Prevalence of Virulence Genes Associated with Diarrheagenic Pathotypes of Escherichia coli Isolates from Water, Sediment, Fish, and Crab in Aby Lagoon, Côte d'Ivoire.

This study was conducted to characterize virulence genes of Escherichia coli isolates from water, sediment, fish, and crab in Aby Lagoon. Serogrouping was performed by EPEC antisera in 113 E. coli strains. The presence of diarrhea-associated genes (eae, stx, AggR, elt, and est) was assessed by multiplex PCR using specific primers. Based on the multiplex PCR, sixty-two isolates (42 from water, 19 from sediment, and 1 from crab) were positive for virulence genes, including 34 positive for elt (ETEC), 46 positive for est (ETEC), 24 positive for both elt and est, 6 positive for stx (EHEC), 1 positive for both stx + est, and 1 positive for both stx + elt. Genes eae (EPEC) and AggR (EAEC) were not detected. Nine serogroups (O114, O127, O55, O111, O86, O119, O126, O128, and O142) were identified. This study revealed the presence of diarrheagenic and nondiarrheagenic E. coli and potential public health risks if fishery products are not appropriately cooked.

1. Introduction

Most Escherichia coli strains are a normal inhabitant of the intestinal tract of humans and warm-blooded animals. Despite being usually harmless, various E. coli strains have acquired genetic determinants (virulence genes) giving them the capacity to cause illness for both humans and animals. Some strains of E. coli are now seen as pathogenic species with remarkable versatility in their ability to cause disease in humans and animals [1]. E. coli is one of the most frequent causes of diarrhea in children in developing countries [2]. According to Grasso et al. [3] and Tumwine et al. [4], infectious pathotypes of E. coli are related to the lack of sanitation and personal hygiene but also the consumption of well water, river water, and other contaminated surface waters.

Diarrheagenic E. coli (DEC) is classified on the basis of its epidemiological, clinical, and pathogenic characteristics into the following six different pathotypes: enteropathogenic E. coli (EPEC), shiga-toxin producing E. coli (STEC) or enterohemorrhagic E. coli (EHEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), and diffuse adherent E. coli (DAEC) [1]. Each pathotype expresses a unique set of virulence and colonization factors encoded in the chromosome or in episomal structures [5]. The genes encoding these virulence factors are conserved among strains isolated from different continents [6-9].

Among the E. coli pathogenic strains, in most developing countries, EPEC, ETEC, and EAEC are the most common cause of infectious diarrhea in young children [10, 11]. Research into EPEC is intense and provides a good virulence model of other E. coli infections as well as other pathogenic bacteria [12]. According to the World Health Organization (WHO) in 1987, most EPEC strains belonged to a series of O antigenic groups known as EPEC serogroups which included O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158 [13]. Serogrouping of E. coli based on somatic O antigen used for differentiating diarrheagenic E. coli is costly and time-consuming and poorly correlates with the presence of virulence factors. So, in the last decade, modern molecular detection methods were reported in the literature for rapid identification of E. coli pathotypes including PCR and multiplex PCR.

In spite of increasing evidence that E. coli strains originating from human and animal feces contain several virulence genes, only a few studies have investigated the presence of E. coli pathotype in environmental waters [14-18]. The presence of E. coli strains with virulence genes profiles similar to EHEC, EPEC, and ETEC in environmental waters has already been reported. To the best of our knowledge, no investigation on E. coli pathotypes distribution has been carried out on the estuarine water environments of Côte d'Ivoire. Yet, these environments that receive frequently domestic wastewater and mammalian feces provide important fishery resources. The production of fish and shellfish is estimated, respectively, to be 6.000 and 7.000 tons per year in the Aby Lagoon [19]. Contamination of lagoon waters by E. coli pathotypes could have a negative impact on fish, crabs, and other animals in this environment. Thus, a potential public health risk exists if these fishery products were contaminated by these pathotypes on the one hand and on the other hand if the hygiene measures are faulty during cooking. According to Rangel et al. [20], exposure to recreational waters has been linked to high numbers (21 out of 31) of reported E. coli O157:H7 disease outbreaks in the United States from 1982 to 2002. In addition, direct ingestion or aerosols of contaminated water during spray irrigation and contaminated vegetable could cause infection.

The aim of this study was to use PCR method to detect four pathotypes of E. coli (ETEC, EPEC, EAEC, and EHEC) from water, sediment, fish, and crab samples. During the study, both PCR and culture-based methods were used.

2. Materials and Methods

2.1. Sampling Sites

The Aby Lagoon is located between 2°51 and 3°21 eastern longitude and 5°05 and 5°22 northern latitude southeast. The two main tributaries (Bia and Tanoe) are escape routes from anthropogenic and mining operations within Aby Lagoon's watershed in Côte d'Ivoire and Ghana (Figure 1). Six sampling stations spread throughout the Aby Lagoon were selected in view of the fact that these stations were subject to various discharges (wastewater, excreta). Station 1 is located near an urban area. Swimming and fishing are practiced here. Station 2 located at the mouth of the river Bia is a fishing zone. Stations 3 and 6, located, respectively, near the latrine on the pile of the Aby and Assomlan villages, are sites where recreational activities are constantly practiced. Stations 4 and 5 are fishing zones.

Figure 1

Study area and sampling stations [21].

2.2. Sampling

Six campaigns were carried out from June 2010 to March 2011 for the collection of water, sediment, fish, and crab samples. These six campaigns are distributed as follows: two campaigns for the rainy season (June-July), two for the flood season (September-October), and two for the dry season (February-March). At each sampling point, samples of water were collected in sterile glass bottles and those of sediments in stomacher bags. Samples of fish and crabs obtained from fishermen in Aby Lagoon were collected in stomacher bags. A total of 72 water samples and 36 sediment samples were analyzed, consisting of 12 water samples and six sediment samples collected per campaign. Thirty-six fish samples and 36 crab samples were analyzed, with six samples collected per campaign for each. A total of 180 lagoon samples were collected. Collected samples were transported to the laboratory in a cooler containing ice.

2.3. Isolation of Escherichia coli Strains

A total of 113 strains of E. coli were isolated from 72 samples of water, 36 samples of sediment, 36 samples of fish, and 36 samples of crab. E. coli isolates from water and sediment were obtained on Eosin Methyl Blue agar (EMB, BIOKAR) through the membrane filtration method. Briefly, 5 mL and 10 mL of water samples were filtered through 0.45 μm cellulose membrane filters (Millipore, Sartorius Stedim Biotech, Germany) and placed on Eosin Methyl Blue agar. For sediment analysis, dilutions (10−1, 10−2) were first performed with sterile buffer peptone water, and then volumes of 5 mL and 10 mL of each diluted sample were filtered as previously described and placed on Eosin Methyl Blue agar. For fish and crab analysis, 25 g of gut, flesh, and gills of fish and of gut and shell of crab from each sample was added to 225 mL of sterile buffer peptone water contained in a plastic stomacher bag and mixed. Decimal dilutions from this solution were then carried out in buffer peptone water. E. coli isolates from fish and crabs were obtained with desoxycholate agar (Becton Dickinson GmbH). All the Petri dishes were incubated at 44.5°C for 24 hours. In addition, isolates were purified on EMB, a selective medium for enterobacteria, and incubated as before. Metallic sheen colonies showing a dark central spot [22] were used as presumptive E. coli. Presumptive E. coli strains with positive indol, negative citrate, and negative urea were confirmed as E. coli. E. coli strain of American Type Culture Collection 25922 (ATCC 25922) was used as the control.

2.4. Detection of Virulence Genes by PCR

DNA of each isolate was extracted according to the boiling method. Approximately 5 to 10 colonies of an overnight bacterial culture were taken and suspended in 100 μL of distilled water. The mixture was stored at −20°C for 10 min and then boiled at 100°C for 10 min. After centrifugation in a Mikro 220R Hettich centrifuge at 14000 RPM for 10 min, supernatants were used for PCR amplification. The amplification reactions were carried out in a reaction mixture of 25 μL containing 10 μL of Master Mix 1x (5PRIME Hot Master Mix 2.5x Dominique DUTSCHER) (France), 1.4 μM concentration (each) of primers (Table 1), and 5 μL of the DNA template. The PCR amplification was performed using a thermocycler system (Applied Biosystems, 2720 Thermal Cycler, USA). The amplification program included an initial denaturation step at 94°C for 2 min, followed by 30 cycles of denaturation (94°C for 1 min), primer annealing (52°C for 1 min), and extension (65°C for 1 min), with a final extension at 65°C for 10 min. PCR products (10 μL) were resolved by electrophoresis on a 2.5% agarose gel (Promega, USA) at 120 mV for 80 min. Agarose gel was then stained with ethidium bromide (Sigma-Aldrich, USA), and the DNA bands were visualized and photographed under UV illumination (UV UVItec, UK). The buffer in the electrophoresis chamber (PCR SCIE-PLAS, China) and in the agarose gel was 1x Tris-borate-EDTA (89 mM Tris-borate, 2.5 mM EDTA).

Table 1

Primers used for PCR in this study [23].

Genes	Sequence (5′ to 3′)	Size (bp)	References
Eae	F CCC GAA TTC GGC ACA AGC ATA AGCR CCC GGA TCC GTC TCG CCA GTA TTC G	881	[24]
Stx	F GAG CGA AAT AAT TTATAT GTGR TGA TGA TGG CAA TTC AGT AT	518	[25]
AggR	F GTA TAC ACA AAA GAA GGA AGCR ACA GAA TCG TCA GCA TCA GC	254	[26]
Elt	F TCTCTATGTGCATACGGAGCR CCATACTGATTGCCGCAAT	322	[27]
Est	F TTAATAGCACCCGGTACAAGCAGGR CCTGACTCTTCAAAAGAGAAAATTAC	147	[28]

2.5. Serogrouping of E. coli Isolates

Detection of virulence strains among the 113 E. coli isolates was performed by O serogrouping with 12 antisera (Bio-Rad) by the slide agglutination method according to the manufacturer's instructions. The 12 immune sera tested in this study were O55, O26, O111, O86, O119, O127, O125, O126, O128, O114, O124, and O142.

3. Results

Sixty-two strains (55%) of the 113 strains tested were positive for virulence genes. Pathogenic strains of E. coli were more isolated in the sediment with a frequency of 70% of the cases, followed by the strains from water (68%). Virulence strains were least observed with the crabs (9%). No pathogenic strain of E. coli was detected in fish samples (Table 2).

Table 2

Distribution of E. coli strains.

	Source				Total
	Water	Sediment	Fish	Crab
Number of strains	62	27	13	11	113
Pathogenic strains	42 (68%)	19 (70%)	0 (0)	1 (9%)	62 (55%)
Nonpathogenic strains	20 (32%)	8 (30%)	13 (100%)	10 (91%)	51 (45%)

The four pathotypes of E. coli in this study according to the nature of the samples analyzed are shown in Table 3. Two E. coli pathotypes were identified, namely, enterotoxigenic E. coli (ETEC) with a percentage of 90% and enterohemorrhagic E. coli (EHEC) with a prevalence of 10%. These two pathotypes were observed in the samples of water, sediments, and crab. In water samples, 8% and 60% of the pathogenic strains belonged to EHEC and ETEC, respectively. For sediment samples, 2% of the cases of the virulent strains belonged to EHEC and 29% to ETEC. No strains of enteropathogenic E. coli (EPEC) and enteroaggregative E. coli (EAEC) were identified. The only pathogenic strain identified in the crab samples belonged to ETEC.

Table 3

Prevalence of E. coli pathotypes.

Source	Frequency (%)				Total
	Water	Sediment	Fish	Crab
Pathotype groups
EPEC	0	0	0	0	0
EHEC	5 (8%)	1 (2%)	0	0	6 (10%)
EAEC	0	0	0	0	0
ETEC	37 (60%)	18 (29%)	0	1 (2%)	56 (90%)
Total	42 (68%)	19 (31%)	0	1 (2%)	62 (100%)

Table 4 shows the prevalence of virulence genes according to the nature of the samples examined. The genes belonging to ETEC were the most detected with a frequency of 74% and 55% of the cases for the genes “est” and “elt,” respectively. These genes were identified in strains isolated from water, sediment, and crabs with the most important prevalence from the water samples (32% for “elt” gene and 50% for “est” gene). The ETEC strains harboring “est” gene were the most identified (74%). A prevalence of 35% of these strains possessed both the heat-labile toxin gene (elt) and the heat-stable toxin gene (est). About 10% of enterohemorrhagic E. coli (EHEC) harbored “stx” gene. The simultaneous presence of genes stx + est and elt + stx was also identified in some strains with a prevalence of 2% for each combination. Figure 2 shows the PCR amplification products of the target genes studies.

Table 4

Prevalence of virulence genes.

Pathotype groups	Frequency
	ETEC			EHEC
Genes	elt	est	elt + est	stx	stx + est	stx + elt
Source
Water	20 (32%)	31 (50%)	12 (19%)	5 (8%)	1 (2%)	1 (2%)
Sediment	13 (21%)	14 (22%)	9 (14%)	1 (2%)	0	0
Crab	1 (2%)	1 (2%)	1 (2%)	0	0	0
Total	34 (55%)	46 (74%)	24 (35%)	6 (10%)	1 (2%)	1 (2%)

Figure 2

Gel electrophoresis profile of different virulence genes of the potential diarrheagenic E. coli isolates. Lane MT: molecular size marker (100 bp DNA ladder). Lane 1: elt; lanes 2 and 4: elt and est; lanes 3, 5, 6, 7, 9, 10, and 12: nonpathogenic E. coli; lanes 8 and 11: est; T1: positive control (est, elt); T2: negative control.

The various serogroups of potential pathogenic E. coli according to the nature of samples are shown in Table 5. The results of the serogrouping by antisera showed that 37% of the 62 pathogenic E. coli isolates were typeable with the used antisera. Nine serogroups, namely, O114 (14%), O127 (6%), O55 (5%), and 2% for O111, O86, O119, O126, O128, and O142, were identified. The O114 serogroup was the most detected. Different serogroups identified are not specific to each group of pathotype (Table 6).

Table 5

Serogroups of potential pathogenic strains typeable.

Serogroups	Water	Sediment	Crabs	Total
O55	2	1	0	3 (5%)
O26	0	0	0	0
O111	1	0	0	1 (2%)
O86	1	0	0	1 (2%)
O119	1	0	0	1 (2%)
O127	3	1	0	4 (6%)
O125	0	0	0	0
O126	1	0	0	1 (2%)
O128	1	0	0	1 (2%)
O114	3	5	1	9 (14%)
O124	0	0	0	0
O142	1	0	0	1 (2%)
Total N (%)	14 (23%)	7 (12%)	1 (2%)	22 (37%)

Table 6

Relationship between virulence genes and O antigens.

Strains	Genes	Serogroups
S1	est, elt	ND
S2	est, elt	O114
S3	elt	ND
E1	est	ND
E2	stx, elt	O55
C1	est, elt	O114
S4	est, elt	O114
S5	est, elt	O114
E3	est	ND
E4	est, elt	ND
E5	est	O127
S6	est	ND
E6	stx, est	O114
E7	est	O111
S7	stx	ND
E8	elt	ND
E9	stx	ND
E10	est, elt	ND
S8	est, elt	ND
E11	est, elt	O127
S9	elt	ND
E12	elt	ND
S10	elt	ND
E13	est, elt	O114
E14	est, elt	ND
E15	est, elt	ND
E16	elt	ND
S11	est, elt	O114
E17	est	ND
E18	est	ND
E41	est, elt	ND
E19	est, elt	ND
E20	est	O114
E21	stx	O127
E22	elt	ND
E23	est	O126
S12	est	O127
E24	est	ND
E25	est	ND
E26	est	ND
S13	est	ND
E42	est	ND
E27	elt	ND
E28	est, elt	ND
E29	est	ND
S14	est, elt	O55
E30	est	O142
E31	est	O128
S15	est, elt	ND
E32	elt	ND
E33	stx	ND
E34	est	O119
S16	est	O55
S17	est	O114
E35	est, elt	O86
E36	est	ND
E37	elt	ND
E38	est, elt	ND
E39	elt	ND
S18	est, elt	ND
E40	est, elt	ND
S19	est	ND

ND: not determined.

4. Discussion

Results of the prevalence of potential pathogenic E. coli strains found in water (68%) and sediment (70%) samples were similar to those reported by Obi et al. [14] from water and sediment of six rivers in South Africa. These results could be explained by the fact that this lagoon received all effluents. Indeed, several effluents are released often without any treatment in the lagoon. Kambiré et al. [29] showed that the Aby Lagoon was influenced by continental waters. In addition, these authors indicated that most of the household members (93%) living in places without latrines defecated directly into the lagoon. The prevalence of nonpathogenic E. coli was 45%. According to Bekal et al. [30], Escherichia coli is a normal inhabitant of the intestinal tract of humans and warm-blooded animals. Despite being usually harmless, various E. coli strains have acquired genetic determinants (virulence genes) rendering them pathogenic for both humans and animals.

The pathogenic E. coli strains found in this study belong to two different pathotypes: ETEC and EHEC. ETEC (90%) represents the most frequent pathotype. This result is similar to those reported by Salem et al. [6]. ETEC was identified as the common cause of infections among tourists visiting Asia, Africa, and South America and also as a common diarrheal pathogen in children in many developing countries of Asia, Africa, and South America [31, 32].

The prevalence of heat-stable toxin gene (est) of ETEC was 74% of the strains tested compared to the heat-labile toxin gene (lt), 55%. Other studies showed predominance of “est” gene [33, 34]. Several authors have also reported the simultaneous presence of the genes est and lt in ETEC [32, 35, 36] like in this study. According to Munshi et al. [37], the genes encoding LT (elt or etx) reside on plasmids that also may contain genes (est) encoding ST.

The prevalence of EHEC pathotype was 10%. This frequency is lower than that obtained by Ndlovu et al. [15] which was 15% in their study on the characterization of E. coli isolated from surface water sources. However, frequency in this study is higher than that obtained by Obi et al. [14] which was 2% in South African rivers. Our prevalence is approximately similar to those reported by Dadié et al. [38] in 1780 samples of food (meat and dairy products) and 1416 patients in Côte d'Ivoire. One isolate harbored the combination of stx and elt genes and another stx and est genes. An association gene was also observed by Moalic and Guennec [39] from E. coli strain causing diarrhea in pigs in France. According to Titilawo et al. [16], the lower prevalence of the EHEC pathotype compared to other pathotypes suggests that human fecal contamination is the main source of diarrheagenic E. coli pathotypes in the surface water as opposed to contamination from animals. Contrary to the studies of Sidhu et al. [40] and Titilawo et al. [16] in the characterization of E. coli from surface water and rivers in Southwestern Nigeria, respectively, genes for EPEC (eae) and EAEC (AggR) were not detected in this study.

Phenotype assays such as serogrouping with traditional antisera are the routine methods that have been widely used in clinical laboratories [41]. Serogrouping has been shown to be insufficient for the identification of a particular pathotype group. The 12 antisera specific for EPEC group according to the WHO are permitted to detect other pathotype E. coli groups like ETEC and EHEC in this study. Nine serogroups were identified in this study. Among the identified serogroups, the O114 serogroup was the most isolated. This serogroup has been the cause of an epidemic of infantile gastroenteritis in England [42].

5. Conclusion

This study shows the presence of pathotypes of E. coli in water, sediment, and crab. The pathogenic E. coli belongs to two different pathotypes: ETEC and EHEC. ETEC represented the most frequent pathotype. Nonpathogenic strains of E. coli were also identified in all samples analyzed, especially in fish samples. Nine serogroups have been identified with O114 as majority group. This study shows the importance of controlling sources of human fecal pollution, such as municipal wastewater management, to reduce potential risks to human health. In this sense, all latrines built on pile should be suppressed. The domestic water must also be treated before being discharged into the lagoon.