Literature DB >> 28691902

Essential roles of Caspase-3 in facilitating Myc-induced genetic instability and carcinogenesis.

Ian M Cartwright1, Xinjian Liu1, Min Zhou1, Fang Li1, Chuan-Yuan Li1,2.   

Abstract

The mechanism for Myc-induced genetic instability is not well understood. Here we show that sublethal activation of Caspase-3 plays an essential, facilitative role in Myc-induced genomic instability and oncogenic transformation. Overexpression of Myc resulted in increased numbers of chromosome aberrations and γH2AX foci in non-transformed MCF10A human mammary epithelial cells. However, such increases were almost completely eliminated in isogenic cells with CASP3 gene ablation. Furthermore, we show that endonuclease G, an apoptotic nuclease downstream of Caspase-3, is directly responsible for Myc-induced genetic instability. Genetic ablation of either CASP3 or ENDOG prevented Myc-induced oncogenic transformation of MCF10A cells. Taken together, we believe that Caspase-3 plays a critical, unexpected role in mediating Myc-induced genetic instability and transformation in mammalian cells.

Entities:  

Keywords:  Caspase-3 activation; Myc-induced genetic instbility; cancer biology; endoG; human; transformation

Mesh:

Substances:

Year:  2017        PMID: 28691902      PMCID: PMC5550274          DOI: 10.7554/eLife.26371

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

One of the hallmarks of cancer is increased genomic instability (Hanahan and Weinberg, 2011). In addition to DNA replication errors and /or mutations induced by exposure to DNA damaging agents, over-expression of oncogenes have been shown to induce genomic instability (Bartkova et al., 2005; Gorgoulis et al., 2005). One such oncogene is Myc. As one of the most widely studied oncogenes in cancer biology, it is mutated or over-expressed in multiple types of cancer (Pelengaris et al., 2002). Myc is involved in driving cellular proliferation and promoting stem cell self-renewal under normal circumstances. When myc is overexpressed in a cell, it can cause increased genomic instability and promote carcinogenesis (Karlsson et al., 2003; Ray et al., 2006). Despite numerous studies, the mechanisms involved in myc-induced genomic instability and transformation remain controversial. There are conflicting reports on the mechanism of myc-induced genomic instability and transformation. Several studies suggest that myc-induced genomic instability and carcinogenesis is a result of an overabundance of reactive oxygen species (ROS) (Vafa et al., 2002; Felsher and Bishop, 1999). However, it has also been reported that myc overexpression can cause DNA damage and transformation in the absence of ROS (Ray et al., 2006). Over-expression of myc has been shown to induce apoptosis (Evan et al., 1992; Harrington et al., 1994). Until recently, apoptosis has been widely recognized as an anti-carcinogenic process based on the assumption that it is utilized by the host to eliminate damaged cells, including those suffering DNA damage (Hanahan and Weinberg, 2011; Reed, 1999). However, there has been increasing evidence that apoptosis may in fact been involved in promoting carcinogenesis (Tang et al., 2012; Ichim et al., 2015; Liu et al., 2015). Mammalian cells exposed to external stress can survive activation of the apoptotic cascade and incur increased genetic instability and oncogenic transformation. Studies show that mammalian cells that survive apoptosis experience increased mitochondria membrane permeability (MOMP)(Ichim et al., 2015) and sublethal caspase 3 activation (Liu et al., 2015), which lead to activation of downstream endonucleases such as CAD and endoG, which in turn cause increased genetic instability and oncogenic transformation. In the current study, we carried out experiments to examine the potential roles of the cellular apoptotic machinery in Myc-induced mutagenesis and carcinogenesis. We show sublethal activation of caspase 3 and endonuclease G plays an essential role in Myc-induced genetic instability and oncogenic transformation in human cells.

Results and discussion

Previously, we and others have shown that mammalian cells exposed to external stress such radiation and chemicals could survive the activation of apoptotic caspases. Among the cells that survive caspase activation, elevated DNA damage, such as DNA double strand breaks were observed. In this study, we set out to examine the hypothesis that sublethal activation of apoptotic caspases are involved in Myc-induced genetic instability. Our hypothesis is based on the well-established evidence that Myc over-expression in mammalian cells promotes caspase activation and cell death (Karlsson et al., 2003; Ray et al., 2006). To investigate the effects of Myc expression we used a recombinant lentivirus to transduce the c-Myc gene under the control of a constitutively active CMV promoter into MCF10A cells, an immortalized but not transformed human mammary epithelial cell line (Soule et al., 1990; Tait et al., 1990). We reasoned that if some of the Myc-expressing cells can survive caspase activation, they may possess higher levels genomic instability, similar to those cells that were exposed to ionizing radiation (Liu et al., 2015). We quantified Myc’s ability to activate Casp3 by immunofluorescence staining of cleaved Casp3 (Figure 1A,B). Roughly 6% of Myc-expressing MCF10A cells were observed with having relatively normal nuclei and cleaved caspase 3, as compared to control MCF10A cells where only ~1% of the cells were observed with cleaved caspase 3. We also examined the relationship between Casp3 activation and cellular survival by use of a reporter system described in a prior publication (Liu et al., 2015). Our data indicate that irrespective of Casp3 activation status in the presence or absence of Myc expression, 40% or more of the individually sorted MCF10A cells can form colonies in 96-well plates (Figure 1—figure supplement 1). Further flow cytometry analysis showed that despite increased Casp3EGFP activities in Myc-expressing MCF10A cells, the levels of Annexin V staining, a well-recognized marker of apoptosis, did not increase significantly (Figure 1—figure supplement 2). Those data provide clear evidence that a significant fraction of MCF10A cells can survive spontaneous or Myc-induced Casp3 activation.
Figure 1.

Requirement for Casp3 in Myc-induced genomic instability.

(A) Representative immunofluorescence staining of MCF10A cells with cleaved caspase 3 (green) and DAPI (blue). Scale bar represents 10 μm. (B) The proportion of nonapoptotic MCF10A cells presenting with normal nuclear morphology and cleaved caspase 3 signal. (C) Western blot analysis of Caspase-3 status in MCF10A cells with or without CASP3 gene knockout. (D) Representative immunofluorescence γH2AX foci (green) and DAPI staining in MCF10A cells with wild type (left panel) and CASP3KO. Scale bar represents 20 μm. (E) Fraction of cells which stained positive for a γH2AX foci in control and Casp3-deficient MCF10A with or without exogenous expression of Myc, n = 3. (F) A representative image of chromosome staining in MCF10A cells. A dicentric chromosome is indicated by an arrow. (G) Fraction of cells containing at least one chromosome aberration in control and Casp3-deficient MCF10A with or without exogenous expression of Myc. In B, E, and G, error bars represent standard error of the mean (SEM), * indicates a p value < 0.01, ** indicates a p value > 0.1, Student’s t-test, n = 3. For B, E, each data point was derived from the average of three triplicate groups of 150 cells each. In G, each data point was derived from the average of three triplicate groups of 50 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.003

DOI: http://dx.doi.org/10.7554/eLife.26371.004

DOI: http://dx.doi.org/10.7554/eLife.26371.005

DOI: http://dx.doi.org/10.7554/eLife.26371.006

DOI: http://dx.doi.org/10.7554/eLife.26371.007

DOI: http://dx.doi.org/10.7554/eLife.26371.008

DOI: http://dx.doi.org/10.7554/eLife.26371.009

DOI: http://dx.doi.org/10.7554/eLife.26371.010

DOI: http://dx.doi.org/10.7554/eLife.26371.011

DOI: http://dx.doi.org/10.7554/eLife.26371.012

DOI: http://dx.doi.org/10.7554/eLife.26371.013

DOI: http://dx.doi.org/10.7554/eLife.26371.014

There was not a significant increase in annexin V-high cells in Casp3-GFP high cells.

DOI: http://dx.doi.org/10.7554/eLife.26371.015

(A) Average number of γH2AX foci per cell in Myc-transduced MCF10A cells with or without CASP3 gene ablation. (B) Average number of chromosomal aberrations per cell in Myc-transduced MCF10A cells with or without CAPS3 gene ablation. Error bars represent standard error of the mean (SEM). *p>0.05; **p<0.05; Students t-test, n = 3. In A, each data point was derived from the average of three triplicate groups of 150 cells each. In B, each data point was derived from the average of three triplicate groups of 50 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.016

Notice the heterogeneous nature of Myc expression.

DOI: http://dx.doi.org/10.7554/eLife.26371.017

Cells were synchronized and irradiated with 3Gys of X-rays. At different time points after radiation exposure, they were fixed and stained with fluorescence-labeled γH2AX antibody. The fraction of cells with γH2AX foci were then enumerated from fluorescence images. MCF10A Myc vs Casp3KO Myc, **p<0.001, n = 5, Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.26371.018

(A) Western blot confirmation of Myc over-expression and re-expression Casp3 in Casp3KO cells. (B) The effect of Casp3 re-expression on Myc-induced γH2AX foci in MCF10A-CASP3KO cells. (C) The effect of dominant-negative Casp3 (C163A mutation) on Myc-induced γH2AX foci in MCF10A-CASP3KO cells. Error bars represent standard error of the mean (SEM). *p>0.05; **p<0.05. In B and C, each data point was derived from the average of three triplicate groups of 150 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.019

(A) Western blot showing CASP3 gene knockout in immortalized human BJ1 fibroblasts. (B) Quantitative estimate of Myc induced γH2AX foci in control and CASP3 knockout BJ1 fibroblasts. (C) Quantitative estimate of Myc-induced chromosomal aberrations in control and CAPS3 knockout BJ1 human fibroblast cells. In B, C, error bars represent SEM. *p>0.05, **p<0.001, Student’s t-test, n = 3. In B, each data point was derived from the average of three triplicate groups of 150 cells each. In C, each data point was derived from the average of three triplicate groups of 50 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.020

Figure 1—figure supplement 1.

Clonogenic abilities of control and Myc-expressing MCF10A cells with high and low Casp3 reporter (Casp3GFP) activities after being individually sorted into 96-well plates by use of FAC based on their reporter activities.

DOI: http://dx.doi.org/10.7554/eLife.26371.014

Figure 1—figure supplement 2.

Flow cytometry analysis of annexin v-PE staining in Casp3-GFP transduced MCF10A cells with or without Myc expression.

There was not a significant increase in annexin V-high cells in Casp3-GFP high cells.

DOI: http://dx.doi.org/10.7554/eLife.26371.015

Requirement for Casp3 in Myc-induced genomic instability.

(A) Representative immunofluorescence staining of MCF10A cells with cleaved caspase 3 (green) and DAPI (blue). Scale bar represents 10 μm. (B) The proportion of nonapoptotic MCF10A cells presenting with normal nuclear morphology and cleaved caspase 3 signal. (C) Western blot analysis of Caspase-3 status in MCF10A cells with or without CASP3 gene knockout. (D) Representative immunofluorescence γH2AX foci (green) and DAPI staining in MCF10A cells with wild type (left panel) and CASP3KO. Scale bar represents 20 μm. (E) Fraction of cells which stained positive for a γH2AX foci in control and Casp3-deficient MCF10A with or without exogenous expression of Myc, n = 3. (F) A representative image of chromosome staining in MCF10A cells. A dicentric chromosome is indicated by an arrow. (G) Fraction of cells containing at least one chromosome aberration in control and Casp3-deficient MCF10A with or without exogenous expression of Myc. In B, E, and G, error bars represent standard error of the mean (SEM), * indicates a p value < 0.01, ** indicates a p value > 0.1, Student’s t-test, n = 3. For B, E, each data point was derived from the average of three triplicate groups of 150 cells each. In G, each data point was derived from the average of three triplicate groups of 50 cells each. DOI: http://dx.doi.org/10.7554/eLife.26371.003

Data for Figure 1B.

DOI: http://dx.doi.org/10.7554/eLife.26371.004

Data for Figure 1E.

DOI: http://dx.doi.org/10.7554/eLife.26371.005

Data for Figure 1G.

DOI: http://dx.doi.org/10.7554/eLife.26371.006

Data for Figure 1—figure supplement 3A.

DOI: http://dx.doi.org/10.7554/eLife.26371.007

Data for Figure 1—figure supplement 3B.

DOI: http://dx.doi.org/10.7554/eLife.26371.008

Data for Figure 1—figure supplement 5.

DOI: http://dx.doi.org/10.7554/eLife.26371.009

Data for Figure 1—figure supplement 6B.

DOI: http://dx.doi.org/10.7554/eLife.26371.010

Data for Figure 1—figure supplement 6C.

DOI: http://dx.doi.org/10.7554/eLife.26371.011

Data for Figure 1—figure supplement 7B.

DOI: http://dx.doi.org/10.7554/eLife.26371.012

Data for Figure 1—figure supplement 7C.

DOI: http://dx.doi.org/10.7554/eLife.26371.013

Clonogenic abilities of control and Myc-expressing MCF10A cells with high and low Casp3 reporter (Casp3GFP) activities after being individually sorted into 96-well plates by use of FAC based on their reporter activities.

DOI: http://dx.doi.org/10.7554/eLife.26371.014

Flow cytometry analysis of annexin v-PE staining in Casp3-GFP transduced MCF10A cells with or without Myc expression.

There was not a significant increase in annexin V-high cells in Casp3-GFP high cells. DOI: http://dx.doi.org/10.7554/eLife.26371.015

Additional data for the influence of Casp3 on Myc-induced genetic instability in MCF10A cells.

(A) Average number of γH2AX foci per cell in Myc-transduced MCF10A cells with or without CASP3 gene ablation. (B) Average number of chromosomal aberrations per cell in Myc-transduced MCF10A cells with or without CAPS3 gene ablation. Error bars represent standard error of the mean (SEM). *p>0.05; **p<0.05; Students t-test, n = 3. In A, each data point was derived from the average of three triplicate groups of 150 cells each. In B, each data point was derived from the average of three triplicate groups of 50 cells each. DOI: http://dx.doi.org/10.7554/eLife.26371.016

Immunofluorescence co-staining of vector control and Myc-transduced MCF10A cells.

Notice the heterogeneous nature of Myc expression. DOI: http://dx.doi.org/10.7554/eLife.26371.017

DNA double-strand repair kinetics in MCF10A cells with various genetic backgrounds.

Cells were synchronized and irradiated with 3Gys of X-rays. At different time points after radiation exposure, they were fixed and stained with fluorescence-labeled γH2AX antibody. The fraction of cells with γH2AX foci were then enumerated from fluorescence images. MCF10A Myc vs Casp3KO Myc, **p<0.001, n = 5, Student’s t-test. DOI: http://dx.doi.org/10.7554/eLife.26371.018

Additional data confirming the role of Casp3 in mediating Myc-induced genomic instability.

(A) Western blot confirmation of Myc over-expression and re-expression Casp3 in Casp3KO cells. (B) The effect of Casp3 re-expression on Myc-induced γH2AX foci in MCF10A-CASP3KO cells. (C) The effect of dominant-negative Casp3 (C163A mutation) on Myc-induced γH2AX foci in MCF10A-CASP3KO cells. Error bars represent standard error of the mean (SEM). *p>0.05; **p<0.05. In B and C, each data point was derived from the average of three triplicate groups of 150 cells each. DOI: http://dx.doi.org/10.7554/eLife.26371.019

Role of Casp3 in Myc-induced genetic instability in BJ-1 human fibroblasts.

(A) Western blot showing CASP3 gene knockout in immortalized human BJ1 fibroblasts. (B) Quantitative estimate of Myc induced γH2AX foci in control and CASP3 knockout BJ1 fibroblasts. (C) Quantitative estimate of Myc-induced chromosomal aberrations in control and CAPS3 knockout BJ1 human fibroblast cells. In B, C, error bars represent SEM. *p>0.05, **p<0.001, Student’s t-test, n = 3. In B, each data point was derived from the average of three triplicate groups of 150 cells each. In C, each data point was derived from the average of three triplicate groups of 50 cells each. DOI: http://dx.doi.org/10.7554/eLife.26371.020 To examine if Casp3 plays a causative role in Myc-induced genomic instability and carcinogenesis, we generated MCF10A and BJ-1hTERT cells with CASP3 gene knockout by use of the CRISPR/Cas9 technology (Figure 1C, Tables 1–3). Control and Casp3-deficient MCF10A cells with and without exogenous Myc expression were then analyzed for both chromosome aberrations and γH2AX foci, two well-established markers of genomic instability. In control MCF10A cells, Myc overexpression caused significant increases in both the fraction of cells with and the average numbers per cell of γH2AX foci and chromosomal aberrations (Figure 1D–G, Figure 1—figure supplement 3). In contrast, Myc overexpression in Casp3-deficient cells induced no increases in the numbers of either chromosome aberrations or γH2AX foci when compared to control MCF10A or CASP3 knockout (CASP3KO) cells without Myc overexpression (Figure 1D–G, Figure 1—figure supplement 3). To examine the relationship between c-Myc expression and γH2AX foci induction, we carried out immunofluorescence staining of c-Myc and γH2AX (Figure 1—figure supplement 4). Our results indicate that c-Myc expression was not homogeneous, perhaps a reflection of the silencing of the CMV promoter that controlled c-Myc expression. Furthermore, γH2AX foci presence did not always correlate with high c-Myc expression, perhaps indicating a stochastic nature of γH2AX foci induction. However, Myc expression did have a strong influence on both the baseline and induced levels of γH2AX foci and their repair kinetics in MCF10A cells. A systematic analysis on the repair of radiation-induced γH2AX foci showed that Myc expression caused not only higher background levels of γH2AX foci but also higher residual foci levels after a significant number of the induced foci were repaired. On the other hand, CASP3 knockout eliminated most of the basal and residual levels of γH2AX foci in MCF10A cells (Figure 1—figure supplement 5).
Table 1.

Primary antibodies used in this study.

DOI: http://dx.doi.org/10.7554/eLife.26371.021

Target proteinAntibody sourceClone information
γH2AX (Ser139)Upstate BiotechnologyJBW301, Mouse mAb
Caspase-3 (full length)Cell Signaling Technology8G10, Rabbit mAb
Caspase-3 (cleaved,Asp175)Cell Signaling Technology5A1E, Rabbit mAb
EndoGChemiconRabbit polyclonal
HA epitopeNovus BiologicalsGoat polyclonal
β-ActinNovus BiologicalsMouse mAb
c-MycCell Signaling TechnologyRabbit mAb
Mito MarkerThermo Fisher ScientificN/A
Table 3.

Mutations at target sequences in various CRISPR knockout MCF10A and BJ-1 hTERT cells.

DOI: http://dx.doi.org/10.7554/eLife.26371.023

5`……3`Mutation
Casp3 KOMCF10AClone1: AAAGATCATACATGGAAGCGAATCAATGGA - - - - - - - ATAT Casp3: AAAGATCATACATGGAAGCGAATCAATGGACTCTGGAATAT7 bp deletion
Casp3 KOBJ-1hTERTClone28: AAAGATCATACATGGAAGCGAATCAATG - - - deletion-------- Casp3: AAAGATCATACATGGAAGCGAATCAATGGACTCTGGAATAT193 bp deletion
EndoG KOMCF10AClone13: -------- deletion-------- EndoG: TGCCACCAACGCCGACTACCGCGGCAGTGGCTTCGACCGCG169 bp deletion

Note: Red: sgRNA sequence; Yellow: PAM sequence; Bold: insertion sequence; -: deletion sequence. In all cases, knockout clones that showed both clear absence of target protein expression and gene mutations were chosen. In addition, in most cases, only those clones with homozygous mutations (where both copies of the gene showed the same mutation) were chosen for convenience.

Figure 1—figure supplement 3.

Additional data for the influence of Casp3 on Myc-induced genetic instability in MCF10A cells.

(A) Average number of γH2AX foci per cell in Myc-transduced MCF10A cells with or without CASP3 gene ablation. (B) Average number of chromosomal aberrations per cell in Myc-transduced MCF10A cells with or without CAPS3 gene ablation. Error bars represent standard error of the mean (SEM). *p>0.05; **p<0.05; Students t-test, n = 3. In A, each data point was derived from the average of three triplicate groups of 150 cells each. In B, each data point was derived from the average of three triplicate groups of 50 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.016

Figure 1—figure supplement 4.

Immunofluorescence co-staining of vector control and Myc-transduced MCF10A cells.

Notice the heterogeneous nature of Myc expression.

DOI: http://dx.doi.org/10.7554/eLife.26371.017

Figure 1—figure supplement 5.

DNA double-strand repair kinetics in MCF10A cells with various genetic backgrounds.

Cells were synchronized and irradiated with 3Gys of X-rays. At different time points after radiation exposure, they were fixed and stained with fluorescence-labeled γH2AX antibody. The fraction of cells with γH2AX foci were then enumerated from fluorescence images. MCF10A Myc vs Casp3KO Myc, **p<0.001, n = 5, Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.26371.018

Primary antibodies used in this study. DOI: http://dx.doi.org/10.7554/eLife.26371.021 Single guided RNA (sgRNA) sequences used in this study. DOI: http://dx.doi.org/10.7554/eLife.26371.022 *Capital letters: enzyme overhangs; non-capital letters: sgRNA target guide sequence. Mutations at target sequences in various CRISPR knockout MCF10A and BJ-1 hTERT cells. DOI: http://dx.doi.org/10.7554/eLife.26371.023 Note: Red: sgRNA sequence; Yellow: PAM sequence; Bold: insertion sequence; -: deletion sequence. In all cases, knockout clones that showed both clear absence of target protein expression and gene mutations were chosen. In addition, in most cases, only those clones with homozygous mutations (where both copies of the gene showed the same mutation) were chosen for convenience. In order to rule out the possibility that our CASP3KO cells suffered off-target effects during the generation process, we re-expressed Casp3 in CASP3KO MCF10A cells (Figure 1—figure supplement 6A) and examined for Myc-induced γH2AX foci. Our results indicate that Casp3 re-expression restored Myc-induced DNA damage foci (Figure 1—figure supplement 6B). In a parallel experiment, we expressed a dominant-negative CAPS3 gene (dnCASP3) in Casp3KO cells. DnCasp3 differs from wild-type Casp3 in only a single amino acid that eliminates its cleavage activities (Stennicke and Salvesen, 1997). In contrast to wild-type Casp3 re-expression, dnCASP3 re-expression did not restore the ability of Myc to induce γH2AX foci (Figure 1—figure supplement 6C).
Figure 1—figure supplement 6.

Additional data confirming the role of Casp3 in mediating Myc-induced genomic instability.

(A) Western blot confirmation of Myc over-expression and re-expression Casp3 in Casp3KO cells. (B) The effect of Casp3 re-expression on Myc-induced γH2AX foci in MCF10A-CASP3KO cells. (C) The effect of dominant-negative Casp3 (C163A mutation) on Myc-induced γH2AX foci in MCF10A-CASP3KO cells. Error bars represent standard error of the mean (SEM). *p>0.05; **p<0.05. In B and C, each data point was derived from the average of three triplicate groups of 150 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.019

In order to make sure that our observations so far are not restricted to MCF10A cells, we generated CASP3 gene knockout cells from hTERT immortalized BJ1 human fibroblast cells (Figure 1—figure supplement 7A, Table 3) to assess the effects of Casp3 on myc-induced genomic instability. Similar to MCF10A cells, we observed that Myc overexpression resulted in statistically significant increases in γH2AX foci (Figure 1—figure supplement 7B) and chromosomal aberrations (Figure 1—figure supplement 7C) in cells overexpressing Myc. However, such increases were almost completely eliminated in CASP3KO BJ1 cells (Figure 1—figure supplement 7B,C), similar to CASP3KO MCF10A cells.
Figure 1—figure supplement 7.

Role of Casp3 in Myc-induced genetic instability in BJ-1 human fibroblasts.

(A) Western blot showing CASP3 gene knockout in immortalized human BJ1 fibroblasts. (B) Quantitative estimate of Myc induced γH2AX foci in control and CASP3 knockout BJ1 fibroblasts. (C) Quantitative estimate of Myc-induced chromosomal aberrations in control and CAPS3 knockout BJ1 human fibroblast cells. In B, C, error bars represent SEM. *p>0.05, **p<0.001, Student’s t-test, n = 3. In B, each data point was derived from the average of three triplicate groups of 150 cells each. In C, each data point was derived from the average of three triplicate groups of 50 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.020

Since Myc-induced genomic instability is intimately associated with its ability to transform mammalian cells, we investigated Myc-induced tumorigenicity in MCF10A cells. We initially evaluated Myc-induced tumorigenicity of MCF10A cells by use of the soft agar colony forming assay, a well-establish assay that evaluates the anchorage independence ability of putative tumor cells. Our results indicate that Myc overexpression in control MCF10A resulted in a significant increase in the number of observed soft agar colonies (Figure 2A,B). However, such increases were completely absent in Casp3 knockout cells (Figure 2A,B). The causative role for Casp3 in this process was further demonstrated in Casp3KO cells with Casp3 re-expression, the ability of Myc to induce soft agar colony formation was restored (Figure 2C). In control MCF10A cells, expression of an exogenous Casp3 caused no increase in Myc-induced soft agar colony formation (Figure 2C).
Figure 2.

Requirement for Casp3 in Myc-induced transformation.

(A) Depicts colonies which grew in soft agar. (B) Average number of colonies in soft agar in control and Casp3-deficient cells with or without Myc expression. (C) Average number of colonies in soft agar in wild type and Casp3 knockout MCF10A cells with Casp3 re-expression in the absence or presence of Myc over-expression. (D) Tumor growth from control, Myc-overexpressing, and Casp3KO cells with Myc over-expressiong in nude mice. (E) Individual tumor sizes in nude mice form wild-type cells with Myc over-expression. The error bars in B, D, and E represent standard error of the mean (SEM). * Indicates p value < 0.001, ** indicates p value << 1e−5, *** indicates a p value > 0.1. Student’s t-test was used to calculate the p-values in B and C. N = 3 for B and C. N = 5 for D.

DOI: http://dx.doi.org/10.7554/eLife.26371.024

DOI: http://dx.doi.org/10.7554/eLife.26371.025

DOI: http://dx.doi.org/10.7554/eLife.26371.026

DOI: http://dx.doi.org/10.7554/eLife.26371.027

Requirement for Casp3 in Myc-induced transformation.

(A) Depicts colonies which grew in soft agar. (B) Average number of colonies in soft agar in control and Casp3-deficient cells with or without Myc expression. (C) Average number of colonies in soft agar in wild type and Casp3 knockout MCF10A cells with Casp3 re-expression in the absence or presence of Myc over-expression. (D) Tumor growth from control, Myc-overexpressing, and Casp3KO cells with Myc over-expressiong in nude mice. (E) Individual tumor sizes in nude mice form wild-type cells with Myc over-expression. The error bars in B, D, and E represent standard error of the mean (SEM). * Indicates p value < 0.001, ** indicates p value << 1e−5, *** indicates a p value > 0.1. Student’s t-test was used to calculate the p-values in B and C. N = 3 for B and C. N = 5 for D. DOI: http://dx.doi.org/10.7554/eLife.26371.024

Data for Figure 2B.

DOI: http://dx.doi.org/10.7554/eLife.26371.025

Data for Figure 2C.

DOI: http://dx.doi.org/10.7554/eLife.26371.026

Data for Figure 2D&E.

DOI: http://dx.doi.org/10.7554/eLife.26371.027 In a further experiment, we examined the ability of Myc-transduced control or CASP3KO cells to form tumors in nude mice. Despite injection of 4 × 106 cells each, only the group of nude mice that were injected with Myc-transduced control MCF10A cell were able to form tumors after 8 weeks of observation (Figure 2D), thereby confirming that both Myc over-expression and an intact CAPSP3 gene are required for oncogenic transformation. A more detailed examination showed that in Myc over-expressing MCF10A cells, five out of eight injected sites formed tumors, albeit with varying growth kinetics (Figure 2E). The in vivo data here are striking in that Casp3 deficiency completely blocked the ability of Myc to transform MCF10A cells. In vitro, although Casp3 deficiency significantly reduced Myc-induced soft agar colony formation, it was not completely blocked. The discrepancy between the in vitro and in vivo assays perhaps reflected the different properties that the two assays are measuring. We next sought to determine the downstream effectors of Casp3 in mediating Myc-induced genomic instability and oncogenic transformation. In a previous study, endonuclease G (endo G), an apoptotic endonuclease that normally resides within the mitochondria and migrates to the nucleus after activation of apoptotic cascade (Parrish et al., 2001; Li et al., 2001), is responsible for much of the Casp3-induced genomic instability after stress exposure. In order to evaluate if endoG is involved in Myc-induced genomic stability, we determined the cellular location of endoG in control and Myc expressing MCF10A cells by use of immunofluorescence staining. Our results show that there was a significant increase in the fraction of cells with endoG nuclear migration in Myc-expressing MCF10A vs control cells (11% vs 2%, Figure 3A,B). However, the increase was completely eliminated in CASP3 knockout cells (Figure 3B).
Figure 3.

Requirement of EndoG in Myc-induced genomic instability and transformation.

(A) Immunofluorescence staining of of MCF10A with antibodies to EndoG (green), mitochondria (Orange) and DAPI (blue). Scale bar represents 20 μm. (B) Fraction of MCF10A cells with activated EndoG (EndoG signal within the nucleus). Error bar indicates SEM. (C) Western blot analysis fo EndoG expression in wild type or endoG knockout MCF10A cells. (D) Fraction of cells which stained positive for a γH2AX foci in control and EndoG-deficient MCF10A with or without exogenous expression of Myc. (E) Influence of endoG status on Myc-induced transformation of MCF10A cells, as indicted by soft agar (SA) colony formation. * Indicates p value < 0.001, **p>0.05. Student’s t-test in B, D, E. Error bars represent SEM. In B, D, each data point was derived from the average of three triplicate groups of 150 cells each. In E, n = 3.

DOI: http://dx.doi.org/10.7554/eLife.26371.028

DOI: http://dx.doi.org/10.7554/eLife.26371.029

DOI: http://dx.doi.org/10.7554/eLife.26371.030

DOI: http://dx.doi.org/10.7554/eLife.26371.031

DOI: http://dx.doi.org/10.7554/eLife.26371.032

DOI: http://dx.doi.org/10.7554/eLife.26371.033

Error bar indicates SEM. * indicates p<0.01, Student’s t-test, n = 3. Each data point was derived from the average of three triplicate groups of 150 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.034

DOI: http://dx.doi.org/10.7554/eLife.26371.035

Top panels. ROS levels in MCF10A vs CASP3KO cells (left) and MCF10A vs ENDOGKO cells (right). Lower panels, ROS levels in wild type (left), CASP3KO (middle), and ENDOGKO (right) MCF10A cells with or without Myc expression.

DOI: http://dx.doi.org/10.7554/eLife.26371.036

Cytoplasmic mtND5 of indicated cells were analyzed by use of quantitative RT-PCR. The levels of 18S rDNA were also determined to serve as genomic DNA control. Error bars represent standard error of the mean (SEM), n = 3, p values derived from Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.26371.037

Requirement of EndoG in Myc-induced genomic instability and transformation.

(A) Immunofluorescence staining of of MCF10A with antibodies to EndoG (green), mitochondria (Orange) and DAPI (blue). Scale bar represents 20 μm. (B) Fraction of MCF10A cells with activated EndoG (EndoG signal within the nucleus). Error bar indicates SEM. (C) Western blot analysis fo EndoG expression in wild type or endoG knockout MCF10A cells. (D) Fraction of cells which stained positive for a γH2AX foci in control and EndoG-deficient MCF10A with or without exogenous expression of Myc. (E) Influence of endoG status on Myc-induced transformation of MCF10A cells, as indicted by soft agar (SA) colony formation. * Indicates p value < 0.001, **p>0.05. Student’s t-test in B, D, E. Error bars represent SEM. In B, D, each data point was derived from the average of three triplicate groups of 150 cells each. In E, n = 3. DOI: http://dx.doi.org/10.7554/eLife.26371.028

Data for Figure 3B.

DOI: http://dx.doi.org/10.7554/eLife.26371.029

Data for Figure 3D.

DOI: http://dx.doi.org/10.7554/eLife.26371.030

Data for Figure 3E.

DOI: http://dx.doi.org/10.7554/eLife.26371.031

Data for Figure 3—figure supplement 1.

DOI: http://dx.doi.org/10.7554/eLife.26371.032

Data for Figure 3—figure supplement 4.

DOI: http://dx.doi.org/10.7554/eLife.26371.033

Additional data showing the average number of γH2AX foci per cell in control and EndoG deficient MCF10A cells with or without exogenous expression of Myc.

Error bar indicates SEM. * indicates p<0.01, Student’s t-test, n = 3. Each data point was derived from the average of three triplicate groups of 150 cells each. DOI: http://dx.doi.org/10.7554/eLife.26371.034

Flow cytometry analysis of various MCF10A cells for PI and annexin V staining to quantitate the fraction of cell undergoing early (lower right quadrants), late (top right quadrants) apoptosis, and necrosis (top left quadrants).

DOI: http://dx.doi.org/10.7554/eLife.26371.035

Flow cytometry level analysis of reactive oxygen species (ROS) levels in various MCF10A cells.

Top panels. ROS levels in MCF10A vs CASP3KO cells (left) and MCF10A vs ENDOGKO cells (right). Lower panels, ROS levels in wild type (left), CASP3KO (middle), and ENDOGKO (right) MCF10A cells with or without Myc expression. DOI: http://dx.doi.org/10.7554/eLife.26371.036

Relative levels of mitochondrial DNA that leaked into the cytoplasm in control as wells genetically modified MCF10A cells.

Cytoplasmic mtND5 of indicated cells were analyzed by use of quantitative RT-PCR. The levels of 18S rDNA were also determined to serve as genomic DNA control. Error bars represent standard error of the mean (SEM), n = 3, p values derived from Student’s t-test. DOI: http://dx.doi.org/10.7554/eLife.26371.037 In order to determine if endoG plays a causative role in Myc-induced genomic damage and transformation, we created MCF10A cells with ENDOG gene knockout by use of CRISPR/Cas9 (Figure 3C). We then evaluated the abilities of Myc to induce γH2AX foci and oncogenic transformation. Our results show that ENDOG deletion was able to eliminate both Myc-induced γH2AX foci (Figure 3D and Figure 3—figure supplement 1) and oncogenic transformation as evaluated by use of the soft agar colony-forming assay (Figure 3E).
Figure 3—figure supplement 1.

Additional data showing the average number of γH2AX foci per cell in control and EndoG deficient MCF10A cells with or without exogenous expression of Myc.

Error bar indicates SEM. * indicates p<0.01, Student’s t-test, n = 3. Each data point was derived from the average of three triplicate groups of 150 cells each.

DOI: http://dx.doi.org/10.7554/eLife.26371.034

To further determine the relationships among Myc expression, CASP3 status, ENDOG status, and apoptosis, we carried out flow cytometry analysis of Annexin V and PI (propidium iondine) staining, which allowed for the identification of different stages of cellular apoptosis. Our results (Figure 3—figure supplement 2) indicate that CASP3KO caused small reductions in both Annexin V+ and Annexin V+/PI+ MCF10A cells when compared with control cells. However, ENDOG knockout caused small increases in fractions of Annexin V+/PI- and Annexin V-/PI+ cells when compared with control cells. Myc expression, on the other hand, caused increases in fractions of Annexin V+/PI+ cells I all three cell populations. Overall, while the relative changes could be sizable, the absolute changes caused by the knockouts or Myc expression in terms of PI+ or Annexin V+ cells were small.
Figure 3—figure supplement 2.

Flow cytometry analysis of various MCF10A cells for PI and annexin V staining to quantitate the fraction of cell undergoing early (lower right quadrants), late (top right quadrants) apoptosis, and necrosis (top left quadrants).

DOI: http://dx.doi.org/10.7554/eLife.26371.035

Increased ROS has been previously implicated in Myc-induced carcinogenesis. Our data so far has suggested strongly that the Casp3 activation and endoG release from the mitochondria played decisive roles in Myc-induced carcinogenesis. In order to determine if ROS levels in MCF10A cells correspond with oncogenic transformation, we did DCFDA-based flow cytometry analysis ROS levels in various MCF10A-derived cells (Figure 3—figure supplement 3). Our results indicate that CASP3 or ENDOG knockout caused small increase and decrease in MCF10A cells (Figure 3—figure supplement 3, top panels), respectively. Forced MYC expression increased ROS in wild-type MCF10A cells but not in CASP3KO or ENDOGKO MCF10A cells (Figure 3—figure supplement 3, mid-panels). Further, Myc was able to induce significantly more ROS in wild-type MCF10A cells than CASP3KO cells, but about equal levels of ROS in wild type vs ENDOGKO cells (Figure 3—figure supplement 3, lower panels). Those data suggest that although ROS production appeared to track with carcinogenesis in wild-type and CASP3KO cells, it did not in ENDOGKO cells.
Figure 3—figure supplement 3.

Flow cytometry level analysis of reactive oxygen species (ROS) levels in various MCF10A cells.

Top panels. ROS levels in MCF10A vs CASP3KO cells (left) and MCF10A vs ENDOGKO cells (right). Lower panels, ROS levels in wild type (left), CASP3KO (middle), and ENDOGKO (right) MCF10A cells with or without Myc expression.

DOI: http://dx.doi.org/10.7554/eLife.26371.036

In order to determine whether Casp3 activation and endoG release is the result of partial damage of many mitochondria vs severe damage to a small number of mitochondria, a quantitative PCR (qPCR) analysis of cytoplasmic mitochondrial DNA (mtDNA) levels was done (Figure 3—figure supplement 4). Our results indicate that MYC expression in MCF10A cells caused a significant increase in cytoplasmic mtDNA levels, indicating that a significant fraction of mitochondria had compromised membrane integrity. On the other hand, CASP3KO significantly reduced cytoplasmic mtDNA levels in MCF10A cells with or without Myc over expression. While we are not clear of the exact cause of this, we speculate that Casp3 and other upstream factors that promote mitochondrial leakage form a positive loop to promote mitochondrial leakage with or without Myc expression.
Figure 3—figure supplement 4.

Relative levels of mitochondrial DNA that leaked into the cytoplasm in control as wells genetically modified MCF10A cells.

Cytoplasmic mtND5 of indicated cells were analyzed by use of quantitative RT-PCR. The levels of 18S rDNA were also determined to serve as genomic DNA control. Error bars represent standard error of the mean (SEM), n = 3, p values derived from Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.26371.037

To further examine if endoG leakage from the mitochondria and migration is sufficient to cause genomic instability and oncogenic transformation, we engineered a modified endoG protein where the native mitochondrial localization signal is switched to a nuclear localization signal (NLS-EndoG, Figure 4A) and transduced it into MCF10ACASP3KO cells with or without Myc expression (Figure 4B). Immunofluorescence staining confirmed the nuclear localization of the engineered endoG (Figure 3C). We then determined the incidence of γH2AX foci in transduced cells. Our results indicate the NLS-endoG expression restored the depleted γH2AX foci induction by Myc in CASO3KO cells (Figure 4D). In fact, NLS-endoG alone was sufficient to induce γH2X foci in CASP3KO cells to levels induced by Myc (Figure 4D).
Figure 4.

A nucleus-located EndoG restores Myc induced transformation in Casp3-deficient cells.

(A) A diagram showing a re-engineered endoG with a nucleus localization signal (NLS) at its tagged N-terminal. (B) Western blot demonstrating exogenous myc and NLS-EndoG expression by use of an anti-HA antibody. (C) Immunoflouresence staining of EndoG (green), mito marker (red), and DAPI (blue) in NLS-EndoG transduced CASP3KO cells. Scale bar indicates 20 µm. (D) Average number of γH2AX foci per cell in MCF10A with or without nEndoG in the absence or presence of Myc or Casp3KO. (E) The influence of nEndoG on soft agar formation in MCF10A-Casp3KO cells with or without Myc gene expression. (F) Xenograft tumor formation in nude mice from MCF10A-Casp3KO cells with NLS-EndoG (nEndoG) and/or Myc expression. In D, E, F error bars represent standard error of the mean (SEM), * indicates p value < 0.001 while ** Indicates p value > 0.1. Student’s t-test. In D, each data point was derived from the average of three triplicate groups of 150 cells each. In E, n = 3. In F, n = 5.

DOI: http://dx.doi.org/10.7554/eLife.26371.038

DOI: http://dx.doi.org/10.7554/eLife.26371.039

DOI: http://dx.doi.org/10.7554/eLife.26371.040

DOI: http://dx.doi.org/10.7554/eLife.26371.041

A nucleus-located EndoG restores Myc induced transformation in Casp3-deficient cells.

(A) A diagram showing a re-engineered endoG with a nucleus localization signal (NLS) at its tagged N-terminal. (B) Western blot demonstrating exogenous myc and NLS-EndoG expression by use of an anti-HA antibody. (C) Immunoflouresence staining of EndoG (green), mito marker (red), and DAPI (blue) in NLS-EndoG transduced CASP3KO cells. Scale bar indicates 20 µm. (D) Average number of γH2AX foci per cell in MCF10A with or without nEndoG in the absence or presence of Myc or Casp3KO. (E) The influence of nEndoG on soft agar formation in MCF10A-Casp3KO cells with or without Myc gene expression. (F) Xenograft tumor formation in nude mice from MCF10A-Casp3KO cells with NLS-EndoG (nEndoG) and/or Myc expression. In D, E, F error bars represent standard error of the mean (SEM), * indicates p value < 0.001 while ** Indicates p value > 0.1. Student’s t-test. In D, each data point was derived from the average of three triplicate groups of 150 cells each. In E, n = 3. In F, n = 5. DOI: http://dx.doi.org/10.7554/eLife.26371.038

Data for Figure 4D.

DOI: http://dx.doi.org/10.7554/eLife.26371.039

Data for Figure 4E.

DOI: http://dx.doi.org/10.7554/eLife.26371.040

Data for Figure 4F.

DOI: http://dx.doi.org/10.7554/eLife.26371.041 We next examined the influence of NLS-EndoG on oncogenic transformation by use of the soft agar assay. Our results show that NLS-EndoG restored the ability of Myc to induce oncogenic transformation in Casp3 knockout MCF10A cells (Figure 4E). However, NLS-EndoG expression alone was not sufficient to induce oncogenic transformation despite its ability to induce DNA damage foci to levels similar to Myc expression (Figure 4E). Those results suggest while endoG nuclear migration is a necessary condition for Myc-induced oncogenic transformation, it is not sufficient by itself. Additional activities of Myc are clearly required in the transformation process. A further tumor formation experiment was conducted in nude mice to examine the role of NLS-EndoG in oncogenic transformation. NLS-EndoG restored the ability of Myc to induce oncogenic transformation in CASP3KO MCF10A cells (Figure 4F), with five out of eight inoculations formed tumors. On the other hand, NLS-EndoG alone was not able to make MCF10A cells with CASP3 gene knockout to become tumorigenic, consistent with results from soft agar colony formation assay (Figure 4E). Despite being one of the first oncogenes identified and having numerous studies dedicated to discovering its roles in cancer biology, there are still many gaps in our knowledge about Myc. The present study provides significant new insights into the roles of Myc in carcinogenesis. In particular, it resolves two apparently paradoxical observations regarding Myc: its ability to stimulate apoptosis and to induce genomic instability and oncogenic transformation. In many instances, such as in the case of p53, apoptosis induction is anti-carcinogenic due to its ability to remove damaged cells from the body. However, in the case of Myc, the apoptotic machinery, is exploited by Myc as a vehicle to cause genomic instability and induce oncogenic transformation. Most strikingly, our data suggest that Casp3 and Endo G, two well-established apoptosis effectors, are activated and required for Myc-induced oncogenic transformation. This finding suggest that Myc-induced activation of apoptosis, instead of being a result of Myc induced cellular stress, is actually part and parcel of Myc’s capacity to induce mammalian transformation. One important piece of information that remain missing is how Myc induces mitochondrial leakage and Casp3 activation. While we do not have any experimental evidence at present, it is possible that deregulation in mitochondrial biogenesis, which is known to be stimulated by Myc, may be responsible for it, as suggested previously (Dang et al., 2005; Zhang et al., 2007; Ahuja et al., 2010). This possibility should be investigated in future studies since it may holds the key to Myc’s powerful oncogenic abilities. On the surface, our discovery appears to be contrary to the established paradigm that apoptosis is a key barrier for carcinogenesis (Hanahan and Weinberg, 2011). However, it is consistent with an increasing body of literature that suggest a pro-oncogenic role for apoptosis and some apoptotic factors (Tang et al., 2012; Ichim et al., 2015; Liu et al., 2015). The key conceptual advance in the studies is the realization of that cells exposed to stress can survive caspase activation (Tang et al., 2012; Ichim et al., 2015; Liu et al., 2015; Ding et al., 2016; Ichim and Tait, 2016). The observation of such survival in development (Ding et al., 2016), chemical exposure (Tang et al., 2012; Ichim et al., 2015), and radiation exposure (Liu et al., 2015) indicate that it is a wide spread phenomenon. Our observation of cells surviving Myc-induced caspase activation is a significant extension of those earlier observations and may provide important insights into the relationship between apoptosis and oncogene-induced transformation beyond that of Myc. Taken together, our study provides crucial evidence that Casp3 and endo G, two key factors in the canonical apoptosis pathway, play essential, facilitative roles in Myc-induced oncogenic transformation.

Materials and methods

Cell lines and tissue culture

Early passage, immortalized, non-transformed human breast epithelial cell line, MCF10A, was a kind gift from Dr. Hatsumi Nagasawa of Colorado State University (Fort Collins, CO). MCF10A growth medium was composed of Dulbacco’s modified Eagle’s medium (DMEM)/F12 (Sigma) supplemented with 5% donor horse serum (Sigma), 20 ng/ml of epidermal growth factor (EGF; R&D Systems), 0.5 µg/ml hydrocortisone (Sigma), 100 ng/ml cholera toxin (Sigma), 10 µg/ml insulin (Invitrogen), and 100 units/ml penicillin and 100 µg/ml streptomycin. hTERT immortalized, non-transformed human fibroblast cell line, hTERT BJ-1, was a kind gift from Dr. Takamitsu Kato of Colorado State University. hTERT BJ-1 growth medium was composed of DMEM supplemented with 10% fetal bovine serum (Sigma) and 100 units/ml penicillin and 100 µg/ml streptomycin. The identities of both MCF10A and hTERT-BJ1 were authenticated through STR profiling methods. Throughout the course of the experiments, the cells were also checked periodically for the absence of mycoplasma contamination.

γH2AX foci assay

For γH2AX foci assays, the cells were synchronized in G1 using the well-established double-thymidine block protocol (Bostock et al., 1971). Briefly, cells were plated on glass-bottom 35 mm petri dishes (MatTek, Ashland, MA) and cultured with growth medium for overnight. They were incubated with 2 mM thymidine for 18 hr, washed 2x with PBS, and incubated for 10–12 hr in growth media. They were then incubated for 15–18 hr with 2 mM thymidine. After synchronization, cells were fixed with 4% PFA and permeabilized and blocked in PBS containing 0.1% Triton X-100, 5% goat serum, and 1% BSA. Cells were incubated with a primary antibody against γH2AX (Upstate Biotechnology, Lake Placid, NY), wash with PBS and incubated with a secondary antibody conjugated with Alexa Fluor 488 (Invitrogen). Cells were mounted with mounting medium (Vector Laboratories) containing DAPI. Fluorescent images of γH2AX were acquired with a Zeiss fluorescence microscope with a 63x oil objective (Axio Observer Z1). For each experimental group we observed 150 cells in triplicate.

Chromosome aberration analysis

We carried out chromosome aberration analysis in cultured cells following an established protocol (Savage, 1976). We analyzed for various chromosome/chromatid aberrations that include breaks/gaps, dicentrics, centric/acentric rings, and translocations. Each data points represent data from 50 cells in triplicate.

CRISPR/Cas9-mediated gene knockout and lentivirus production

We made various cells deficient in various genes by use of the CRISPR/Cas9 technology. Single-guided RNA (sgRNA) sequences targeting the genes were generated with the use of a free online CRISPR design tool (crispr.mit.edu). The sgRNA sequences used were listed in Table 2. Annealed double stranded sgRNA oligos were ligated into the lentiCRISPR vector (Cong et al., 2013) (deposited by Dr. Feng Zhang to Addgene, Cambridge, MA) at BsmBl site, which co-express cas9 and sgRNA in the same vector. The constructed CRISPR lentivirus vectors were then packaged according to a standard protocol. To produce lentiviral vectors, lentiviral plasmids with the target genes were transduced into 293 T cells together with second-generation packaging plasmids (psPAX2, pMD2.G) following previously published procedures: http://tronolab.epfl.ch/lentivectors.
Table 2.

Single guided RNA (sgRNA) sequences used in this study.

DOI: http://dx.doi.org/10.7554/eLife.26371.022

GeneAccessionsgRNA oligo(5`−3`)*Targeted exon
CASPASE3NC_000004CACCGcatacatggaagcgaatcaa AAACttgattcgcttccatgtatgCExon4
CASPASE3NC_000004CACCGggaagcgaatcaatggactc AAACgagtccattgattcgcttccCExon4
EndoGNC_000009CACCGgggctgggtgcggtcgtcga AAACtcgacgaccgcacccagcccCExon1
EndoGNC_000009CACCGcgacttccgcgaggacgact AAACagtcgtcctcgcggaagtcgCExon1

*Capital letters: enzyme overhangs; non-capital letters: sgRNA target guide sequence.

Immunofluorescence staining

Cells were cultured on glass-bottom 35 mm petri dishes. Cells were fixed with 4% paraformaldehyde (PFA) in PBS for 15 min, permeabilized and blocked with PBS containing 5% goat serum, 0.1% Triton X-100, and 1% bovine serum albumin (BSA) for 45 min. Fixed cells were incubated with primary antibodies for cleaved Caspase-3, γH2AX, or EndoG overnight at 4C, followed by incubation with appropriate Alexa Fluor 488-conjugated secondary antibodies (Invitrogen, Carlsbad, CA) for 1 hr and mounted with mounting medium (Vector Laboratories, CA) containing DAPI. Fluorescent images were acquired with a Zeiss fluorescence microscope with a 63x oil objective (Axio Observer Z1).

Soft-agar assay

The soft-agar assay was carried out following an established procedure (Cifone and Fidler, 1980). About 1 × 104 MCF10A cells in growth medium were plated into six-well plates with 1.5 ml 0.3% (m/v) low-melting agar (BD, Sparks, MD, which was overlaid onto 1.5 ml 0.6% (w/v) bottom agar layer. Soft-agar colonies were maintained at 37°C and fed twice a week by drop-wise addition of growth medium for colony formation. After 21 days in culture, the colonies were counted after staining with 0.005% crystal violet.

Flow cytometry-based analysis of ROS

In order to measure reactive oxygen species, the cells were labeled with DCFDA (20 µM) according to the manufacturer’s instruction that comes with the ROS kit (Abcam, Cambridge, MA). The cells were then analyzed by use of flow cytometry.

Q-PCR analysis of mtDNA

To measure cytoplasmic mtDNA in various MCF10A-derived cells, the cytoplasmic fraction of the cellular lysates were isolated according to a published protocol (Bronner and O’Riordan, 2016). To quantify mtDNA, a segment of the mtND5 gene was amplified by use of the primer pair (Neufeld-Cohen et al., 2016): forward 5′-ACGAAAATGACCCAGACCTC-3′, rev 5′-GAGATGACAAATCCTGCAAAGATG-3′ through Q-PCR. A pair of primers for 18 s rDNA (Forward: 5’-TAGAGGGACAAGTGGCGTTC-3’ Reverse: 5’-CGCTGAGCCAGTCAGTGT-3’) was used as control.

Tumor formation in nude mice

Animal experiments conducted in this study were approved by the Duke University Institutional Animal Use and Care Committee (protocol# A195-14-08). To confirm the tumorigenicity of myc overexpressing MCF10A cells, about 4 × 106 cells were injected subcutaneously into the flanks of 6–8 week-old, female athymic nude mice (Jackson Laboratories) in 50 µl of 1:1 Matrigel (Corning) and PBS. After inoculation, the growth of tumors was evaluated once a week for 8 weeks.

Statistical analysis

Student’s t-test was used to evaluate the significance of differences between different experimental groups. In most cases, a p-value of less than 0.05 was deemed as significant while a p-value of more than 0.05 was deemed not significant. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Essential roles of Caspase-3 in facilitating Myc-induced genetic instability and carcinogenesis" for consideration by eLife. Your article has been favorably evaluated by Kevin Struhl (Senior Editor) and three reviewers, one of whom, Chi Van Dang, is a member of our Board of Reviewing Editors. The following individual involved in review of your submission has agreed to reveal their identity: Dean Felsher (Reviewer #2). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: The manuscript by Cartwright et al. reports data which are consistent with a previously unsuspected role of MYC-induced pre-apoptotic release of caspase-3 and the downstream endonuclease ENDOG in mediating genetic instability and contributing to transformation of MCF10A cells. They perform studies in MCF10A and TERT-immortalized human fibroblasts and measure genomic instability including measures of γH2AX and chromosomal instability and in vitro transformation and in vivo growth in nude mice. Specifically, deletion of CASP3 or ENDOG blocked MYC-mediated genomic instability and neoplastic transformation. The authors used straightforward experimental approaches with γH2AX as a marker of DNA damage and CRISPR/Cas9 mediated knockout of CASP3 or ENDOG in two cell systems to test their hypotheses. They also measured chromosomal abnormalities by karyotyping. They demonstrate the nuclear presence of EndoG was higher in MYC-overexpressing cells than control and this was diminished with CASP3 knockout. To determine whether EndoG is responsible for DNA damage, they knocked out ENDOG and found a reduction in DNA damage in MYC-overexpressing cells. This was negated by reintroduction of a nuclear-targeted EndoG (NLS-linked) transfected back into EndoG knockout cells. Nuclear-targeted EndoG, while sufficient to increase γH2AX staining and necessary for MYC-mediated transformation, is insufficient for neoplastic transformation. Nuclear-targeted EndoG, however, could rescue MYC-mediated transformation and tumorigenesis in MYC-overexpressing MCF10A with CASP3 knocked out. Overall, the authors provide compelling evidence for a MYC-mediate near-death cellular state in which leakage of CASP3 could activate ENDOG to cause DNA damage and contribute to neoplastic transformation. Essential revisions: 1) The use of additional quantitative assays would greatly bolster this study:a) The authors should provide quantitative assessment of apoptosis using Annexin V + PI staining and flow cytometry in the different cell lines at baseline. These simple experiments will help bolster these intriguing novel observations. b) DNA break repair assay. c) ROS production. While the rescue experiments, particularly by nuclear-targeted EndoG in CASP3-knockout cells, seems to pinpoint the pathway from MYC to DNA damage, MYC can also induce ROS production. As such, documentation of baseline ROS in the different cell lines using flow cytometry should address whether ROS tracks with tumorigenesis. d) Cytoplasmic mtDNA levels (by PCR relative to genomic DNA) to determine the extent of mitochondrial damage in MYC-overexpressing cells. This would address whether release of Casp3 is from partially damaged mitochondria or during fission and fusion (induced by MYC as reported in the literature) or due to small percentages of mitochondria that are full damaged. 2) In Figure 1B, the percentage of cells with cleaved Caspase-3 in Myc overpressed cells is about 6%, which is about 4-5 times higher than in control cells. The authors should document the extent of MYC expression among the MCF10A cells by anti-MYC antibody immunofluorescent microscopy to accompany the γH2AX staining. Presumably, MYC staining should be quite uniform. 3) Figure 1—figure supplement 1: there seems to be no difference in cell survival in either Casp3GFP high or low sorted cells. The authors should document by Annexin V (or other apoptotic markers) staining to verify whether apoptosis process is initiated in Casp3GFP high vs. low cells. 4) Do the authors find that knocking out Caspase 3 reduced the frequency of tumorigenic cells or is there an absolute prevention of tumorigenic growth? This aspect should be discussed. Further Caspase 3 may have other functions that are required for sustained tumor growth, such as suppressing MYC-mediated apoptosis. The authors need to acknowledge this possibility. 5) The authors did not define the mechanism by which overexpressed MYC induces low level release of Casp3. This should be discussed to encourage further studies regarding MYC's effects on deregulated mitochondrial biogenesis and function. Essential revisions: 1) The use of additional quantitative assays would greatly bolster this study:a) The authors should provide quantitative assessment of apoptosis using Annexin V + PI staining and flow cytometry in the different cell lines at baseline. These simple experiments will help bolster these intriguing novel observations. We agree with this suggestion and carried out flow cytometry analysis of Annexin V +PI staining of various cell lines used in our study. The data, now shown as Figure 3—figure supplement 2, indicate the Myc over expression caused only a small but clear increase in AnnexinV and PI double positive fraction in parental MCF10A cells. The same is true for both Casp3KO or EndoGKO MCF10A cells. The fractions of AnnexinV+PI‐ cells were slightly higher in EndoG knockout cells but lower in Casp3 knockout cells when compared with parental MCF10A cells. b) DNA break repair assay. In order to determine the capacity of wild type and gene knockout MCF10A cells to repair DNA double strand breaks, we carried out experiments to measure the kinetics of x‐ray induced γH2AX foci induction in MCF10A and MCF10ACasp3KO cells with or without Myc gene expression (Figure 1—figure supplement 5). Our data indicated that Myc over‐expressing wild type MCF10A cells had the highest fraction of cells with γH2AX foci in un‐irradiated cells, as expected. After 3 Gy of irradiation, all cell types incurred significant DNA damage with γH2AX foci with Myc‐expressing wild type MCF10A cells reaching over 98% of cells that were γH2AX positive while the other cells reaching close to 90%. In all cells, a significant fraction of the induced γH2AX foci were gone by 60 min after irradiation. However, there were significant fractions of residual DNA damage that were not repaired in all irradiated cells, with Myc expression MCF10A cells having over 75% cells that were γH2AX+ while the other cells having 35‐45% fraction that were γH2AX+. c) ROS production. While the rescue experiments, particularly by nuclear-targeted EndoG in CASP3-knockout cells, seems to pinpoint the pathway from MYC to DNA damage, MYC can also induce ROS production. As such, documentation of baseline ROS in the different cell lines using flow cytometry should address whether ROS tracks with tumorigenesis. We agree that it is important to examine the roles of ROS in MYC induced carcinogenesis. Therefore, we did a systematic analysis of ROS levels in various MCF10‐derived cell lines by use of the DCFDA ROS staining assay and flow cytometry analysis (Figure 3—figure supplement 3). Our data indicate that CASP3 knockout reduced ROS levels (top left panel) while ENDOG knockout increased ROS levels (top right panel). On the other hand in MYC overexpression increased ROS levels significantly in MCF10A cells while such increases were eliminated in both CASP3KO cells and ENDOGKO cells (mid‐panels). It is also important to point out that Myc‐expressing ENDOG knockout cells had almost the same level of ROS levels as Mycexpressing wild type MCF10A cells (lower right panel). Therefore, ROS appears to track with tumorigenesis in Myc‐expressing MCF10A cells but not with baseline ROS levels in ENDOG knockout cells or MycENDOG knockout cells. Furthermore, the fact that nuclear endoG (NLSendoG) can compensate for the loss of Casp3 indicate that nuclease‐mediated DNA damage is the dominant mechanism in Myc‐induced carcinogenesis over ROS. d) Cytoplasmic mtDNA levels (by PCR relative to genomic DNA) to determine the extent of mitochondrial damage in MYC-overexpressing cells. This would address whether release of Casp3 is from partially damaged mitochondria or during fission and fusion (induced by MYC as reported in the literature) or due to small percentages of mitochondria that are full damaged. We agree with the above assessment and carried out quantitative PCR analysis of an mtDNA encoded gene mtND5 to measure the levels of cytoplasmic mtDNA levels in various MCF10A‐derived cells. Our results (Figure 3—figure supplement 4) indicate that Myc expression significantly increased the levels of cytoplasmic mtDNA. We believe this points to a general increase in the number of damaged mitochondria instead of a total damage in a small number of mitochondria as the latter would not have increased cytoplasmic mtDNA significantly. Interestingly, Casp3 knockout significantly reduced the levels of cytoplasmic mtDNA in baseline as well as Myc‐expressing MCF10A cells, suggesting that mitochondrial leakage and Caspase activation forms a feedback loop. 2) In We followed the reviewers’ suggestion carried out immunofluorescence staining of Myc and γH2AX in MCF10AMyc cells (Figure 1—figure supplement 4). Our results indicate that Myc‐expression is in fact heterogeneous. Furthermore, its expression does not correlate 100% with γH2AX staining, even though most of the γH2AX positive cells had Myc expression. We are not surprised by the heterogeneous nature of the Myc expression, given it is a protein with a short half‐life and the fact that the CMV promoter that controls Myc expression may not be universally active in all because it is subject to transient or long‐term silencing. 3) The suggested experiment was done (Figure 1—figure supplement 2). Our results indicate that despite a significant increase in the fraction of cells with Casp3‐EGFP activation in Myc‐expressing MCF10A cells, the overall fraction of Annexin V positive cells did on increase at all. 4) Do the authors find that knocking out Caspase 3 reduced the frequency of tumorigenic cells or is there an absolute prevention of tumorigenic growth? This aspect should be discussed. Further Caspase 3 may have other functions that are required for sustained tumor growth, such as suppressing MYC-mediated apoptosis. The authors need to acknowledge this possibility. Our answer to this important question would depend on the assays we used. If we used soft agar growth as the criteria, then the answer is that CASP3KO reduced the frequency of tumorigenic cells. If we use tumor growth in nude mice as the assay, then it is an absolute prevention of tumorigenic growth. We have now added some text on this point in the seventh paragraph of the Results and Discussion. 5) The authors did not define the mechanism by which overexpressed MYC induces low level release of Casp3. This should be discussed to encourage further studies regarding MYC's effects on deregulated mitochondrial biogenesis and function. We have now added some language in the Results and Discussion section (seventeenth paragraph) about Myc’s potential effects on deregulated mitochondrial biogenesis and function as potential mechanism of Myc‐induced release of Casp3. References were also added for this point.
  29 in total

1.  Defective double-strand DNA break repair and chromosomal translocations by MYC overexpression.

Authors:  Asa Karlsson; Debabrita Deb-Basu; Athena Cherry; Stephanie Turner; James Ford; Dean W Felsher
Journal:  Proc Natl Acad Sci U S A       Date:  2003-08-08       Impact factor: 11.205

2.  Induction of apoptosis in fibroblasts by c-myc protein.

Authors:  G I Evan; A H Wyllie; C S Gilbert; T D Littlewood; H Land; M Brooks; C M Waters; L Z Penn; D C Hancock
Journal:  Cell       Date:  1992-04-03       Impact factor: 41.582

3.  Myc controls transcriptional regulation of cardiac metabolism and mitochondrial biogenesis in response to pathological stress in mice.

Authors:  Preeti Ahuja; Peng Zhao; Ekaterini Angelis; Hongmei Ruan; Paavo Korge; Aaron Olson; Yibin Wang; Eunsook S Jin; F Mark Jeffrey; Michael Portman; W Robb Maclellan
Journal:  J Clin Invest       Date:  2010-04-01       Impact factor: 14.808

4.  An evaluation of the double thymidine block for synchronizing mammalian cells at the G1-S border.

Authors:  C J Bostock; D M Prescott; J B Kirkpatrick
Journal:  Exp Cell Res       Date:  1971-09       Impact factor: 3.905

Review 5.  Dysregulation of apoptosis in cancer.

Authors:  J C Reed
Journal:  J Clin Oncol       Date:  1999-09       Impact factor: 44.544

6.  Ultrastructural and immunocytochemical characterization of an immortalized human breast epithelial cell line, MCF-10.

Authors:  L Tait; H D Soule; J Russo
Journal:  Cancer Res       Date:  1990-09-15       Impact factor: 12.701

7.  Activation of the DNA damage checkpoint and genomic instability in human precancerous lesions.

Authors:  Vassilis G Gorgoulis; Leandros-Vassilios F Vassiliou; Panagiotis Karakaidos; Panayotis Zacharatos; Athanassios Kotsinas; Triantafillos Liloglou; Monica Venere; Richard A Ditullio; Nikolaos G Kastrinakis; Brynn Levy; Dimitris Kletsas; Akihiro Yoneta; Meenhard Herlyn; Christos Kittas; Thanos D Halazonetis
Journal:  Nature       Date:  2005-04-14       Impact factor: 49.962

8.  DNA damage response as a candidate anti-cancer barrier in early human tumorigenesis.

Authors:  Jirina Bartkova; Zuzana Horejsí; Karen Koed; Alwin Krämer; Frederic Tort; Karsten Zieger; Per Guldberg; Maxwell Sehested; Jahn M Nesland; Claudia Lukas; Torben Ørntoft; Jiri Lukas; Jiri Bartek
Journal:  Nature       Date:  2005-04-14       Impact factor: 49.962

9.  Circadian control of oscillations in mitochondrial rate-limiting enzymes and nutrient utilization by PERIOD proteins.

Authors:  Adi Neufeld-Cohen; Maria S Robles; Rona Aviram; Gal Manella; Yaarit Adamovich; Benjamin Ladeuix; Dana Nir; Liat Rousso-Noori; Yael Kuperman; Marina Golik; Matthias Mann; Gad Asher
Journal:  Proc Natl Acad Sci U S A       Date:  2016-02-09       Impact factor: 11.205

10.  Cell survival, DNA damage, and oncogenic transformation after a transient and reversible apoptotic response.

Authors:  Ho Lam Tang; Ho Man Tang; Keng Hou Mak; Shaomin Hu; Shan Shan Wang; Kit Man Wong; Chung Sing Timothy Wong; Hoi Yan Wu; Hiu Tung Law; Kan Liu; C Conover Talbot; Wan Keung Lau; Denise J Montell; Ming Chiu Fung
Journal:  Mol Biol Cell       Date:  2012-04-25       Impact factor: 4.138

View more
  13 in total

Review 1.  Novel roles of apoptotic caspases in tumor repopulation, epigenetic reprogramming, carcinogenesis, and beyond.

Authors:  Ruya Zhao; Rayan Kaakati; Andrew K Lee; Xinjian Liu; Fang Li; Chuan-Yuan Li
Journal:  Cancer Metastasis Rev       Date:  2018-09       Impact factor: 9.264

Review 2.  Mitochondria as multifaceted regulators of cell death.

Authors:  Florian J Bock; Stephen W G Tait
Journal:  Nat Rev Mol Cell Biol       Date:  2019-10-21       Impact factor: 94.444

3.  Procaspase-3 Overexpression in Cancer: A Paradoxical Observation with Therapeutic Potential.

Authors:  Matthew W Boudreau; Jessie Peh; Paul J Hergenrother
Journal:  ACS Chem Biol       Date:  2019-07-16       Impact factor: 5.100

4.  Overcoming Resistance to Targeted Anticancer Therapies through Small-Molecule-Mediated MEK Degradation.

Authors:  Jessie Peh; Matthew W Boudreau; Hannah M Smith; Paul J Hergenrother
Journal:  Cell Chem Biol       Date:  2018-06-14       Impact factor: 8.116

Review 5.  Unconventional Ways to Live and Die: Cell Death and Survival in Development, Homeostasis, and Disease.

Authors:  Swapna A Gudipaty; Christopher M Conner; Jody Rosenblatt; Denise J Montell
Journal:  Annu Rev Cell Dev Biol       Date:  2018-08-08       Impact factor: 13.827

Review 6.  A matter of life and death: stem cell survival in tissue regeneration and tumour formation.

Authors:  Despina Soteriou; Yaron Fuchs
Journal:  Nat Rev Cancer       Date:  2018-01-19       Impact factor: 60.716

Review 7.  Paradoxical roles of caspase-3 in regulating cell survival, proliferation, and tumorigenesis.

Authors:  Ebrahim Eskandari; Connie J Eaves
Journal:  J Cell Biol       Date:  2022-05-12       Impact factor: 8.077

8.  Caspase-independent cell death does not elicit a proliferative response in melanoma cancer cells.

Authors:  Ahlima Roumane; Kevin Berthenet; Chaïmaa El Fassi; Gabriel Ichim
Journal:  BMC Cell Biol       Date:  2018-07-04       Impact factor: 4.241

9.  Non-canonical roles of apoptotic and DNA double-strand break repair factors in mediating cellular response to ionizing radiation.

Authors:  Chuan-Yuan Li
Journal:  Int J Radiat Biol       Date:  2021-07-14       Impact factor: 2.694

Review 10.  Mutagenic Consequences of Sublethal Cell Death Signaling.

Authors:  Christine J Hawkins; Mark A Miles
Journal:  Int J Mol Sci       Date:  2021-06-07       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.