Literature DB >> 28690828

Culture and identification of Borrelia spirochetes in human vaginal and seminal secretions.

Marianne J Middelveen1, Jennie Burke2, Eva Sapi3, Cheryl Bandoski3, Katherine R Filush3, Yean Wang2, Agustin Franco2, Arun Timmaraju3, Hilary A Schlinger1, Peter J Mayne1, Raphael B Stricker1.   

Abstract

Background: Recent reports indicate that more than 300,000 cases of Lyme disease are diagnosed yearly in the USA. Preliminary clinical, epidemiological and immunological studies suggest that infection with the Lyme disease spirochete Borrelia burgdorferi (Bb) could be transferred from person to person via intimate human contact without a tick vector. Detecting viable Borrelia spirochetes in vaginal and seminal secretions would provide evidence to support this hypothesis.
Methods: Patients with and without a history of Lyme disease were selected for the study after informed consent was obtained. Serological testing for Bb was performed on all subjects. Semen or vaginal secretions were inoculated into BSK-H medium and cultured for four weeks. Examination of genital cultures and culture concentrates for the presence of spirochetes was performed using light and darkfield microscopy, and spirochete concentrates were subjected to Dieterle silver staining, anti-Bb immunohistochemical staining, molecular hybridization and PCR analysis for further characterization. Immunohistochemical and molecular testing was performed in three independent laboratories. Positive and negative controls were included in all experiments.
Results: Control subjects who were asymptomatic and seronegative for Bb had no detectable spirochetes in genital secretions by PCR analysis. In contrast, spirochetes were observed in cultures of genital secretions from 11 of 13 subjects diagnosed with Lyme disease, and motile spirochetes were detected in genital culture concentrates from 12 of 13 Lyme disease patients using light and darkfield microscopy. Morphological features of spirochetes were confirmed by Dieterle silver staining and immunohistochemical staining of culture concentrates. Molecular hybridization and PCR testing confirmed that the spirochetes isolated from semen and vaginal secretions were strains of Borrelia, and all cultures were negative for treponemal spirochetes. PCR sequencing of cultured spirochetes from three couples having unprotected sex indicated that two couples had identical strains of Bb sensu stricto in their semen and vaginal secretions, while the third couple had identical strains of B. hermsii detected in their genital secretions. Conclusions: The culture of viable Borrelia spirochetes in genital secretions suggests that Lyme disease could be transmitted by intimate contact from person to person.

Entities:  

Keywords:  Borrelia burgdorferi; Lyme borreliosis; chronic Lyme disease; sexual transmission.; spirochetes

Year:  2014        PMID: 28690828      PMCID: PMC5482345          DOI: 10.12688/f1000research.5778.1

Source DB:  PubMed          Journal:  F1000Res        ISSN: 2046-1402


Introduction

Lyme disease is the most common human tick-borne disease in the world today ( Stricker & Johnson, 2014). It is transmitted by Ixodes ticks and is caused by the spirochete Borrelia burgdorferi (Bb) ( Burgdorfer ). Bb is phylogenetically related to the spirochetal agent of syphilis, Treponema pallidum ( Gupta ). T. pallidum is transmitted sexually between partners through contact of mucosal membranes, gaining access to the bloodstream through microabrasions and then disseminating systemically ( Ho & Lukehart, 2011; LaFond & Lukehart, 2006). The close phylogenic relationship of Bb to T. pallidum suggests that this mode of transmission might be possible for Bb. In addition to theoretical considerations, evidence for non-vector transmission of Bb is based on animal models. Proof of contact transmission of Bb – without involvement of an arthropod vector – was established by two studies in mice. Burgess caged uninfected deer mice with experimentally-infected deer mice and demonstrated transmission of Bb by seroconversion of contact-exposed mice from negative to positive and by the isolation of Bb from the blood of one contact-exposed mouse 42 days after initial contact. A study by Wright & Nielsen (1990) demonstrated that white-footed mice were susceptible to oral infection and transmitted infection to each other through direct contact. Furthermore, sexual transmission of Bb has been proposed in a canine model. Bb was transmitted to uninfected female dogs in estrus via semen by natural breeding with male dogs infected experimentally with Bb ( Gustafson, 1993). Successful transmission of infection from male dogs to female dogs was shown by seroconversion of female dogs from negative to positive as well as the detection of Bb DNA in the tissue of fetuses from resulting pregnancies. If contact transmission of Bb occurs in mice and sexual transfer occurs in dogs, it is not unreasonable to postulate similar routes of infection in humans. We sought to determine if viable Borrelia spirochetes could be recovered from human vaginal and seminal secretions, an important first step to investigate whether sexual transmission of these spirochetes among humans is possible.

Materials and methods

1. Research subject selection

Control subjects who were asymptomatic without a history of Lyme disease and patients with a history of Lyme disease were recruited for the study after written informed consent to collect and publish their data was obtained. Approval for sample collection was obtained from the Western Institutional Review Board, Olympia, WA (WIRB ® #20141439). Further approval for sample testing was obtained from the Institutional Review Board of the University of New Haven, West Haven, CT. Serological testing of all participants after coding of their blood samples was performed by IGeneX Reference Laboratories, Palo Alto, CA in a blinded fashion. Patients were considered positive for Lyme disease if they were serologically positive by CDC criteria and/or IGeneX criteria, as previously described ( Engstrom ; Ma ), or if they had musculoskeletal, neurocognitive and/or cardiac symptoms clinically consistent with a Lyme disease diagnosis, as described elsewhere ( Donta, 2014; Smith ). None of the patients were taking antibiotics at the time of testing.

2. Borrelia cultures

Borrelia spirochetes were cultured as previously described ( Bankhead & Chaconas, 2007; Middelveen ; Middelveen ). The inoculum for blood culture was prepared as follows: 10 milliliters of whole blood was collected by sterile venipuncture from each patient. Samples sat at room temperature for 10 to 15 minutes allowing clotting to occur. Red blood cells (RBCs) were separated by low speed centrifugation. Barbour–Stoner–Kelly H (BSK-H) complete medium was used for cultures with the addition of 6% rabbit serum (Sigma Aldrich, #B8291) and the following antibiotics: phosphomycin (0.02 mg/ml), rifampicin (0.05 mg/ml), and amphotericin B (2.5 µg/ml) (Sigma Aldrich). The culture medium described above was inoculated for blood culture with the spun serum containing white blood cells and some RBCs, and for genital culture with either ejaculated semen or vaginal secretions collected by intravaginal swabbing with a sterile cotton-tipped swab. Blood and genital cultures were incubated at 32°C in an Oxoid anaerobic jar (Thermo Scientific) containing an AnaeroGen sachet (Thermo Scientific) to provide an anaerobic environment. Cultures were incubated for four weeks and checked weekly by light and/or darkfield microscopy for visible motile spirochetes. All cultures were processed for microscopic imaging and PCR by centrifuging the culture fluid at 15,000 g for 20 minutes to concentrate spirochetes. The supernatant was discarded and the pellet retained. The pellet samples were coded and processed in a blinded fashion for subsequent experiments.

3. Dieterle silver staining

Dieterle silver staining was performed using two fixation methods. In the standard method, formalin-fixed, paraffin-embedded pellets were sectioned and stained with Dieterle silver stain as previously described ( Aberer & Duray, 1991; Middelveen ). In the newer method, culture fluid was spread and dried on a SuperFrost™ Plus microscope slide (Fisher Scientific) and fixed by incubating the slide in acetone for 10 minutes at -20°C, as previously described ( Sapi ). Dieterle silver staining was performed on the acetone-fixed slide. Positive and negative culture controls were prepared for comparison purposes with plasma from Bb-inoculated mice and uninfected mice followed by Dieterle silver staining using the standard method. Control cultures of mixed Gram-positive and mixed Gram-negative bacteria were also subjected to Dieterle staining. The control processing and staining was performed at McClain Laboratories LLC, Smithtown, NY.

4. Anti-Bb immunostaining

Blood and genital culture pellets from coded patient samples were processed in a blinded fashion for special staining at McClain Laboratories. Formalin-fixed, paraffin-embedded pellets were sectioned and stained with anti-Bb immunostain for spirochete detection, as previously described ( Middelveen ; Middelveen ). In brief, immunostaining was performed using an unconjugated rabbit anti-Bb polyclonal antibody (Abcam ab20950), incubated with an alkaline phosphatase probe (Biocare Medical #UP536L), followed by a chromogen substrate (Biocare Medical #FR805CHC), and counterstained with hematoxylin. Positive and negative culture controls were prepared for comparison purposes with plasma from Bb-inoculated mice and uninfected mice followed by anti-Bb immunostaining. Culture pellets from fungal-infected human skin samples, mixed Gram-positive bacteria and mixed Gram-negative bacteria were also prepared for comparison purposes as negative anti-Bb immunostain controls to exclude cross-reactivity with commonly encountered microorganisms. Staining was titrated to determine optimal antibody dilutions to achieve positive staining of spirochetes while minimizing background staining ( Middelveen ; Middelveen ). Coded samples were processed in a blinded fashion for Bb immunostaining as previously described ( Sapi ). Culture fluid was spread and dried on a SuperFrost™ Plus microscope slide (Fisher Scientific) and fixed by incubating the slide in acetone for 10 minutes at -20°C. Dried, fixed culture fluid was submerged under 100 μl of polyclonal FITC-labeled rabbit anti-Bb antibody (Thermo Scientific #PA-1-73005) diluted 1:50 in 1× PBS buffer with 1% BSA (Sigma Aldrich #A9418). For negative controls, the antibody was omitted and replaced with normal rabbit serum. The slides were then incubated for 1 hour at 37°C in a humidified chamber, washed with 1× PBS for 5 minutes at room temperature, rinsed twice in double distilled water and dried in a laminar air-flow hood for 10 minutes. The slides were mounted with Vectashield mounting medium (Vector Labs) and viewed with fluorescent microscopy at 400× magnification with a Leica DM2500 microscope ( Sapi ).

5. Molecular hybridization using Bb DNA probe

The Bb molecular beacon DNA probe was generously provided by Dr. Alan MacDonald. Probe FlaB (sequence of 23 mer TGGGAGTTTCTGGTAAGATTAAT) was derived from the Bb open reading frame (ORF) BB0147 (approximately 1100 mer) of the flagellin B gene. A nucleotide Basic Local Alignment Search Tool (BLAST) search of the 23 mer sequence disclosed no matches in the human genome or in any other life form other than the Bb sequence of BB0147. Bb detection with the molecular beacon was performed as previously described ( Middelveen ) on coded samples in a blinded fashion using the following protocol: paraffin sections were dewaxed by baking at 60°C, then immersed in serial 100% xylene baths followed by serial immersion through baths of 100% ethanol, 90% ethanol, 80% ethanol, and finally in distilled H 2O, and then air-dried. Fixed sections were immersed in 20 μl of the working DNA beacon solution. The sectioned specimen was covered with a layer of plastic cut from a Ziploc ® freezer bag and was heated at 90°C for 10 minutes to denature DNA and RNA. The heat was first reduced to 80°C for 10 minutes, then the slides were removed from heat and allowed to gradually cool to 24°C. The slides were washed in PBS, covered with 30% glycerol and a glass coverslip, then examined under an EPI Fluor microscope. Staining of test specimens was performed alongside staining of positive and negative controls. The positive control was prepared by embedding a known Bb strain in agarose, formalin-fixing the specimen then blocking in paraffin and staining sections as described above. The specificity of the FlaB probe was validated in studies performed at the University of New Haven (Sapi E., unpublished observation 2014; see Supplemental Figure 1). The FlaB probe hybridized to Bb sensu stricto, yet failed to hybridize with B. afzelii, B. garinii, B. hermsii, Treponema denticola and Escherichia coli. Thus the probe appears to be specific for detection of Bb sensu stricto.
Supplemental Figure 1.

Molecular hybridization of FlaB probe with Borrelia strains, T. denticola and E.coli.

FlaB hybridization is shown in green, while DAPI counterstain of bacterial targets is shown in blue. Note specific hybridization of FlaB probe with B. burgdorferi sensu stricto and lack of hybridization with other Borrelia strains, T. denticola or E.coli. 400× magnification. See Dataset, data file 4.

6. PCR of cultures

Blood and genital culture pellets were first dissolved in 200 μl of Qiagen buffer, then forwarded to the University of New Haven, Department of Biology and Environmental Science, West Haven, CT, USA and Australian Biologics, Sydney, NSW, Australia for PCR detection of Borrelia. All control and patient samples were coded, and PCR testing was performed in a blinded fashion. Detection of Borrelia by PCR was performed as previously described ( Mayne ) using the Eco™ Real-Time PCR system with primers targeted to the genes encoding 16S rRNA ( Borrelia), flA ( T. denticola) and fliG1 ( T. pallidum) and analyzed with the software version 3.0.16.0. DNA was extracted from the dissolved culture pellets using the QIAamp DNA Mini Kit (Qiagen) and 20 μl were used for each reaction. The thermal profile involved incubation for 2 minutes at 50°C, polymerase activation for 10 minutes at 95°C then PCR cycling for 40 cycles of 10 seconds at 95°C dropping to 60°C sustained for 45 seconds. All samples were run in duplicate with positive and negative controls. Positive controls were genomic DNA samples from B. burgdorferi, B. garinii, and B. afzelii (Amplirun DNA/RNA amplification controls, Vircell S.L, Granada, Spain). Negative controls were samples of non-template DNA in molecular-grade water. The magnitude of the PCR signal generated (∆R) for each sample was interpreted as positive or negative compared to positive and negative controls. In samples with sufficient DNA for sequencing, endpoint PCR amplification and Sanger sequencing of the Borrelia gene target from cultures was followed by BLAST comparison with known Borrelia sequences, as previously described ( Mayne ). DNA samples were extracted from blood, vaginal or seminal cultures by lysing cells overnight in 180 µl tissue lysis buffer (Qiagen) and 20 µl Proteinase K (Qiagen) at 56°C in a shaking water bath followed by phenol:chloroform extraction the next day. The DNA was resuspended in 50–100 µl 1×TE buffer. A published TaqMan assay targeting a 139-bp fragment of the gene encoding the Borrelia 16S rRNA was used for the detection of Borrelia in DNA extracted from patient samples ( O’Rourke ). All reactions were carried out at a final volume of 20 µl and consisted of 900 nM of each primer, 200 nM of probe, and 10 µl of 2× TaqMan Universal PCR Master Mix (Applied Biosystems) and 1 nanogram of DNA. Amplifications were carried out on a CFX96 Real-Time System (Bio-Rad), and cycling conditions consisted of 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Fluorescent signals were recorded with CFX96 Real-Time software and Cq threshold was set automatically. The reactions were performed in triplicate with positive and negative controls. Nested PCR primers for the genes encoding the Borrelia 16S rRNA, fla and pyrG loci were used as previously described ( Clark ; Margos ; Sapi ). Reactions were carried out in a final volume of 50 µl using 10 µl template DNA. Final concentrations were 2× Buffer B (Promega), 2 mM MgCl 2, 0.4 mM dNTP mix, 2 µM of each primer, and 2.5 U Taq polymerase (Invitrogen). “Outer” primers were used in the first reaction. “Inner” primers were used for the nested reaction, in which 1 µl of PCR product from the first reaction was used as template for the second. Cycling parameters were as follows: 94°C for 5 minutes followed by 40 cycles of denaturation at 94°C for 1 minute, annealing for 1 minute (temperature based on the primer set used), and extension at 72°C for 1 minute, with a final extension step at 72°C for 5 minutes. PCR products were visualized on 1–2% agarose gels. Sanger sequencing was used for gene analysis, as previously described ( Margos ).

Results

1. Patient data

All patient data are shown in Table 1. The control group included four asymptomatic patients (two males and two females). All four were seronegative for Bb.
Table 1.

Patient Data.

Patients 6 & 7 (*), 8 & 9 (**), 10 & 11 (†), and 12 & 13 (††) are sexual partners. Patients 8 and 11 were seronegative but clinically diagnosed with Lyme disease.

ControlSexAgeSerology
1 (M)male63negative
2 (M)male53negative
3 (F)female58negative
4 (F)female43negative
Patient Sex Age Serology
1 (F)female56equivocal
2 (M)male45positive
3 (M)male35positive
4 (F)female66positive
5 (F)female27positive
6 (M)*male63positive
7 (F)*female53positive
8 (M)**male42negative
9 (F)**female40positive
10 (M)†male56positive
11 (F)†female54negative
12 (M)††male65positive
13 (F)††female54positive

Patient Data.

Patients 6 & 7 (*), 8 & 9 (**), 10 & 11 (†), and 12 & 13 (††) are sexual partners. Patients 8 and 11 were seronegative but clinically diagnosed with Lyme disease. The patient group included six male subjects and seven female subjects, including four pairs of partners (Patients 6 and 7, 8 and 9, 10 and 11, and 12 and 13, respectively). Eleven of the 13 patients selected for the study were serologically positive for Lyme disease. Patient 1 was serologically equivocal and patient 8 was seronegative, although Bb plasmid DNA was detected in whole blood and serum from this patient.

2. Light and darkfield microscopy

Blood cultures from 11 patients were incubated for four weeks and checked weekly for spirochete growth using light and darkfield microscopy. Motile spirochetes and/or motile spherules were observed in the culture fluid from all 11 patients after four weeks ( Table 2). Genital cultures from the four controls were incubated for four weeks. None of the control cultures contained visible spirochetes, and the cultures were sent for PCR testing. Genital cultures from the 11 patients were incubated for four weeks and checked weekly. Motile spirochetes were observed in the culture fluid from all 11 patients after four weeks ( Figure 1A). See Dataset, data file 1.
Table 2.

Microscopy results from fresh blood and genital culture fluid.

See Dataset, data file 1. ND, not done.

Patient numberMicroscopy – fresh blood culture fluidMicroscopy – fresh genital culture fluid
1 (F)motile spherulesvaginal – motile spirochetes
2 (M)NDseminal – ND
3 (M)NDseminal – ND
4 (F)motile spherulesvaginal – motile spherules and spirochetes
5 (F)motile spherulesvaginal – motile spirochetes, some yeast cells
6 (M)motile spirochetes and spherulesseminal – motile spirochetes
7 (F)motile spirochetes and spherulesvaginal – motile spherules and spirochetes
8 (M)motile spherulesseminal – motile spirochetes
9 (F)motile spherulesvaginal – motile spirochetes
10 (M)motile spherulesseminal – motile spherules/ spirochetes
11 (F)motile spherulesvaginal – motile spherules/ spirochetes
12 (M)motile spherulesseminal – motile spherules/ spirochetes
13 (F)motile spherulesvaginal – motile spherules/ spirochetes
Figure 1.

A: Darkfield image of genital culture from Patient 1. Note numerous spirochetes. 400× magnification. See Dataset, data file 1. B: Dieterle silver stain of genital culture from Patient 12. Note darkly staining spirochete. Formalin fixed slide, 400× magnification. See Dataset, data file 2. C: Semen sample from Patient 10 showing B. burgdorferi spirochetes (left) and sperm cell (right). Dieterle silver stain of acetone fixed slide, 1000× magnification. See Dataset, data file 2.

Microscopy results from fresh blood and genital culture fluid.

See Dataset, data file 1. ND, not done. Most genital cultures grew very well and contained abundant spirochetes, but some blood cultures contained few spirochetes. Therefore, to better document the presence of spirochetes in culture, the culture fluid was concentrated into pellets by centrifugation ( Table 3). Spirochetes and/or spherules were detected by sectioning and special staining of paraffin blocked pellets in all the patient blood and genital cultures concentrated by centrifugation, except for blood and genital culture pellets from Patient 1 that were lost during paraffin blocking ( Table 3). Control genital culture samples were sent directly for PCR testing and were not subjected to light and darkfield microscopy.
Table 3.

Microscopy results and Dieterle silver staining of genital culture concentrates.

See Dataset, data file 2.

Patient numberMicroscopy – genital culture pelletDieterle silver stain – genital culture pellet
1 (F)pellet lostpellet lost
2 (M)seminal – spherules/ spirochetesseminal – spherules/ spirochetes
3 (M)seminal – spirochetesseminal – spherules/ spirochetes
4 (F)vaginal – spirochetesvaginal – spherules
5 (F)vaginal – spirochetes, some yeast cellsvaginal – spherules
6 (M)seminal – spirochetesseminal – spherules/ spirochetes
7 (F)vaginal – spirochetesvaginal – spherules/ spirochetes
8 (M)seminal – spirochetesseminal – spherules/ spirochetes
9 (F)vaginal – spherules/ spirochetesvaginal – spherules
10 (M)seminal – spirochetesseminal – spherules/ spirochetes
11 (F)vaginal – spirochetesvaginal – spherules/ spirochetes
12 (M)seminal – spirochetesseminal – spherules/ spirochetes
13 (F)vaginal – spirochetesvaginal – spherules/ spirochetes

Microscopy results and Dieterle silver staining of genital culture concentrates.

See Dataset, data file 2.

3. Immunohistochemistry

The culture samples of uninfected mouse plasma, mixed Gram-positive bacteria and mixed Gram-negative bacteria failed to stain with Dieterle silver stain using the standard staining method. In contrast, the culture sample of Bb-infected mouse plasma stained positive for spirochetes with Dieterle silver stain ( Dataset, data file 2A). Using standard Dieterle staining, spherules and/or spirochetal forms were visible in all patient genital cultures ( Figure 1B). Spirochetes were detected in all patient genital culture pellets except for Patient 1, whose pellet was lost during processing ( Table 3). Using the newer fixation method, spirochetes and sperm cells were visible in semen samples and showed distinct morphology ( Figure 1C). Sperm cells are known to stain with silver stains ( Pathak ; Schmid ). Sperm cells were seen in all semen samples except for Patients 2 and 6, who had vasectomies (data not shown). Since control genital cultures had no visible spirochetes, the control samples were sent directly for PCR testing and were not subjected to Dieterle silver staining. See Dataset, data file 2. A: Darkfield image of genital culture from Patient 1. Note numerous spirochetes. 400× magnification. See Dataset, data file 1. B: Dieterle silver stain of genital culture from Patient 12. Note darkly staining spirochete. Formalin fixed slide, 400× magnification. See Dataset, data file 2. C: Semen sample from Patient 10 showing B. burgdorferi spirochetes (left) and sperm cell (right). Dieterle silver stain of acetone fixed slide, 1000× magnification. See Dataset, data file 2. I. Culture fluid – University of New Haven Genital culture fluid from Patient 1 was fixed on a SuperFrost™ Plus microscope slide and was stained with FITC-labelled polyclonal anti-Bb antibody. Staining was strongly positive, revealing well-defined spirochetes morphologically consistent with Bb ( Figure 2A). The polyclonal antibody was not reactive to T. denticola (data not shown).
Figure 2.

A: B. burgdorferi immunostaining of vaginal culture from Patient 1. Note intensely staining spiral and round forms in culture. 400× magnification. B: B. burgdorferi immunostaining of seminal culture from Patient 6. Note intensely staining spiral and round forms in culture. 400× magnification. See Dataset, data file 3.

II. Culture pellets – McClain laboratories The culture sample of uninfected mouse plasma failed to stain with anti-Bb immunostain. In contrast, the culture sample of Bb-infected mouse plasma stained positive for spirochetes with anti-Bb immunostain ( Dataset, data file 3A). Control fungalinfected human skin cultures, Gram-positive bacterial cultures and Gram-negative bacterial cultures all failed to stain for spirochetes with the anti-Bb immunostain ( Dataset, data file 3A). Anti-Bb immunostaining was positive for all genital cultures except for Patient 1, whose pellet was lost during processing ( Table 4). Immunostaining revealed both spiral and globular Bb forms ( Figure 2B). Since control genital cultures had no visible spirochetes, the control samples were sent directly for PCR testing and were not subjected to immunostaining. See Dataset, data file 3.
Table 4.

Results of B. burgdorferi immunostaining and FlaB molecular hybridization in genital culture concentrates.

See Dataset, data files 3 and 4. ND, not done.

Patient numberBb immunostaining – genital culture pelletFlaB hybridization – genital culture pellet
1 (F)pellet lost*pellet lost
2 (M)seminal – positiveseminal – positive
3 (M)seminal – positiveseminal – positive
4 (F)vaginal – positivevaginal – positive
5 (F)vaginal – positivevaginal – positive
6 (M)seminal – positiveseminal – positive
7 (F)vaginal – positivevaginal – positive
8 (M)seminal – positiveseminal – positive
9 (F)vaginal – positivevaginal – positive
10 (M)seminal – positiveND
11 (F)vaginal – positiveND
12 (M)seminal – positiveND
13 (F)vaginal – positiveND

*Positive Bb immunostaining of genital culture fluid. See Results section.

Results of B. burgdorferi immunostaining and FlaB molecular hybridization in genital culture concentrates.

See Dataset, data files 3 and 4. ND, not done. *Positive Bb immunostaining of genital culture fluid. See Results section. A: B. burgdorferi immunostaining of vaginal culture from Patient 1. Note intensely staining spiral and round forms in culture. 400× magnification. B: B. burgdorferi immunostaining of seminal culture from Patient 6. Note intensely staining spiral and round forms in culture. 400× magnification. See Dataset, data file 3.

4. Molecular hybridization

Hybridization with the Fla B probe was positive for genital culture pellets from Patients 2–9 ( Table 4). The culture pellet from Patient 1 was lost during processing. The molecular probe showed intense staining in vaginal secretions and less intense staining in semen samples ( Figure 3A and 3B). See Dataset, data file 4.
Figure 3.

A: Molecular hybridization of B. burgdorferi-specific FlaB probe with seminal culture from Patient 6. Note intensely staining spiral and round forms in culture. 400× magnification. B: Molecular hybridization of B. burgdorferi-specific FlaB probe with vaginal culture from Patient 7. Note intensely staining spiral and round forms in culture. 400× magnification. See Dataset, data file 4.

A: Molecular hybridization of B. burgdorferi-specific FlaB probe with seminal culture from Patient 6. Note intensely staining spiral and round forms in culture. 400× magnification. B: Molecular hybridization of B. burgdorferi-specific FlaB probe with vaginal culture from Patient 7. Note intensely staining spiral and round forms in culture. 400× magnification. See Dataset, data file 4.

5. PCR testing

Borrelia 16S rRNA sequence was not detected by real-time PCR in any of the control genital culture pellets. In contrast, Borrelia 16S rRNA sequence was detected in genital culture pellets from 11 of 13 patients ( Table 5A). Patient 2 had equivocal test results and Patient 3 had negative test results in seminal cultures. See Dataset, data file 5. Real-time PCR failed to detect treponemal gene sequences in any of the control or patient genital culture pellets. See Dataset, data file 5a. The 16S rRNA isolates from six patients were sequenced and subjected to BLAST analysis (see below).
Table 5.

A: Real time PCR testing of genital culture concentrates performed by Australian Biologics. ND, not done. See Dataset, data file 5. B: Real time and nested PCR testing of blood and genital culture concentrates performed by University of New Haven. See Dataset, data file 7. ND, not done.

Table 5A: Real-time PCR – Australian Biologics. 

Control numberGenital culture – Real- time Borrelia PCRGenital culture – Real- time T. pallidum PCRGenital culture – Real- time T. denticola PCR
1 (M) seminalNegativeNegativeNegative
2 (M) seminalNegativeNegativeNegative
3 (F) vaginalNegativeNegativeNegative
4 (F) vaginalNegativeNegativeNegative
Patient # sample Genital culture – Real- time Borrelia PCR Genital culture – Real- time T. pallidum PCR Genital culture – Real- time T. denticola PCR
1 (F) vaginalpositive (sequenced 99% match B-31)negativenegative
2 (M) seminalequivocalnegativenegative
3 (M) seminalnegativenegativenegative
4 (F) vaginalpositivenegativenegative
5 (F) vaginalpositivenegativenegative
6 (M) seminalpositive (sequenced 100% match B-31)negativenegative
7 (F) vaginalpositive (sequenced 98% match B-31)negativenegative
8 (M) seminalpositivenegativenegative
9 (F) vaginalpositivenegativenegative
10 (M) seminalpositive (sequenced 100% match YOR)NDND
11 (F) vaginalpositive (sequenced 100% match YOR)NDND
12 (M) seminalpositiveNDND
13 (F) vaginalpositive (sequenced 100% match B-31)NDND

A: Real time PCR testing of genital culture concentrates performed by Australian Biologics. ND, not done. See Dataset, data file 5. B: Real time and nested PCR testing of blood and genital culture concentrates performed by University of New Haven. See Dataset, data file 7. ND, not done.

Table 5A: Real-time PCR – Australian Biologics. PCR testing using the TaqMan assay for Borrelia 16S rRNA sequence was positive in blood culture pellets from seven of nine patients tested ( Table 5B). Patients 1 and 5 had negative results in blood culture pellets using the TaqMan assay, but both were positive by nested PCR for the pyrG gene. In addition, nested PCR targeting the fla gene was performed on blood culture pellets from Patients 2, 3 and 4, and nested PCR targeting the 16S rRNA gene was performed on the blood culture pellet from Patient 6. The samples were positive, and sequencing revealed 99–100% homology with Bb sensu stricto strain B-31 ( Table 5B). See Dataset, data file 7.

Table 5B: PCR – University of New Haven. 

Control numberBlood cultureGenital culture – 16S rRNA Taq Man PCRGenital culture – Nested PCR
1 (M)NDNegativepyrG negative, fla negative
2 (M)NDNegativepyrG negative, fla negative
3 (F)NDNegativepyrG negative, fla negative
4 (F)NDNegativepyrG negative, fla negative
Patient number Blood culture – primers with positive detection Genital culture – primers with positive detection
1 (F)pyrG16S rRNA Taq Man
2 (M)16S rRNA Taq Man, fla (sequenced, 100% match B-31)16S rRNA Taq Man
3 (M)16S rRNA Taq Man, fla (sequenced, 100% match B-31)16S rRNA Taq Man, fla, 16S rRNA (sequenced, 99% match B-31)
4 (F)16S rRNA Taq Man, fla (sequenced, 99% match B-31)16S rRNA Taq Man
5 (F)pyrG16S rRNA Taq Man
6 (M)16S rRNA Taq Man 16S rRNA (sequenced, 99% match B31)16S rRNA
7 (F)16S rRNA Taq Man, pyrG16S rRNA Taq Man, 16S rRNA, fla
8 (M)16S rRNA Taq Man16S rRNA Taq Man
9 (F)16S rRNA Taq Man16S rRNA Taq Man
10 (M)NDND
11 (F)NDND
12 (M)NDpyrG (sequenced, 99% match B-31)
13 (F)NDND
Table 5B: PCR – University of New Haven. PCR testing using the TaqMan assay for Borrelia 16S rRNA sequence was negative in all four control genital culture pellets, and nested PCR targeting the pyrG and fla genes was negative in all four control samples, confirming the results of the TaqMan assay ( Table 5B). In contrast, eight of nine patients were positive for TaqMan 16S rRNA sequence in the genital culture pellets. Patient 6 was negative using the TaqMan assay for 16S rRNA sequence but positive using nested PCR targeting a different portion of the 16S rRNA gene ( Table 5B). Nested PCR targeting the fla gene (Patient 3) and the 16S rRNA gene (Patients 3 and 7) was also performed on genital culture pellets and was positive in those patients, confirming the results of the TaqMan assay. Patient 12 had positive PCR targeting the pyrG gene with confirmatory sequencing (see below).

6. Sequencing of Borrelia detected in blood and genital cultures

PCR isolates of the vaginal culture from Patient 1 (Australian Biologics) and the seminal culture from Patient 3 (University of New Haven) were subjected to Sanger sequencing and BLAST analysis and showed 97–99% homology with Bb sensu stricto strain B-31 ( Table 5A and Table 5B). See Datasets, data files 6 and 7. PCR isolates of blood cultures from Patients 2, 3, 4 and 6 were subjected to Sanger sequencing and BLAST analysis at University of New Haven and showed 99–100% homology with Bb sensu stricto strain B-31 ( Table 5B). See Dataset, data file 7. PCR isolates of genital cultures from three couples having unprotected sex (Patients 6–7, 10–11 and 12–13) were subjected to Sanger sequencing and BLAST analysis. Patients 6, 7, 10, 11 and 13 had sequencing done at Australian Biologics, while Patient 12 had sequencing done at University of New Haven. Sequencing revealed that the first and third couples had Borrelia strains that matched Bb sensu stricto strain B-31 ( Table 6). In contrast, the second couple had PCR sequences that matched B. hermsii strain YOR. Thus the Borrelia strain shared by this couple differed significantly from the strains identified in the other couples. See Dataset, data file 6.
Table 6.

Comparison of seminal and vaginal Borrelia gene sequences using BLAST analysis.

Sequencing for Patients 6, 7, 10, 11 and 13 was done at Australian Biologics. Sequencing for Patient 12 was done at University of New Haven. See Dataset, data file 6.

PatientDescriptionMaximum ScoreTotal ScoreQuery CoverE ValueReference Strain Match
6 (M)Bb sensu stricto (B31)23023084%3e-57100%
7 (F)Bb sensu stricto (B31)22422483%2e-5598%
10 (M)B. hermsii (YOR)32.2122975%1.5100%
11 (F)B. hermsii (YOR)30.259984%2.1100%
12 (M)Bb sensu stricto (B31)1218121895%1e-6399%
13 (F)Bb sensu stricto (B31)97.6488087%1e-20100%

Comparison of seminal and vaginal Borrelia gene sequences using BLAST analysis.

Sequencing for Patients 6, 7, 10, 11 and 13 was done at Australian Biologics. Sequencing for Patient 12 was done at University of New Haven. See Dataset, data file 6. The dataset contains data files 1, 2, 2a, 3, 3a, 4, 5, 5a, 6 and 7. Detailed legends for each files can be found in the text file provided. Click here for additional data file.

Discussion

In this study using standard and published culture, immunohistochemical, molecular hybridization and PCR techniques, we have shown that Borrelia strains are present in semen and vaginal secretions from patients with Lyme disease. Simultaneous testing for treponemal spirochetes was negative in genital secretions of all Lyme disease patients, confirming the specificity of Borrelia detection in these patients. Furthermore we have shown that couples having unprotected sex have virtually identical strains of Borrelia in their genital secretions, suggesting that Borrelia spirochetes might be transmitted from person to person without a tick vector. As expected, PCR sequencing of cultured Borrelia from semen and vaginal secretions yielded primarily Bb sensu stricto strains, reflecting the North American origin of our study subjects. In addition, PCR sequencing of genital secretions from one couple yielded identical strains of Bb sensu stricto strains in two different laboratories. However, we were surprised to find one couple with identical strains of B. hermsii in their genital secretions. The presence of a distinct Borrelia strain in semen and vaginal secretions from a sexually active couple that differs from strains found in other couples supports the premise of Borrelia transmission via shared genital secretions. The finding is analogous to sharing distinct human immunodeficiency virus (HIV) strains, which is well recognized in sexual partners with HIV/AIDS ( Shaw & Hunter, 2012). Animal models have provided compelling evidence for contact transmission of Bb without a tick vector in mice, ducks, cats and dogs ( Burgess ; Burgess & Patrican, 1987; Burgess, 1989; Burgess, 1992; Wright & Neilsen, 1990). Bb has been shown to survive in stored semen from dogs, rams and bulls ( Kumi-Diaka & Harris, 1995). Furthermore, seminal transmission of Bb has been noted in dogs, as described above ( Gustafson, 1993). In contrast, contact transmission of Bb could not be demonstrated in Lewis rats and Syrian golden hamsters ( Moody & Barthold, 1991; Woodrum & Oliver, 1999). Technical limitations in the study of these highly inbred rodents including limited contact between animals and failure to perform molecular testing may have contributed to the negative results. While it is not possible to perform controlled sexual transmission studies of Borrelia in humans, several investigators have speculated that this mode of transmission is possible ( Bach, 2001; Harvey & Salvato, 2003; Stricker ). The suggestion that Bb could be transmitted sexually was initially proposed by Bach in 2001. He observed that sexually active patients had a marked propensity for antibiotic failure and speculated that re-infection occurred by intimate person-to-person contact. Bb DNA was detected by PCR technology in human breast milk, umbilical cord blood, semen and vaginal secretions taken from patients presenting at his practice ( Bach, 2001). The study of a group of chronically ill Bb-seropositive and PCR-positive patients in Houston, Texas – a non-endemic area – provided epidemiological evidence that Lyme disease could spread in the absence of a suitable vector ( Harvey & Salvato, 2003). In the absence of infected ticks, intimate person-to-person transfer was implicated as the probable means of transmission ( Harvey & Salvato, 2003). A study by Stricker et al. provided clinical and immunological evidence for Bb transmission from partner to partner. In heterosexual seropositive couples with Lyme disease in which only one partner had a documented tick bite, the partner with the documented tick bite tended to have more severe clinical manifestations of the disease and a lower CD57 natural killer (NK) cell level ( Stricker ). This difference in clinical severity and CD57 NK cell level was not noted in seropositive couples diagnosed with Lyme disease in which both partners had a documented history of tick bite ( Stricker ). Sexual transfer of Borrelia infection through mucosal contact therefore seems possible in humans. The fact that we have been able to culture motile, actively reproducing, viable spirochetes from human genital secretions supports this hypothesis. Recent reports from the Centers for Disease Control and Prevention (CDC) indicate that more than 300,000 cases of Lyme disease are diagnosed yearly in the USA ( CDC, 2013). Sexual transmission of Borrelia may partly explain the large number of annual cases that is almost two times higher than breast cancer and six times higher that HIV/AIDS ( Stricker & Johnson, 2014). Recognition of possible sexual transmission of Borrelia in both humans and animals is fundamentally important because of the epidemiological implications. If sexual transmission of Borrelia occurs in both animals and humans, this mode of transmission is a possible means of introducing Borrelia infection into areas not considered endemic and of introducing the spirochete to new reservoirs. Borrelia would also join the list of other spirochetes that are either proven or postulated to be sexually transmitted, including the spirochetal agents of syphilis and leptospirosis ( Harrison & Fitzgerald, 1988; Maatouk & Moutran, 2014). Of note, sexual transmission of other tickborne agents in animals and humans has also been proven or postulated ( Facco ; Kruszewska & Tylewska-Wierzbanowska, 1993; Metcalf, 2001; Miceli ; Milazzo ). The number of spirochetes needed to infect an animal or human varies according to strain-specific biological and transmission factors. In mouse studies of experimental Borrelia infection, the 50% infectious dose was 18 spirochetes with tick salivary gland extract and 251 spirochetes with tick midgut extract ( Cook, 2014). Transmission studies of syphilis using “human volunteers” found that the 50% infectious dose was approximately 57 organisms ( LaFond & Lukehart, 2006). At present, the spirochetal load in genital secretions from Lyme disease patients is unknown, but it appears that genital infection could be induced by a relatively small number of organisms based on the studies outlined above. It is known that seminal plasma inhibits the immune response to Gram-negative pathogens ( Brooks ), while the female genital tract induces immune factors that may be conducive to spirochete survival ( Clark & Schust, 2013; Wira ). The role of the male and female genital tracts in tolerance and propagation of Borrelia infection merits further study. Lyme disease diagnosis is based largely upon serological testing using CDC-sanctioned two-tier surveillance criteria supported by FDA-approved commercial test kits. While most patients in this study did have positive serological test results for Lyme borreliosis, some were considered serologically negative, and the majority of our study subjects did not meet the positive standard as defined by the CDC surveillance criteria ( CDC, 2014a). We were able to detect Borrelia spirochetes in the blood and/or genital secretions of all patients who were clinically diagnosed with Lyme disease, demonstrating that the CDC surveillance protocol is inadequate diagnostically. Inadequate diagnostic methodology undoubtedly results in under-reporting of Lyme disease, and at least one group has speculated that this substandard methodology is considered acceptable because Borrelia is not sexually transmitted ( Lange & Sayyedi, 2002). In addition, if Borrelia spirochetes were transmitted sexually, then patients with false-negative results may unknowingly spread the infection to sexual partners. The 2011 CDC case definition for Lyme disease states that a positive Bb culture confirms the diagnosis of the disease ( CDC, 2014b). Although culture of Borrelia genital isolates may be a useful diagnostic laboratory methodology in the future, detecting and characterizing cultured Borrelia isolates is not straightforward, and both false-positive and false-negative results could occur. In our experience, human clinical isolates from genital secretions frequently propagate prolifically in culture, but on occasion they do not. In such instances, the culture must be concentrated and specific staining should be conducted to ascertain the presence of spirochetes. Once detected, spirochetes must be characterized genetically for specific identification. PCR is currently the most reliable means for correctly identifying cultured isolates, but even this methodology has drawbacks and limitations ( Lange & Sayyedi, 2002; Nolte, 2012). There are currently no standardized FDA-approved PCR protocols or kits available for Bb detection, so commercial PCR testing constitutes an array of “home brew” assays using different methodologies such as real-time PCR and nested PCR, with various primers targeting different genes, yielding wide differences in sensitivity and specificity ( Nolte, 2012; Schmidt, 1997; Yang ). False negatives can result because primers may be strain-specific and may not detect all Borrelia genotypes, and fluids such as blood, semen and vaginal secretions may contain substances inhibitory to the PCR process ( Lange & Sayyedi, 2002; Nolte, 2012; Yang ). The potential for false-positive PCR testing may also arise if there is DNA contamination in the laboratory, and appropriate positive and negative controls must be included in the assay ( Lange & Sayyedi, 2002; Nolte, 2012). We experienced differences in primer specificity in our clinical isolates and also found that inhibition occurred, particularly in semen cultures. Another complicating factor in Borrelia isolation is the morphological variation of the spirochete, which includes spherical, granular or cystic forms. Morphological variants of Bb, some of which are not culturable, are well documented in the medical literature ( Barthold ; Hodzic ; Kurtti ; MacDonald, 2013; Meriläinen ; Mursic ). These variants may play a role in infection, enabling Bb and other pathogenic spirochetes to evade the immune system ( Döpfer ; Menten-Dedoyart ; Mursic ). Limited Bb growth and non-spiral morphology are thought to be induced by unfavorable environmental conditions ( Brorson ), and these features appear to be consistent with our observations. We found that Borrelia growth was more vigorous with more long slender morphological variants in cultures of genital secretions compared to cultures of blood, and we speculate that the human circulatory system is a more hostile environment for Borrelia than the human reproductive system. The possibility of Borrelia contamination yielding false-positive PCR results in blood cultures from Lyme disease patients has been suggested ( Sapi ). This possibility is highly unlikely in our cultures of genital secretions for the following reasons: first, no reference strains of Borrelia that could cause contamination were present in the laboratory where cultures were performed. Second, the sequenced Borrelia strains were not 100% identical to the reference strains of Borrelia, implying that they were distinct from potentially contaminating reference strains. Third, testing was performed in three independent laboratories, and it would be highly unlikely to have contamination in all three locations. Fourth, negative controls were run with the molecular samples in the three independent laboratories, and the controls were consistently negative. Fifth, as noted above, one couple had a distinct strain of Borrelia in their genital secretions, so that selective contamination with two different reference strains would have had to occur in the PCR samples. Thus laboratory contamination yielding false-positive PCR results for Borrelia strains in the genital secretions is highly unlikely. Several questions have been raised about the likelihood of Borrelia sexual transmission ( Craig, 2014). First, according to the CDC surveillance system Lyme disease occurs most commonly in children and older adults. However, the CDC surveillance system only captures about 10% of Lyme disease patients, and the other 90% may have a different demographic distribution consistent with sexual transmission, as shown in a recent study from Australia ( Mayne, 2015). A study from military treatment facilities in the USA “unexpectedly” found no association between the incidence of Lyme disease and the prevalence of infected ticks, and the rate of Lyme disease was 2.6 times higher in officers than enlisted men ( Rossi ). Second, while sexually transmitted diseases like herpes simplex virus (HSV) and gonorrhea show an urban predominance, Lyme disease has a more rural distribution ( Craig, 2014). However, Lyme disease is acquired in more ways than HSV and gonorrhea, and the rate of sexual transmission is unknown at present. Thus the epidemiology of Lyme disease may differ from other sexually transmitted diseases based on these undefined variables. Third, the transmission of HIV can be traced from one sex partner to another using HIV strain typing. Based on our study, a similar transmission pattern using Borrelia strain typing may be seen once larger studies are performed among couples having unprotected sex. In summary, sexual transmission of Borrelia is plausible in light of our limited knowledge about the risk of acquiring Lyme disease. In conclusion, we have shown that Borrelia spirochetes are present in semen and vaginal secretions of patients with Lyme disease. Furthermore, virtually identical strains of Borrelia are present in couples having unprotected sex, suggesting that transmission via intimate contact without a tick vector may occur. The epidemiology and clinical risk of Borrelia sexual transmission remain to be determined.

Data availability

The data referenced by this article are under copyright with the following copyright statement: Copyright: © 2015 Middelveen MJ et al. Data associated with the article are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). F1000Research: Dataset 1. Updated data of Borrelia spirochetes in human vaginal and seminal secretions., 10.5256/f1000research.5778.d46058 ( Middelveen ).

Consent

Written informed consent to publish clinical details and study results was obtained from each participant. The third version of the paper from Middelveen et al., "Culture and identification of Borrelia spirochetes in human vaginal and seminal secretions" represents a well designed and nicely executed study strongly supported by multiple results that were obtained by three independent laboratories. The impact of the presented data is significant as it highlights the alternative way of the distribution of the causative agent of Lyme disease, Borrelia burgdorferi sensu stricto spirochetes, rather than the traditionally accepted vector-borne way. The well balanced study presents the cultivation of live and replicating spirochetes from genital secretions, confirming the possibility of person-to-person transmission of Lyme disease spirochetes. Supported by multiple techniques, the obtained results are clear, consistent and confirming. The authors do not bring the conclusion or speculate that spirochetes transmitted from person-to-person might trigger Lyme disease in humans, as this postulation needs to be deeply studied. However, confirmation of the fact that live Borrelia are present in semen and vaginal secretions of patients with Lyme disease and can be cultured in active and replicating form from them is the first and significant step in analysis of person-to-person transmission of the causative agent of Lyme disease. This may be one of the reasonable explanations of the increased numbers of confirmed cases of Lyme disease worldwide, in addition to the others that are not discovered yet. We have read this submission. We believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. My concerns have not necessarily been allayed by the authors' rebuttal. Please be aware that I have invested as much time as I can in the review process for this article, and will be unable to contribute further. I have read this submission. I believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. This current version of the paper is one which contributes significantly to the field. I re-affirm my original approval of what I consider is a well executed and well presented study and is worthy of indexation for rational scrutiny and further investigations by the wider medical and scientific communities. I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. The design of these experiments to test the hypothesis that viable spirochetes exist in genital secretions is appropriate. However, the implementation of the experiments, presentation, and interpretation of data is questionable. Culture of B. burgdorferi from secretions: These are not sterile sources, yet there is no mention of contamination with other microbes. The authors should show (supplemental data) staining of secretions and cultures from healthy controls. One would expect some level of background staining. Images shown in Figures 1, 2 and 3 are not specifically detecting spirochetes and are questionable without appropriate controls. The darkfield and silver stain are of very little use, given that “pseudospirochetes” of flagellar bundles can forms in body fluid cultures. No positive or negative controls are shown. The straight morphology and varying lengths of that depicted in Figure 1A (and in all of the dataset 1 darkfield samples provided) are inconsistent with B. burgdorferi morphology. Specific staining shown in Fig 2A is more consistent with spirochete morphology and a legitimate detection method (albeit a low quality image). However, the authors indicate in the Methods section that DAPI counterstain was used but no blue staining is apparent. Does this mean that there were no other sources of DNA in the culture (bacteria or cells)? Clearly, there is ample contamination with other bacteria (seen in darkfield images of dataset 1). Concerning immunostaining with the FlaB probe, the methods are not described and no positive or negative control samples are shown. With the exception of Patient 10, none of the silver stained samples resemble spirochetes. This reviewer encourages readers to examine the images provided in supplementary datasets. Concerning the molecular detection, the sequence for the 23mer FlaB DNA probe should be provided, as should evidence of validation with controls. If multiple genes were amplified from cultures, then those sequences should also be provided. Assuming there was a positive control, 98-100% homology cannot distinguish between a legitimate infection and PCR contamination (with introduction of errors from PCR).  Sequences from patients 10 and 11 as B. hermsii is misleading, given that they are short, disconnected regions of homology. Given that 16s was used, the entire product should line up. BLAST input was not provided for Patient 12 and the region of homology for patient 13 was only 50 bp (where for patient 1, 6 and 7 it was ~120 bp). In conclusion, this manuscript would be made much clearer if all of the control (positive and negative) data were also included. Validation of the assays employed is unapparent. The paper cited from the Australian Biologics assay indicated PCR detection of Borrelia in patients at a much higher frequency than IgG or IgM immunoblot detection of exposure. This is inconsistent with multiple reports. Furthermore, the PCR primers are listed as “proprietary” so an assessment of specificity cannot be made. Sending blinded samples to an impartial 3rd party for testing using validated assays is recommended. I have read this submission. I believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. The design of these experiments to test the hypothesis that viable spirochetes exist in genital secretions is appropriate. However, the implementation of the experiments, presentation, and interpretation of data is questionable. Culture of B. burgdorferi from secretions: These are not sterile sources, yet there is no mention of contamination with other microbes. The authors should show (supplemental data) staining of secretions and cultures from healthy controls. One would expect some level of background staining. We acknowledge that these are not sterile sources. Three antibiotics were used to limit the growth of normal flora. Although Borrelia cultures may contain other flora, obtaining pure isolates was not the purpose of the study. The negative controls from healthy subjects did not show PCR evidence of spirochetal infection, as seen in Table 5 and Dataset 7. Real-time PCR failed to show spirochetal infection in genital cultures from negative controls (Table 5A), and both TaqMan PCR and nested PCR using a variety of targets failed to show Borrelia infection in genital cultures from negative controls (Table 5B). To address the referee’s concern about control silver staining and immunostaining, however, we have performed additional control silver stains and immunostains using a culture from uninfected mouse plasma, which showed no staining for Borrelia with either technique. Cultures of fungal-infected human skin, mixed gram positive strep and staph (from dairy mastitis cultures) and mixed gram negative fecal coliforms (from canine feces cultured on McConkey Agar) also failed to show significant immunostaining for Borrelia. In contrast, plasma culture from a mouse infected with Borrelia spirochetes processed at McClain Laboratory showed positive silver staining and immunostaining. We have included this information in Datasets 2A and 3A and added a description in the Results section on Pages 8 and 9. Images shown in Figures 1, 2 and 3 are not specifically detecting spirochetes and are questionable without appropriate controls. The darkfield and silver stain are of very little use, given that “pseudospirochetes” of flagellar bundles can forms in body fluid cultures. No positive or negative controls are shown. Figure 1 shows darkfield imaging and silver staining indicating that cultures are living and viable. The Figure shows typical spirochetal morphology, and these viable spirochetes were confirmed to be Borrelia by PCR, as shown in Table 5 and Dataset 7. Figure 2 shows immunostaining that is specific for Borrelia and correlates with positive PCR detection in these samples. Figure 3 shows molecular hybridization with the FlaB probe that is highly specific for Borrelia. The positive and negative controls for this experiment are shown in Supplemental Figure 1. Although each figure by itself might not indicate the presence of Borrelia, the combination of darkfield imaging, silver staining, immunostaining, PCR testing using a range of targets and molecular hybridization provides strong evidence for viable Borrelia in these genital cultures, as stated repeatedly in the article. The straight morphology and varying lengths of that depicted in Figure 1A (and in all of the dataset 1 darkfield samples provided) are inconsistent with B. burgdorferi morphology. We respectfully disagree with the referee, and we have included a discussion of morphological variation and pleomorphism in Borrelia cultures in the Discussion section on Page 16 with multiple references. Furthermore, to our knowledge nobody has ever studied Borrelia in seminal or vaginal cultures, so nobody knows what morphological variants would be present. Since Borrelia morphological variation and pleomorphism is acknowledged in the medical literature, visual identification alone is not reliable and that is why we used silver staining, immunostaining and molecular detection to characterize the isolates as Borrelia. Specific staining shown in Fig 2A is more consistent with spirochete morphology and a legitimate detection method (albeit a low quality image). However, the authors indicate in the Methods section that DAPI counterstain was used but no blue staining is apparent. Does this mean that there were no other sources of DNA in the culture (bacteria or cells)? Clearly, there is ample contamination with other bacteria (seen in darkfield images of dataset 1). We agree with the referee that immunostaining in Figure 2A is consistent with spirochete morphology. The DAPI counterstain was only used in the FlaB probe validation study, as shown in Supplemental Figure 1. We have modified the Methods description to reflect this fact. Concerning immunostaining with the FlaB probe, the methods are not described and no positive or negative control samples are shown. Wth the exception of Patient 10, none of the silver stained samples resemble spirochetes. The FlaB probe is a DNA probe, not an immunostain. This DNA hybridization technique is described in detail in Methods section 5 (Page 4) with appropriate references, and positive and negative controls for the technique are shown in Supplemental Figure 1. Again, we have included references to studies showing morphological variation and pleomorphism in Borrelia cultures in the Discussion section on Page 16.  As there are problems with specificity of visual identification using silver staining, we used this method to provide corroborative evidence only. It is the collective evidence -- including darkfield imaging, immunostaining and molecular detection of borrelial DNA that is important. We used a broad approach with various methods so that there was no reliance on any single methodology, as stated repeatedly in the article. This reviewer encourages readers to examine the images provided in supplementary datasets. We encourage readers to do the same. The Dataset images support the findings described in the article. Concerning the molecular detection, the sequence for the 23mer FlaB DNA probe should be provided, as should evidence of validation with controls. We have provided the FlaB probe sequence in Methods section 5 (Page 4), courtesy of Dr. Alan MacDonald. Again, this is a molecular technique intended to provide corroborative evidence -- along with all the other techniques. A detailed vaildation study was provided in Supplemental Figure 1 clearly showing that the molecular probe was specific for Bb sensu stricto. If multiple genes were amplified from cultures, then those sequences should also be provided. Assuming there was a positive control, 98-100% homology cannot distinguish between a legitimate infection and PCR contamination (with introduction of errors from PCR). The gene sequences are described in Table 6, and BLAST analyses are shown in Dataset 6. The argument against PCR contamination is presented in the Discussion section on Page 17. Sequences from patients 10 and 11 as B. hermsii is misleading, given that they are short, disconnected regions of homology. Given that 16s was used, the entire product should line up. BLAST input was not provided for Patient 12 and the region of homology for patient 13 was only 50 bp (where for patient 1, 6 and 7 it was ~120 bp). The B. hermsii sequences are short, but they were the closest match in those samples. The referee ignores the fact that this couple was the only one with a distinct Borrelia sequence that was detected in both sexual partners and not in any other individual or couple in our small study. The BLAST analysis for Patient 12 was performed using a different program, and labeling for the sequence input has been provided. For Patient 13, the region of homology was short, but it was virtually identical to the sequence in her sexual partner (Patient 12), as shown in Table 6. In conclusion, this manuscript would be made much clearer if all of the control (positive and negative) data were also included. Validation of the assays employed is unapparent. The paper cited from the Australian Biologics assay indicated PCR detection of Borrelia in patients at a much higher frequency than IgG or IgM immunoblot detection of exposure. This is inconsistent with multiple reports. Furthermore, the PCR primers are listed as “proprietary” so an assessment of specificity cannot be made. Sending blinded samples to an impartial 3rd party for testing using validated assays is recommended. As outlined above, we have included control data for the PCR and molecular hybridization testing, which is the “acid test” for the presence of Borrelia in genital cultures. The assays described in our study are internally consistent since the darkfield imaging, silver staining and immunostaining have been validated by the PCR and molecular hybridization procedures. In contrast to the referee’s comment, there is ample evidence for “seronegative” Lyme disease, and we have included a discussion of this entity on Page 16 with appropriate references. We used two independent laboratories for PCR testing and molecular hybridization studies, and the results using a range of primers are consistent between the two laboratories. We intend to send blinded samples to independent laboratories for confirmation of our results. In light of our detailed responses to the referee comments, we believe that this preliminary study merits reconsideration for approval by the referee. Middelveen et al. have, produced a well written and informative account of their findings on the “Culture and identification of Borrelia spirochetes in human vaginal and seminal secretions” from subjects diagnosed as Lyme Disease patients by serological and clinical parameters compared to control individuals who were asymptomatic and serologically negative for the Borrelia burgodorfei. Of most interest is their report of the PCR sequencing of cultured spirochetes from three couples having unprotected sex which indicated that two couples had identical strains of Bb sensu stricto in their semen and vaginal secretions, while the third couple had identical strains of B. hermsii. I believe the study is worthy of acceptance and approve it for the following reasons: The rationale and hypothesis behind the investigation is clearly stated. The work has been carefully planned, employing an array of pertinent experimental approaches: routine light microscopy, histological silver staining and immunohistological staining methodology, DNA probe analysis and PCR to demonstrate the presence of Borrelia spirochetes in cultures prepared from semen or vaginal secretions from Lyme disease subjects serologically tested for Bb, whilst samples from Bb negative control subjects did not yield spirochetes. The study is well executed, with samples analysed following blind coding, and techniques performed in a number of independent laboratories. The data sets, tables and figures are presented in a detailed and informative manner. The authors demonstrate an authoritative awareness of previous work in the area, citing relevant animal studies which had investigated the possible sexual transmission of Borrelia, and give a plausible explanation for the discrepancies between the findings by Guftafson in dogs and those of Moody and Woodrun in inbred rodent models. In this second version of the article, the authors have taken pains to address the main concerns of the reviewer Donta, and also answered the comments raised by Baker and others, to version one of the manuscript. In their replies, Middelveen and Stricker have, in my opinion, more than allayed the criticisms with regard to technical details, and also those concerning aspects such as CDC surveillance criteria and of the unknown spirochetal load. The conclusions drawn, that the culture of viable Borrelia spirochetes in human genital secretions suggests that Lyme disease could be transmitted by intimate contact from person to person, are justified and of significance. Their findings to date warrant a larger study and further attention by the scientific and medical community. I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. There are a number of issues that mitigate against the authors' conclusion that Lyme disease can be transmitted sexually. While there are conflicting reports from animal studies that there can be transmission by contact between animals and other studies that appear to better controlled that do not provide such evidence, there is no obvious epidemiological evidence in humans that this is a likely possibility. Apart from the sociologic implications of claiming that intimate or even casual transmission is possible, there needs to be more compelling evidence that this might be the case than is offered in this report. Specific issues in this report: No evidence that samples were blinded. The numbers of patients were too small from which to draw meaningful conclusions. The actual serologic data on patients should be presented in order to be more properly assessed. PCR-DNA analyses should have been done on the original specimens; again in a blinded fashion, and weekly during the culture period. And, as PCR-DNA testing is much more sensitive than cultures, without this information, the validity of the presented information remains in question. Concurrent samples of other body fluids, i.e. blood, saliva, should have been included. Even if presuming the presence of the Lyme borrelia in vaginal secretions or semen, the numbers present would have not been sufficient to cause any transmission of infection, as, with any infectious process, there needs to be a critical inoculum to establish infection. This is the case with transmission by ticks. Borrelia may be spirochetes as are Treponemes and Leptospira, but the transmission of the latter are obviously through body fluids, and not by tick or other vectors. It is not clear that infections transmitted by ticks are also transmitted by intimate or casual contact. If it was true that 8/11 samples were positive, one would expect a much more obvious clinical picture of transmission by intimate or casual contact, which is not the case. PCR-DNA analyses and long-term cultures can be subject to contamination, making the data here more difficult to interpret. I have read this submission. I believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. Co-written with Marianne J. Middelveen We hope that the referee will change his opinion after reading the revised manuscript and our responses to his comments. There are a number of issues that mitigate against the authors' conclusion that Lyme disease can be transmitted sexually. We did not conclude that “Lyme disease can be transmitted sexually”. Based on preliminary editorial comments, we were careful to state that our microscopy, immunochemistry, molecular hybridization and PCR analysis showing live, culturable Borrelia in semen and vaginal secretions suggests that these spirochetes could be transmitted in that manner. Our study does not prove this form of transmission, and we do not make this claim anywhere in the text. While there are conflicting reports from animal studies that there can be transmission by contact between animals and other studies that appear to better controlled that do not provide such evidence, there is no obvious epidemiological evidence in humans that this is a likely possibility. Apart from the sociologic implications of claiming that intimate or even casual transmission is possible, there needs to be more compelling evidence that this might be the case than is offered in this report. The statement that “better controlled” studies do not provide support for contact transmission of Borrelia in animals is contrary to the examples in mice and dogs described in the Introduction and Discussion sections of our article. We have pointed out that the two studies on highly inbred rodents that allegedly showed lack of such transmission did not use PCR techniques and therefore may have missed this transmission. The fact that the CDC now admits to more than 300,000 new cases of Lyme disease each year in the USA (and perhaps as many as one million new cases, as outlined in Stricker & Johnson, 2014) is suggestive that other forms of transmission occur, as noted in the Discussion section on page 10. 1. No evidence that samples were blinded. In response to the referee’s comment, we have noted that the laboratory testing was performed on coded samples in a blinded fashion. This has been noted in the Abstract and reiterated throughout the Methods section. 2. The numbers of patients were too small from which to draw meaningful conclusions. The “ meaningful conclusions” are that 
microscopy, immunochemistry, molecular hybridization and PCR analysis demonstrates live, culturable Borrelia in semen and vaginal secretions from Lyme disease patients. Although the numbers are relatively small, we feel that our detailed study supports this conclusion. 3.The actual serologic data on patients should be presented in order to be more properly assessed. We can include the actual serologic data as an original Dataset, but we don’t see how that would alter the experimental findings in our study. The serologic data is presented in Table 1 and the Results section. In response to the referee’s comment, we have added more detail about the serologic and diagnostic criteria in the Methods section on page 4, with supporting references. 4. PCR-DNA analyses should have been done on the original specimens; again in a blinded fashion, and weekly during the culture period. And, as PCR-DNA testing is much more sensitive than cultures, without this information, the validity of the presented information remains in question. PCR-DNA analysis was done on the “ original specimens” in a blinded fashion 
in conjunction with the microscopy, immunochemistry and molecular hybridization analysis. Repeated testing at weekly or other intervals is beyond the scope of this pilot study, and this type of testing should certainly be explored in future Lyme disease studies. 5. Concurrent samples of other body fluids, i.e. blood, saliva, should have been included. As shown in Table 5, we did do PCR testing on concurrent blood samples in some patients. Saliva testing for Borrelia would have been of interest, but this form of Borrelia testing requires further investigation and is beyond the scope of our study. 6. Even if presuming the presence of the Lyme borrelia in vaginal secretions or semen, the numbers present would have not been sufficient to cause any transmission of infection, as, with any infectious process, there needs to be a critical inoculum to establish infection. This is the case with transmission by ticks. In response to the referee’s comment, we have researched the number of spirochetes necessary for transmission of B. burgdorferi infection in mice and T. palliduminfection in humans. The results show that a very small number of spirochetes (as little as 18 organisms) are required for transmission of infection, and we have included this information in the Discussion on page 11. We have also noted that seminal plasma and the female genital tract may provide a relatively permissive environment for spirochetes compared to blood, skin and other immune sites, making transmission theoretically easier via the genital route. Borrelia may be spirochetes as are Treponemes and Leptospira, but the transmission of the latter are obviously through body fluids, and not by tick or other vectors. It is not clear that infections transmitted by ticks are also transmitted by intimate or casual contact. In response to the referee’s query, we have provided examples of other agents ( Babesia, Chlamydia, Coxiella) that are proven or postulated to be transmitted by both tickbite and intimate contact. This information is included in the Discussion on page 11 with supporting references. If it was true that 8/11 samples were positive, one would expect a much more obvious clinical picture of transmission by intimate or casual contact, which is not the case. As noted above, the substantial numbers of
 new Lyme disease cases each year suggests additional forms of transmission beyond a tickbite. At this time, the true epidemiology of Lyme disease is unknown because the CDC surveillance system only captures less than 10% of Lyme disease cases, as noted in the Discussion on page 11. Other epidemiological studies have suggested that some infected patients may be relatively asymptomatic ( Harvey & Salvato, 2003), so transmission via intimate contact resulting in less obvious infection is plausible. The risk of this form of transmission and correlation with symptoms merits further study. Our report simply raises the possibility, and rejecting the report will shove this issue under the rug to the detriment of Lyme patients. 9. PCR-DNA analyses and long-term cultures can be subject to contamination, making the data here more difficult to interpret. PCR-DNA analysis is subject to contamination. That is why we did blinded testing that always included negative controls in three different laboratories using microscopy, immunochemistry and molecular hybridization to confirm the PCR findings. Although PCR testing alone might be “difficult to interpret”, the combination of experimental techniques done in different laboratories makes interpretation much more reliable.
  54 in total

1.  Chlamydial and rickettsial transmission through tick bite in children.

Authors:  F Facco; G Grazi; S Bonassi; M Magnani; P Di Pietro
Journal:  Lancet       Date:  1992-04-18       Impact factor: 79.321

Review 2.  The role of international transport of equine semen on disease transmission.

Authors:  E S Metcalf
Journal:  Anim Reprod Sci       Date:  2001-12-03       Impact factor: 2.145

3.  Relative infectivity of Borrelia burgdorferi in Lewis rats by various routes of inoculation.

Authors:  K D Moody; S W Barthold
Journal:  Am J Trop Med Hyg       Date:  1991-02       Impact factor: 2.345

Review 4.  PCR in laboratory diagnosis of human Borrelia burgdorferi infections.

Authors:  B L Schmidt
Journal:  Clin Microbiol Rev       Date:  1997-01       Impact factor: 26.132

5.  Evaluation of molecular methods for detection of Borrelia burgdorferi senso lato in ticks.

Authors:  Jifei Yang; Zhijie Liu; Guiquan Guan; Rongxuan Che; Qingli Niu; Youquan Li; Junlong Liu; Miling Ma; Qiaoyun Ren; Aihong Liu; Jianxun Luo; Hong Yin
Journal:  Diagn Microbiol Infect Dis       Date:  2012-04-10       Impact factor: 2.803

Review 6.  HIV transmission.

Authors:  George M Shaw; Eric Hunter
Journal:  Cold Spring Harb Perspect Med       Date:  2012-11-01       Impact factor: 6.915

7.  Neutrophil extracellular traps entrap and kill Borrelia burgdorferi sensu stricto spirochetes and are not affected by Ixodes ricinus tick saliva.

Authors:  Catherine Menten-Dedoyart; Céline Faccinetto; Maryna Golovchenko; Ingrid Dupiereux; Pierre-Bernard Van Lerberghe; Sophie Dubois; Christophe Desmet; Benaissa Elmoualij; Frédéric Baron; Nataliia Rudenko; Cécile Oury; Ernst Heinen; Bernard Couvreur
Journal:  J Immunol       Date:  2012-10-29       Impact factor: 5.422

8.  Experimental inoculation of mallard ducks (Anas platyrhynchos platyrhynchos) with Borrelia burgdorferi.

Authors:  E C Burgess
Journal:  J Wildl Dis       Date:  1989-01       Impact factor: 1.535

9.  Colony formation and morphology in Borrelia burgdorferi.

Authors:  T J Kurtti; U G Munderloh; R C Johnson; G G Ahlstrand
Journal:  J Clin Microbiol       Date:  1987-11       Impact factor: 5.948

10.  Clinical determinants of Lyme borreliosis, babesiosis, bartonellosis, anaplasmosis, and ehrlichiosis in an Australian cohort.

Authors:  Peter J Mayne
Journal:  Int J Gen Med       Date:  2014-12-23
View more
  8 in total

1.  Established Population of Blacklegged Ticks with High Infection Prevalence for the Lyme Disease Bacterium, Borrelia burgdorferi Sensu Lato, on Corkscrew Island, Kenora District, Ontario.

Authors:  John D Scott; Janet E Foley; Kerry L Clark; John F Anderson; Lance A Durden; Jodi M Manord; Morgan L Smith
Journal:  Int J Med Sci       Date:  2016-10-27       Impact factor: 3.738

2.  Detection of Lyme Disease Bacterium, Borrelia burgdorferi sensu lato, in Blacklegged Ticks Collected in the Grand River Valley, Ontario, Canada.

Authors:  John D Scott; Janet E Foley; John F Anderson; Kerry L Clark; Lance A Durden
Journal:  Int J Med Sci       Date:  2017-02-08       Impact factor: 3.738

3.  Presence of Babesia odocoilei and Borrelia burgdorferi Sensu Stricto in a Tick and Dual Parasitism of Amblyomma inornatum and Ixodes scapularis on a Bird in Canada.

Authors:  John D Scott; Kerry L Clark; Lance A Durden
Journal:  Healthcare (Basel)       Date:  2019-03-20

4.  Erosive Vulvovaginitis Associated With Borrelia burgdorferi Infection.

Authors:  Melissa C Fesler; Marianne J Middelveen; Jennie M Burke; Raphael B Stricker
Journal:  J Investig Med High Impact Case Rep       Date:  2019 Jan-Dec

5.  Dermatological and Genital Manifestations of Lyme Disease Including Morgellons Disease.

Authors:  Marianne J Middelveen; John S Haggblad; Julie Lewis; Gilles A Robichaud; Roberto M Martinez; Jyotsna S Shah; Iris Du Cruz; Melissa C Fesler; Raphael B Stricker
Journal:  Clin Cosmet Investig Dermatol       Date:  2021-05-06

6.  Lyme disease: the promise of Big Data, companion diagnostics and precision medicine.

Authors:  Raphael B Stricker; Lorraine Johnson
Journal:  Infect Drug Resist       Date:  2016-09-13       Impact factor: 4.003

7.  Far-Reaching Dispersal of Borrelia burgdorferi Sensu Lato-Infected Blacklegged Ticks by Migratory Songbirds in Canada.

Authors:  John D Scott; Kerry L Clark; Janet E Foley; Bradley C Bierman; Lance A Durden
Journal:  Healthcare (Basel)       Date:  2018-07-25

8.  Sexual Transmission of Lyme Borreliosis? The Question That Calls for an Answer.

Authors:  Natalie Rudenko; Maryna Golovchenko
Journal:  Trop Med Infect Dis       Date:  2021-05-24
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.