| Literature DB >> 28676856 |
Wenxiang Chen1, Jia Meng1, Hong Qian1, Zhantao Deng1, Shuo Chen1, Haidong Xu1, Wenshuang Sun1, Yiying Wang1, Jianning Zhao1, Nirong Bao1.
Abstract
Primary frozen shoulder (PFS) is a common condition of uncertain etiology that is characterized by shoulder pain and restriction of active and passive glenohumeral motions. The pathophysiology involves chronic inflammation and fibrosis of the joint capsule. Single nucleotide polymorphisms (SNPs) at IL-1β, MMP3, TGF-β1, and GDF5 have been associated with risk of a variety of inflammatory diseases; however, no studies have examined these SNPs with susceptibility to PFS. We investigated allele and genotype frequencies of rs1143627 at IL-1β, rs650108 at MMP-3, rs1800469 at TGF-β1, and rs143383 at GDF5 in 42 patients with PFS and 50 healthy controls in a Chinese Han population. Serum samples from both cohorts were evaluated to determine the expression levels of IL-1β. We found that the IL-1β rs1143627 CC genotype was associated with a decreased risk of PFS compared to the TT genotype (P = 0.022) and that serum IL-1β was expressed at a significantly higher level in the PFS cohort compared to that found in the control group (P < 0.001). Our findings indicated no evidence of an association between rs650108, rs1800469, or rs143383 and PFS. IL-1β is associated with susceptibility to PFS and may have a role in its pathogenesis in a Chinese Han population.Entities:
Mesh:
Substances:
Year: 2017 PMID: 28676856 PMCID: PMC5476899 DOI: 10.1155/2017/3681645
Source DB: PubMed Journal: Biomed Res Int Impact factor: 3.411
PCR primers and single base pair (bp) extension primers of 4 SNPs at IL-1β, GDF5, MMP-3, and TGF-β1.
| Genes | SNPs | PCR primer sequence (5′→3′) | Single bp extension primer sequence |
|---|---|---|---|
|
| rs1143627-F | ACGTTGGATGTTGTGCCTCGAAGAGGTTTG | TCCCTCGCTGTTTTTAT |
| rs1143627-R | ACGTTGGATGTCTCAGCCTCCTACTTCTGC | ||
|
| rs650108-F | ACGTTGGATGTCAGGTAGAGGTGACAAGTG | CCAGTGGGTGAGGTTAGA |
| rs650108-R | ACGTTGGATGGTCACTGTCTCATTGTGTGT | ||
|
| rs1800469-F | ACGTTGGATGTACAGGTGTCTGCCTCCTGA | ACTCCTGACCCTTCCATCC |
| rs1800469-R | ACGTTGGATGAAGAGGGTCTGTCAACATGG | ||
|
| rs143383-F | ACGTTGGATGCAGCAGCTGAAAATAACTCG | TCTTGAAAGGAGAAAGCC |
| rs143383-R | ACGTTGGATGTTCAAGCCCTCAGTCAGTTG |
PCR: polymerase chain reaction; SNP: single nucleotide polymorphism.
Characteristics of the study population in patients with PFS and controls.
| Characteristics | Cases | Controls |
|
|---|---|---|---|
| Male/female | 20/22 | 23/27 | 0.877 |
| Age (years) | 53.86 ± 1.60 | 54.80 ± 2.58 | 0.175 |
| BMI (kg/m2) | 23.15 ± 1.00 | 23.31 ± 1.14 | 0.481 |
BMI: body mass index; PFS: primary frozen shoulder.
Comparisons of genotype and allele distributions of IL-1β, MMP-3, TGF-β1, and GDF5 polymorphisms between patients with PFS and controls.
| SNP | Cases | Controls | OR (95% CI) |
|
|---|---|---|---|---|
|
|
| |||
|
| ||||
| Genotype | ||||
| TT | 14 (33.3) | 15 (30.0) | 1.00a | |
| TC | 26 (61.9) | 22 (44.0) | 1.27 (0.50–3.19) | 0.616 |
| CC | 2 (4.8) | 13 (26.0) | 0.17 (0.03–0.87) | 0.022 |
| TC + CC | 28 (66.7) | 35 (35.0) | 0.86 (0.36–2.07) | 0.732 |
| Allele | ||||
| T | 54 (64.3) | 52 (52.0) | 1.00a | |
| C | 30 (35.7) | 48 (48.0) | 0.60 (0.33–1.09) | 0.093 |
|
| ||||
| Genotype | ||||
| AA | 18 (42.9) | 20 (40.0) | 1.00a | |
| AG | 16 (48.1) | 21 (42.0) | 0.85 (0.34–2.10) | 0.720 |
| GG | 8 (19.0) | 9 (18.0) | 0.99 (0.34–3.11) | 0.983 |
| AG + GG | 24 (67.1) | 30 (60.0) | 0.89 (0.39–2.04) | 0.782 |
| Allele | ||||
| A | 52 (61.9) | 61 (61.0) | 1.00a | |
| G | 32 (38.1) | 39 (39.0) | 0.96 (0.53–1.75) | 0.900 |
|
| ||||
| Genotype | ||||
| CC | 9 (21.4) | 13 (26.0) | 1.00a | |
| CT | 23 (54.8) | 24 (48.0) | 1.38 (0.50–0.39) | 0.533 |
| TT | 10 (23.8) | 13 (26.0) | 1.11 (0.34–3.63) | 0.862 |
| CT + TT | 33 (78.6) | 37 (74.0) | 1.29 (0.49–3.40) | 0.609 |
| Allele | ||||
| C | 41 (48.9) | 50 (50.0) | 1.00a | |
| T | 43 (51.1) | 50 (50.0) | 1.05 (0.59–1.87) | 0.872 |
|
| ||||
| Genotype | ||||
| TT | 22 (52.4) | 24 (48.0) | 1.00a | |
| TC | 18 (42.9) | 22 (44.0) | 0.89 (0.38–2.09) | 0.793 |
| CC | 2 (4.8) | 4 (8.0) | 1.54 (0.42–5.64) | 0.513 |
| TC + CC | 20 (47.7) | 26 (52.0) | 0.84 (0.37–1.91) | 0.675 |
| Allele | ||||
| T | 62 (73.8) | 70 (70.0) | 1.00a | |
| C | 22 (26.2) | 30 (30.0) | 1.07 (0.58–1.98) | 0.828 |
aReference genotype/allele; CI: confidence interval; OR: odds ratio; PFS: primary frozen shoulder; SNP: single nucleotide polymorphism.
Comparison between serum IL-1β level in patients with PFS and controls.
| Group |
| Levels of IL-1 |
|
|---|---|---|---|
| Cases | 42 | 28.55 ± 2.58 | <0.001 |
| Controls | 50 | 20.12 ± 2.28 |
PFS: primary frozen shoulder.