| Literature DB >> 28683768 |
Anjan Hazra1,2, Nirjhar Dasgupta1, Chandan Sengupta2, Sauren Das3.
Abstract
Tea (Camellia sinensis, (L.) Kuntze) is considered as most popular drink across the world and it is widely consumed beverage for its several health-benefit characteristics. These positive traits primarily rely on its regulatory networks of different metabolic pathways. Development of microsatellite markers from the conserved genomic regions are being worthwhile for reviewing the genetic diversity of closely related species or self-pollinated species. Although several SSR markers have been reported, in tea, the trait-specific Simple Sequence Repeat (SSR) markers, leading to be useful in marker assisted breeding technique, are yet to be identified. Micro RNAs are short, non-coding RNA molecules, involved in post transcriptional mode of gene regulation and thus effects on related phenotype. Present study deals with identification of the microsatellite motifs within the reported and predicted miRNA precursors that are effectively followed by designing of primers from SSR flanking regions in order to PCR validation. In addition to the earlier reports, two new miRNAs are predicting here from tea expressed tag sequence database. Furthermore, 18 SSR motifs are found to be in 13 of all 33 predicted miRNAs. Trinucleotide motifs are most abundant among all followed by dinucleotides. Since, miRNA based SSR markers are evidenced to have significant role on genetic fingerprinting study, these outcomes would pave the way in developing novel markers for tagging tea specific agronomic traits as well as substantiating non-conventional breeding program.Entities:
Keywords: Micro RNA; Simple sequence repeats; Tea quality; Trait specific marker
Mesh:
Substances:
Year: 2017 PMID: 28683768 PMCID: PMC5501407 DOI: 10.1186/s13104-017-2577-x
Source DB: PubMed Journal: BMC Res Notes ISSN: 1756-0500
Fig. 1The predicted secondary step-loop structures of new tea pre-miRNAs with mature miRNA sequence highlighted in green
List of predicted microRNAs and occurrence of SSR motifs with designed primer
| Predicted miRNA | Precusor id | MFE (−kCal) | References | SSR start | SSR end | SSR motif | SSR length | Primer F | Primer R | Product size |
|---|---|---|---|---|---|---|---|---|---|---|
| miR164 | CV013669 | 20 | [ | |||||||
| miR169 | GE650220 | 7.8 | [ | 81 | 93 | CGC | 3 | GGAGTGAAGGAGGGAAGA | CCGAGAGAATAATAAGGAGGA | 205 |
| miR1846 | DN976181 | 40.5 | [ | |||||||
| miR1863 | GH623864 | 19.2 | [ | 224 | 236 | GAG | 3 | AGTGATTATTGGTGGTGGTC | TCTCAACCAATTCAACAAGTC | 152 |
| miR 408 | GD254786.1 | 120.1 | [ | 519 | 541 | TA | 2 | CTGTTACTGCAGCTTAACCAA | AAATATGCTGCTCATTCAAAC | 152 |
| 142 | 154 | GGC | 3 | AGAAGATGTCTCAGGGAAGAG | ACACAAGTATGTCACCAGCTC | 177 | ||||
| csi-miR1171 | FE943069.1 | 45.97 | [ | 280 | 295 | GTGGA | 5 | GAACCTTTCCTCCAGAATTTA | TCACATTTAGCTTTTCACTCC | 162 |
| csi-miR414a | GD254734.1 | 63.18 | [ | |||||||
| csi-miR414d | GW342817.1 | 37.72 | [ | 170 | 188 | GATGAC | 6 | ACGATGGTGGTTATGAATATG | GGGTTTTTGTTAAGTTGTTCA | 139 |
| csi-miR414f | GE651542.1 | 18.5 | [ | 99 | 111 | TTC | 3 | AGACAAAAACCAAGGCTAGAT | CATCTTGTGCAGATCTCAGTT | 149 |
| 121 | 139 | ATC | 3 | |||||||
| cas-miR1122 | EU849076.1 | 91.23 | [ | |||||||
| csi-miR414 g | CV013826.1 | 25.2 | [ | 504 | 519 | CTC | 3 | TGATGATGAGGAAGGAGATAA | TTGCTTTAGTGAAACAACTCC | 136 |
| csi-miRf10132-akr | CV014169.1 | 69.5 | [ | |||||||
| cja-miR2910 | U42815.1 | −91 | [ | |||||||
| csi-miR2914 | AB120309.1 | 20.9 | [ | |||||||
| cas-miRf10185-akr | GH623933.1 | 51.1 | [ | |||||||
| cas-miR11590-akr | GE651674.1 | 23.8 | [ | |||||||
| csi-miR414 h | GW863581.1 | 86.83 | [ | |||||||
| miR156 | HS396956.1 | 45.8 | [ | 113 | 125 | AAC | 3 | CGTTAGGCTATTTTGTTTCAA | TTCTGTCAATCATCCAATTTC | 159 |
| miR171a | FS948108.1 | 39.2 | [ | 115 | 127 | TC | 2 | TACTTCCAACCAAACACAAGT | TAGCTTACCACCTCAATCAAA | 168 |
| miR171b | FS948109.1 | 40.4 | [ | |||||||
| miR397 | CV699725.1 | 39.2 | [ | |||||||
| miR399 | FS958856.1 | 52.8 | [ | |||||||
| miR2863 | FS950435.1 | 21.5 | [ | 57 | 69 | TCTA | 4 | CTCCTGTACACTCTCTCTCTCC | GATGAACAGCATAGGTATCCA | 127 |
| miR2911a | JK476023.1 | 65.4 | [ | |||||||
| miR2911b | FS953337.1 | 69.2 | [ | |||||||
| miR5021a | GW690847.1 | 71.9 | [ | 72 | 84 | GGA | 3 | AGACACAGGCAGACATAGAGA | AAGATGCGATGAGATCAGATA | 165 |
| 239 | 254 | TTC | 3 | AGATACACATTGGGAAGAAGG | TAGAACTTGCAGAGAGAAACG | 149 | ||||
| 252 | 264 | TC | 2 | |||||||
| miR5021b | GE651759.1 | 72.2 | [ | 60 | 78 | GA | 2 | TAGAACTTGCAGAGAGAATCG | TACACATTGGGAAGAAGAAGA | 152 |
| 75 | 90 | AGA | 3 | |||||||
| miR5368a | GE653011.1 | 76.1 | [ | |||||||
| miR5368b | FS945766.1 | 68.5 | [ | |||||||
| miR6483a | HS398296.1 | 29.8 | [ | |||||||
| miR6483b | JK714410.1 | 30 | [ | |||||||
| miR1533 | JK478587.1 | 89.99 | Reported | 403 | 419 | AC | 2 | |||
| miR8002-3p | FS955851.1 | 155.67 | Reported | |||||||