 | 1 | 2.2 | 0.36 |
| B14 | 2 | 3.8 | 1 | 2.2 | 0.42 |
P<0.05 indicates significant difference.
Figure 1.ELISA to detect the expression of HLA-II protein in different genotypes. Asterisk shows significant difference.
Figure 2.Western blotting to detect the expression of HLA-II protein in different genotypes (A/B). (A) Western blot lanes for two groups; (B) semiquantitative analysis for western blot results. Asterisk shows significant difference.