Literature DB >> 28677529

Generation and characterization of a human iPSC cell line expressing inducible Cas9 in the "safe harbor" AAVS1 locus.

Julio Castaño1, Clara Bueno2, Senda Jiménez-Delgado3, Heleia Roca-Ho2, Mario F Fraga4, Agustín F Fernandez5, Mahito Nakanishi6, Raúl Torres-Ruiz7, Sandra Rodríguez-Perales8, Pablo Menéndez9.   

Abstract

We report the generation-characterization of a fetal liver (FL) B-cell progenitor (BCP)-derived human induced pluripotent stem cell (hiPSC) line CRISPR/Cas9-edited to carry/express a single copy of doxycycline-inducible Cas9 gene in the "safe locus" AAVS1 (iCas9-FL-BCP-hiPSC). Gene-edited iPSCs remained pluripotent after CRISPR/Cas9 genome-edition. Correct genomic integration of a unique copy of Cas9 was confirmed by PCR and Southern blot. Cas9 was robustly and specifically expressed on doxycycline exposure. T7-endonuclease assay demonstrated that iCas9 induces robust gene-edition when gRNAs against hematopoietic transcription factors were tested. This iCas9-FL-BCP-hiPSC will facilitate gene-editing approaches for studies on developmental biology, drug screening and disease modeling.
Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28677529      PMCID: PMC5446316          DOI: 10.1016/j.scr.2017.04.011

Source DB:  PubMed          Journal:  Stem Cell Res        ISSN: 1873-5061            Impact factor:   2.020


Resource Table

Resource utility

This iCas9-FL-BCP-iPSC constitutes a unique tool facilitating the screening on multiple sgRNAs (and libraries) for the generation of locus-specific genetic-edited (knock-in, knock-out, codon substitution, structural rearrangements, etc.) hiPSC for developmental biology, compound screening and disease modeling.

Resource details

Fresh fetal liver (FL) was collected from developing human embryos aborted at 19–22 weeks of pregnancy. Human tissue was provided by The Vrelinghuis abortion clinic (Utrecht, The Netherlands) upon signed informed consent and approval by our local Ethics and Biozahard Board Committees (CMRB-CEIC-26/2013) through a formal collaboration with the Erasmus-Medical Centre, Rotterdam, The Netherlands). Mononuclear cells (MNCs) were isolated using Ficoll-Hypaque and CD34 + CD19 + B-cell progenitors (BCP) were FACS-purified and reprogrammed by infection with non-integrative tetracistronic SeV vectors encoding the transcription factors OCT4, SOX2, KLF4, and MYC (OSKM) (Munoz-Lopez et al., 2016a, Munoz-Lopez et al., 2016b). Resulting FL CD34 + CD19 + − iPSC lines (FL-BCP-hiPSC) were established as previously reported (Munoz-Lopez et al., 2016a, Munoz-Lopez et al., 2016b, Bueno et al., 2016). This FL-BCP-hiPSC was genome-edited to harbor the Cas9 coding sequence controlled by a doxycycline-inducible cassette in the genomic “safe harbor” AAVS1 (iCas9-FL-BCP-hiPSC). A single cassette containing both the rTetR activator under CAG promoter and the Tetracycline Response Element (TRE) promoter driving the expression of Cas9, was inserted in the AAVS1 locus by homologous recombination using the Cas9 nuclease and a guide RNA (gRNA) sequence (Mali et al., 2013) against intron 1 of AAVS1 locus (Fig. 1 panel A). The Fig. 1 panel A shows a schematic representation of the donor vector used for insertion of the iCas9 cassette into the AAVS1 locus (HA, homology arm; puro, puromycin; SA, splice acceptor; T2A, self-cleaving 2A peptide; CAG, CMV early enhancer/chicken β actin promoter. rTetR, reverse Tet repressor; pA, poly A signal; TRE, Tet response element). Correct genomic integration of a unique copy of Cas9 was confirmed by both genomic PCR (not shown) and Southern blot analysis (Fig. 1 panel B) in several iPSC clones, using a 5′-internal probe (left panel) and a 3′-external probe (right panel). Red asterisks indicate clones with the desired targeted insertions of the iCas9. Three iCas9-FL-BCP-hiPSC clones were induced for 72 h with 2 μg/ml of doxycycline and analyzed for Cas9 expression by qPCR (Fig. 1 panel C), showing a robust, non-leaky expression of Cas9. To functionally validate the Cas9 expression, iCas9-FL-BCP-hiPSCs were nucleofected with different gRNAs against three hematopoietic transcription factors (MLL, GATA2 and AF4) in presence/absence of doxycycline. The T7 endonuclease I assay confirmed a high percentage (25%–62%) of cleavage (Fig. 1 panel D). Red asterisks depict the expected T7EI-specific fragments used to quantify indel frequency. The in silico-predicted (crispr.mit.edu) top off-targets of AAVS1 gRNA (RNF4, RHOT2, FAIM2, RPL8, BTNL8, MYBL2) were sequence-verified in iCas9-FL-BCP-hiPSCs and they were consistently found unaltered, demonstrating the high specificity of the approach used (data not shown).
Fig. 1

CRISPR/Cas9-mediated generation of iCas9-FL-BCP-hiPSCs by gene targeting at the AAVS1 locus.

CRISPR/Cas9-mediated generation of iCas9-FL-BCP-hiPSCs by gene targeting at the AAVS1 locus. Importantly, iPSCs remained pluripotent after CRISPR/Cas9 gene editing. iCas9-FL-BCP-hiPSCs retained hESC-like morphology and expressed the pluripotency markers alkaline phosphatase (AP) (Fig. 1 panel E), OCT4, NANOG, SOX2, REX1, CRIPTO, and DNMT3B (Fig. 1 panel F). Endogenous expression of NANOG and OCT4 was accompanied by the extensive loss of CpG methylation in their promoters (Fig. 1 panel G). By flow cytometry, gene-edited iPSCs consistently expressed SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 (Fig. 1 panel H). In vivo, the differentiation capacity was confirmed by teratoma formation in NSG mice comprising tissue representing all three germ layers (Fig. 1 panel I).

Materials and methods

iPSC generation, maintenance and characterization

iPSCs were generated using OKSM polycistronic SeV vector (Munoz-Lopez et al., 2016a, Munoz-Lopez et al., 2016b) and were fully characterized before and after gene edition as previously described (Bueno et al., 2016).

Promoter demethylation

Bisulfite pyrosequencing of OCT4 and NANOG promoters was done as described (Bueno et al., 2016).

Immunophenotyping

Antibodies used to check by flow cytometry the pluripotency-associated markers are detailed in Table 2.
Table 2

Antibodies and primers used in this study.

Antibodies used for immunocytochemistry/flow-citometry
AntibodyDilutionCompany Cat # and RRID
SSEA-3-PERat anti-SSEA-31:100BD Bioscience Cat#560237, RRID:AB_1645542
SSEA-4-v450Mouse anti-SSEA-41:100BD Bioscience Cat#561156, RRID:AB_10896140
TRA-1-60-BV510Mouse anti-TRA-1-601:100BD Bioscience Cat#563188, RRID:AB_2637036
TRA-1-81-AlexaFlour647®Mouse anti-TRA-1-811:100BD Bioscience Cat#560793, RRID:AB_10550550



Primers
TargetForward/Reverse primer (5′–3′)
Genomic PCR5′ junctionCTGCCGTCTCTCTCCTGAGT/GTGGGCTTGTACTCGGTCAT
3′ junctionGGCGATCTGACGGTTCACTAAAC/GAATCCACCCAAAAGGCAGC
Southern blot5′ probeAGGTTCCGTCTTCCTCCACT/GTCCAGGCAAAGAAAGCAAG
3′ probeACAGGTACCATGTGGGGTTC/CTTGCCTCACCTGGCGATAT
T7 assayMLLCAGCACTCTCTCCAATGGCA/TAAGCCTCCCATCTCCCACA
AF4GGGGAAAAAAAACATTTCGGCGACATG/CTACCATTTCCCTCATTCCAATTCACTCC
GATA2CGTGTCGCTGGGATCAAG/TCCCCAAAGAAAGCCAGAAAC
RNA in vitro transcriptionAAVS1 IVTGAAATTAATACGACTCACTATAGGGGGCCACTAGGGACAGGATGTTTTAGAGCTAGAAA/AAAAGCACCGACTCGGTGCC
MLL IVTGAAATTAATACGACTCACTATAGTTAGCAGGTGGGTTTAGCGCGTTTTAGAGCTAGAAA/AAAAGCACCGACTCGGTGCC
AF4 IVTGAAATTAATACGACTCACTATAGGTCTCATTCCAGCAACACGTGTTTTAGAGCTAGAAA/AAAAGCACCGACTCGGTGCC
GATA2 IVTCATGTAGTTGTGCGCCGTTTTAGAGCTAGA/AAAAGCACCGACTCGGTGCC
Pluripotency Markers (qPCR)OCT4GGGTTTTTGGGATTAAGTTCTTCA/GCCCCCACCCTTTGTGTT
NANOGACAACTGGCCGAAGAATAGCA/GGTTCCCAGTCGGGTTCAC
SOX2CAAAAATGGCCATGCAGGTT/AGTTGGGATCGAACAAAAGCTATT
REX1CCTGCAGGCGGAAATAGAAC/GCACACATAGCCATCACATAAGG
CRIPTOCGGAACTGTGAGCACGATGT/GGGCAGCCAGGTGTCATG
DNMT3BGCTCACAGGGCCCGATACTT/GCAGTCCTGCAGCTCGAGTTTA
Housekeeping geneGAPDHGCACCGTCAAGGCTGAGAAC/AGGGATCTCGCTCCTGGAA
Off-target genomic PCRRNF4CAGACCGTGACTCCCGAAA/GTCAGCGGGGAACAAAAACC
RHOT2TGTTACTGGGCGAGGGTAGG/CTACGGCCGCTACCTGAGTA
FAIM2AGGCTCGTCCCATCCTTTTG/CACATCCCCATTTGCTCCCT
RPL8GCAGGCAGTTCTAGAAGCCA/CCTTAGTTATCTGGATTTCCAGAAC
BTNL8TAGGAGTCTTGGTGGTGTTCAT/ATATCGTGGCACCTGGCTAC
MYBL2GCAGTCGGAGGAAGTGACAA/CTCCTGGCCCCTCTTAGACT
Mycoplasma PCRNatureTGCACCATCTGTCACTCTGTTAACCTC/GGGAGCAAACAGGATTAGATACCCT
M1ACACCATGGGAGCTGGTAAT/CTTCATCGACTTTCAGACCCAAGGCAT

CRISPR/Cas9-edition of hiPSCs expressing a doxycycline-inducible Cas9

The CAG-rTetR cassette was PCR amplified from AAVS1-Neo-M2rtTA (Addgene #60843) with primers containing restriction sites for SalI and ClaI. After amplification and enzyme-digestion, the CAG-rTetR cassette was cloned in the Puro-Cas9 donor vector (Addgene #58409). Finally, a gBlock fragment (IDT Technologies) designed with two opposite poly-A sequences was cloned using MluI and ClaI enzymes. A gRNA sequence targeting the AAVS1 intron 1 (5′-GGGGCCACTAGGGACAGGAT-3′) was in vitro transcribed (IVT). To edit the iPSCs, 200.000 cells were electroporated with 100 pmol Cas9 nuclease (IDT - Integrated DNA Technologies), 120 pmol the IVT-gRNA against AAVS1 intron 1, and 5 μg of linearized donor vector. Electroporation was performed using Neon Transfection System (ThermoFisher) at 1400 V, 5 ms and 3 pulses in a 100 μl tip. Cells were then selected with 1 μg/ml puromycin.

Southern blot

Genomic DNA from each cell line was isolated with Maxwell® RSC Cultured Cells DNA Kit (Promega). 6 μg of DNA from each clone was digested with SphI (for 5′ probe) or BglII (for 3′ probe) (New England Biolabs), separated on a 1% agarose gel and transferred to a nylon membrane (RPN303B, Amersham). Membranes were hybridized with DIG-dUTP labeled probes. Probes were detected by an AP-conjugated DIG-Antibody (Roche Diagnostics) using CDP-Star (Sigma-Aldrich) as a substrate for chemiluminescence. Probes were synthesized by PCR using the PCR DIG Probe Synthesis Kit (Roche Diagnostics). 5′ probe was generated using plasmidic DNA and 3′ probe using genomic DNA as a templates. Primers used for probes are detailed in Table 2.

T7 endonuclease assay

iCas9-FL-BCP-hiPSCs were treated with doxycycline (2 μg/ml) for two days before and during transfection. Cells were dissociated with Accutase (Stem Cell Technologies) and 200.000 cells were electroporated with 120 pmol of a single IVT-gRNA (MLL, GATA2 or AF4). Genomic DNA was extracted four days after gRNA transfection. Genomic regions flanking the CRISPR target sites were PCR amplified (Table 1). PCRs were denatured and re-annealed and then PCRs were treated with 5U of T7EI at 37 °C for 1 h.
Table 1

Summary of quality control testing and results for iCas9-FL-BCP-hiPSC.

ClassificationTestResultData
MorphologyPhotographyhESC-like morphologyFig. 1 panel E top
AP stainingPositiveFig. 1 panel E bottom
PhenotypeqPCRExpression of pluripotency markers: OCT4, NANOG, SOX2, CRIPTO, REX, DNMT3BFig. 1 panel F
Promoter demethylationloss of CpG methylation in OCT4 and NANOG promotersFig. 1 panel G
Flow cytometrySSEA-3 (76%), SSEA-4 (100%), TRA-1-60 (100%) and TRA-1-81 (99%)Fig. 1 panel H
GenotypeKaryotype47 (XX) + 20Resolution: 400-band levelFig. 1S panel C
IdentityVDJH (BCR) rearrangementIncomplete VDJH rearrangement (progenitor B cell)Fig. 1S panel A
Mutation analysisSouthern blotOne specific insertion at AAVS1 locusFig. 1 panel B
Microbiology and virologyMycoplasmaMycoplasma tested by PCR: negativeFig. 1S panel B
Differentiation potentialTeratoma formationRepresentation of all three germ layersFig. 1 panel I
Donor screeningN/A
Genotype additional infoN/A
Summary of quality control testing and results for iCas9-FL-BCP-hiPSC.

In vitro transcription

T7 RNA polymerase promoter was added to gRNA sequences by PCR using as a template the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138) containing the guide RNA sequences for MLL, GATA2 or AF4. PCR amplification were performed using specific forward primers and a universal reverse primer (Table 2). PCR products were used as templates for IVT using the HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs). The resulting gRNAs were purified using the MEGAclear kit (Life Technologies), eluted in RNase-free water and stored at − 80 °C until use.

Mycoplasma test

Primers used are listed in Table 2. PCR conditions were: 94 °C: 20″ × 40 cycles 94ªC: 20″ 55 °C: 20″ (Nature primer) or 58 °C: 10″ (M1 primer) 65ªC: 20–40″ Antibodies and primers used in this study. The following are the supplementary data related to this article. Supplementary quality control testing and results for iCas9-FL-BCP-hiPSC. Supplementary material
Unique stem cell line identifierJCLRIi001-A-1
Alternative name of stem cell lineiCas9-FL-BCP-hiPSC
InstitutionJosep Carreras Leukemia Research Institute
Contact information of distributorJulio Castaño, jcastano@carrerasresearch.org
Type of cell lineiPSC
Originhuman
Additional origin infoAge: 19–22 weeks of human fetal developmentSex: XX
Cell sourceFetal liver B-cell progenitors
Method of reprogrammingNon-integrative (Sendai virus)
Associated diseaseNon applicable
Gene/locusCas9 inserted in AAVS1 locus
Method of modificationCRISPR-Cas9
Gene correctionNO
Name of transgene or resistanceCas9
Inducible/constitutive systemDoxycycline inducible system
Date archived/stock dateDecember 2016
Cell line repository/bank
Ethical approvalPatient's informed consent obtained.Institutional Review Board approval obtained (CMRB-CEIC-26/2013)
  4 in total

1.  Reprogramming human B cells into induced pluripotent stem cells and its enhancement by C/EBPα.

Authors:  C Bueno; J L Sardina; B Di Stefano; D Romero-Moya; A Muñoz-López; L Ariza; M C Chillón; A Balanzategui; J Castaño; A Herreros; M F Fraga; A Fernández; I Granada; O Quintana-Bustamante; J C Segovia; K Nishimura; M Ohtaka; M Nakanishi; T Graf; P Menendez
Journal:  Leukemia       Date:  2015-10-26       Impact factor: 11.528

2.  Cellular Ontogeny and Hierarchy Influence the Reprogramming Efficiency of Human B Cells into Induced Pluripotent Stem Cells.

Authors:  Álvaro Muñoz-López; Eddy H J van Roon; Damià Romero-Moya; Belén López-Millan; Ronald W Stam; Dolors Colomer; Mahito Nakanishi; Clara Bueno; Pablo Menendez
Journal:  Stem Cells       Date:  2016-02-25       Impact factor: 6.277

3.  RNA-guided human genome engineering via Cas9.

Authors:  Prashant Mali; Luhan Yang; Kevin M Esvelt; John Aach; Marc Guell; James E DiCarlo; Julie E Norville; George M Church
Journal:  Science       Date:  2013-01-03       Impact factor: 47.728

4.  Development Refractoriness of MLL-Rearranged Human B Cell Acute Leukemias to Reprogramming into Pluripotency.

Authors:  Alvaro Muñoz-López; Damià Romero-Moya; Cristina Prieto; Verónica Ramos-Mejía; Antonio Agraz-Doblas; Ignacio Varela; Marcus Buschbeck; Anna Palau; Xonia Carvajal-Vergara; Alessandra Giorgetti; Anthony Ford; Majlinda Lako; Isabel Granada; Neus Ruiz-Xivillé; Sandra Rodríguez-Perales; Raul Torres-Ruíz; Ronald W Stam; Jose Luis Fuster; Mario F Fraga; Mahito Nakanishi; Gianni Cazzaniga; Michela Bardini; Isabel Cobo; Gustavo F Bayon; Agustin F Fernandez; Clara Bueno; Pablo Menendez
Journal:  Stem Cell Reports       Date:  2016-09-22       Impact factor: 7.765

  4 in total
  10 in total

1.  Generation of a H9 Clonal Cell Line With Inducible Expression of NUP98-KDM5A Fusion Gene in the AAVS1 Safe Harbor Locus.

Authors:  Joan Domingo-Reinés; Gonzalo Martínez-Navajas; Rosa Montes; Mar Lamolda; Iris Simón; Julio Castaño; Rosa Ríos-Pelegrina; Javier Luis Lopez-Hidalgo; Raimundo García Del Moral; Juan A Marchal; Pedro J Real; Verónica Ramos-Mejía
Journal:  Front Cell Dev Biol       Date:  2022-06-01

2.  Quantification of transgene expression in GSH AAVS1 with a novel CRISPR/Cas9-based approach reveals high transcriptional variation.

Authors:  Anne Inderbitzin; Tom Loosli; Roger D Kouyos; Karin J Metzner
Journal:  Mol Ther Methods Clin Dev       Date:  2022-06-09       Impact factor: 5.849

3.  Establishment and characterization of a novel human induced pluripotent stem cell line stably expressing the iRFP720 reporter.

Authors:  Anita Fehér; Andrea Schnúr; Suchitra Muenthaisong; Tamás Bellák; Ferhan Ayaydin; György Várady; Elisabeth Kemter; Eckhard Wolf; András Dinnyés
Journal:  Sci Rep       Date:  2022-06-14       Impact factor: 4.996

Review 4.  hiPSCs in cardio-oncology: deciphering the genomics.

Authors:  Emily A Pinheiro; K Ashley Fetterman; Paul W Burridge
Journal:  Cardiovasc Res       Date:  2019-04-15       Impact factor: 10.787

Review 5.  Rare Opportunities: CRISPR/Cas-Based Therapy Development for Rare Genetic Diseases.

Authors:  Panayiota Papasavva; Marina Kleanthous; Carsten W Lederer
Journal:  Mol Diagn Ther       Date:  2019-04       Impact factor: 4.074

6.  Improving the efficiency of gene insertion in a human artificial chromosome vector and its transfer in human-induced pluripotent stem cells.

Authors:  Yoshinori Hasegawa; Masashi Ikeno; Nobutaka Suzuki; Manabu Nakayama; Osamu Ohara
Journal:  Biol Methods Protoc       Date:  2018-12-31

7.  Efficient viral delivery of Cas9 into human safe harbor.

Authors:  Hideki Hayashi; Yoshinao Kubo; Mai Izumida; Toshifumi Matsuyama
Journal:  Sci Rep       Date:  2020-12-08       Impact factor: 4.379

8.  Nanobody-based chimeric antigen receptor T cells designed by CRISPR/Cas9 technology for solid tumor immunotherapy.

Authors:  Fengzhen Mo; Siliang Duan; Xiaobing Jiang; Xiaomei Yang; Xiaoqiong Hou; Wei Shi; Cueva Jumbo Juan Carlos; Aiqun Liu; Shihua Yin; Wu Wang; Hua Yao; Zihang Yu; Zhuoran Tang; Shenxia Xie; Ziqiang Ding; Xinyue Zhao; Bruce D Hammock; Xiaoling Lu
Journal:  Signal Transduct Target Ther       Date:  2021-02-25

9.  Variable expression and silencing of CRISPR-Cas9 targeted transgenes identifies the AAVS1 locus as not an entirely safe harbour.

Authors:  Jamie R Bhagwan; Emma Collins; Diogo Mosqueira; Mine Bakar; Benjamin B Johnson; Alexander Thompson; James G W Smith; Chris Denning
Journal:  F1000Res       Date:  2019-11-12

10.  CRISPR/Cas9-mediated overexpression of long non-coding RNA SRY-box transcription factor 21 antisense divergent transcript 1 regulates the proliferation of osteosarcoma by increasing the expression of mechanistic target of rapamycin kinase and Kruppel-like factor 4.

Authors:  W Zhang; Q Wang; H Du; S Jiang
Journal:  Bioengineered       Date:  2022-03       Impact factor: 3.269

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.