Literature DB >> 28659929

Involvement of MicroRNAs in Probiotics-Induced Reduction of the Cecal Inflammation by Salmonella Typhimurium.

Qiaoling Chen1, Chao Tong1, Shaoyang Ma1, Luoxiong Zhou1, Lili Zhao1, Xin Zhao1,2.   

Abstract

The microRNAs (miRNAs) have been shown to play important roles in the development of the immune system and in regulation of <span class="Disease">host inflammation responses. Probiotics can effectively alleviate the <span class="Disease">inflammation caused by Salmonella in chickens. However, whether and how miRNAs are involved in modulation of the inflammation response in the gut of chickens have not been reported. In this study, the impact of a probiotics, Lactobacillus plantarum Z01 (LPZ01), was investigated on the cecal miRNAs and cytokine secretions in Salmonella Typhimurium (S. Typhimurium)-infected chickens at the age of 3 days. Newly hatched chicks were assigned to four groups (1): NC (basal diet) (2): S (basal diet + S. Typhimurium challenged) (3): SP (basal diet + S. Typhimurium challenged + LPZ01) (4): P (basal diet + LPZ01). In comparison with the S group, chicks in the SP group reduced the number of S. Typhimurium and had lower levels of interferon-γ and lipopolysaccharide-induced tumor necrosis factor alpha factor (LITAF) in ceca post challenge. Expression of 14 miRNAs was significantly affected by the presence of S. Typhimurium and/or lactobacillus. Five differential expression miRNAs (gga-miR-215-5p, gga-miR-3525, gga-miR-193a-5p, gga-miR-122-5p, and gga-miR-375) were randomly selected for confirmation by the RT-PCR. Predicted target genes of differentially expressed miRNAs were enriched in regulation of cAMP-dependent protein kinase activity, stress-activated MAPK cascade, immune system development and regulation of immune system process as well as in immune related pathways such as MAPK and Wnt signaling pathways. The relationship between changes of miRNAs and changes of cytokines was explored. Finally, 119 novel miRNAs were identified in 36 libraries totally. Identification of novel miRNAs significantly expanded the repertoire of chicken miRNAs and provided the basis for understanding the function of miRNAs in the host. Our results suggest that the probiotics reduce the inflammation of the S. Typhimurium infection in neonatal broiler chicks, at least partially, through regulation of miRNAs expression.

Entities:  

Keywords:  Salmonella; ceca; chickens; microRNAs; probiotics

Year:  2017        PMID: 28659929      PMCID: PMC5468434          DOI: 10.3389/fimmu.2017.00704

Source DB:  PubMed          Journal:  Front Immunol        ISSN: 1664-3224            Impact factor:   7.561


Introduction

<span class="Disease">Salmonellosis is one of the most common and widely distributed <span class="Disease">foodborne diseases with tens of millions of human cases worldwide every year. One of the main causes for Salmonellosis in humans is contaminated poultry-derived foods, mainly eggs and egg products but also chicken meat. Salmonella Typhimurium (S. Typhimurium) infect many animal species, including humans and poultry, resulting in a spectrum of outcomes ranging from severe disease to asymptomatic carriage. Salmonellosis in the human is mainly caused by Salmonella Enteritidis (S. Enteritidis) and S. Typhimurium (1). S. Typhimurium infection in chicks younger than 2 weeks old also results in enteric and systemic disease with a high mortality rate, while infection in older chicks results in asymptomatic cecal colonization with persistent shedding of the organisms in feces (2). Decreasing the prevalence of <span class="Species">Salmonella in poultry flocks may effectively reduce <span class="Disease">salmonellosis in humans. For example, in Belgium, as in most of the EU, the incidence of salmonellosis has decreased since 2003 after the implementation of national plans (3). Many effective management strategies to control Salmonella infection in poultry include preventive hygienic measures, nutritional, and immune modulation strategies (3). Among the immune modulation strategies, probiotics confer the health benefit on the host when administered in adequate amounts. In addition to be used for control of specific enteric pathogens, probiotics are becoming accepted as potential alternatives to antibiotics as growth promoters. The probiotics can effectively reduce the Salmonella colonization, possibly through the competitive exclusion by probiotic bacteria. Despite the fact that many studies have showed the beneficial effects of probiotics for reducing Salmonella infection in chickens, the underlying mechanisms for the health benefits of probiotics, specifically for reduction of Salmonella infection, are still not fully understood. Mature microRNAs (miRNAs) are an abundant class of small non-coding RNAs with 18–25 nt in length that posttranscriptionally modulate the expression of their target genes by binding to the 3′-untranslated regions (4). They participate in development of the immune system and in regulation of <span class="Disease">host inflammation responses to the gut microbes, including both pathogenic and non-pathogenic bacteria (5). During comprehensive analyses of the impact of two <span class="Species">Lactobacillus species, Lactobacillus paracasei CNCM I-3689 and Lactobacillus casei BL23, on Listeria monocytogenes infection in a gnotobiotic mouse model, Archambaud et al. (6) found that three miRNAs (miR-192, miR-200b, and miR-215) were repressed during L. monocytogenes infection and treatment with each Lactobacillus increased miR-192 expression, whereas only L. casei increased miR-200b and miR-215 expression in ilea. The situation is different in conventional mice due to the presence of the endogenous microbiota. L. monocytogenes infection reduced expression of miR-143, miR-148a, miR-200b, miR-200c, and miR-378 in intestine upon L. monocytogenes infection (7). Similarly, Singh et al. (8) demonstrated that 16 miRNAs were differentially expressed in ceca of germ-free versus conventional mice. Nata et al. (9) reported that overexpression of miR-146b activated the NF-κB pathway, improved epithelial barrier function, ameliorated intestinal inflammation in dextran sulfate sodium-induced colitis mice. Hoeke et al. (10) found that Salmonella infection led to miR-29a upregulation by targeting caveolin 2 in the ileum of piglets. These studies exemplified changes and functions of miRNAs in the intestine of different animals reacting to normal microbiota or pathogenic bacteria. However, up to now, there is little information for miRNAs in poultry intestine. In this study, we hypothesized that <span class="Disease">Salmonella infection and probiotic supplementation might change miRNAs expression in ceca of neonatal broilers. In order to evaluate whether supplementation of probiotics was effective to change miRNAs expression and thus reduce <span class="Disease">Salmonella infection in neonatal broilers, we performed the miRNA sequencing of cecal samples from Salmonella infected and probiotic-supplemented chicks in addition to measuring the mRNAs expression of three pro-inflammatory cytokines and loads of Salmonella in the ceca.

Bacterial Culture

A <span class="Species">S. Typhimurium (CVCC542) strain with <span class="Chemical">novobiocin resistance was obtained from the China Veterinary Culture Collection Center and used in this study. The bacterium was cultured at 37°C in the Luria Bertani (LB) medium (Difco, Franklin Lakes, NJ, USA) containing 25 µg of novobiocin per milliliter for 16 h with shaking before being used for the challenge. The number of colony-forming units (CFUs) of S. Typhimurium was determined by plating serial dilutions on plate count agar plates and 1 × 108 CFU in 0.2 mL sterilized phosphate-buffered saline (PBS, pH 7.2) was used to infect chickens.

Probiotic Culture

The <span class="Species">Lactobacillus plantarum <span class="CellLine">Z01 (LPZ01), which was previously used in the study of Feng et al. (11), was grown on the Man-Rogosa-Sharpe Broth (MRS, Difco) under anaerobic conditions at 37°C for 24 h every time before use. Whole cells of the LPZ01 were obtained by centrifugation at 12,000 × g for 10 min at 4°C and washed twice with PBS. Then the LPZ01 culture was diluted in reconstituted powdered skim milk to an expected concentration of 1 × 108 CFU/mL for oral gavage to chicks. Actual CFUs administered per chick were determined retrospectively.

Birds, Experimental Design, and Sample Collection

Newly hatched commercial male broiler <span class="Species">chickens (Arbor Acres) were obtained from a local hatchery in Xianyang city, Shaanxi province of China. Birds were housed and maintained in a clean and sterile house with age-appropriate temperatures and 60–70% humidity, receiving <span class="Chemical">water and diets ad libitum. A standard chick starter diet, containing no antimicrobial additives, was formulated according to the NRC requirement (23% protein and 3,029 kcal/kg metabolizable energy) and the main ingredients of the diet were corn and soybean meal. A total of 144 chicks were randomly assigned into four treatments, including (1) an uninfected control group (NC: negative control); (2) a positive control group infected with S. Typhimurium (S: S. Typhimurium); (3) a group infected with S. Typhimurium and orally supplemented with LPZ01 (SP: S. Typhimurium + probiotic); (4) a group only orally supplemented with LPZ01 (P: probiotic) (Figure 1). Each treatment had six cages with six birds in each cage. As shown in Figure 1, infections were carried out by oral gavage of 0.2 mL novobiocin-resistant S. Typhimurium (1 × 108 CFU in 0.2 mL) at 3 days of age in the S and SP group, whereas chicks in the NC and P groups orally received 0.2 mL PBS. Birds were moved to another house before challenge. LPZ01 in reconstituted powdered skim milk was administered via oral gavage (0.2 mL) to SP and P groups every day, while other two groups received reconstituted powdered skim milk only.
Figure 1

The experimental design. Newly hatched chicks were divided into four treatment groups (n = 6 cages/treatment; 6 chicks in each cage), (1) an uninfected negative control group (NC: negative control); (2) a positive control group infected with S. Typhimurium (S: S. Typhimurium); (3) a group infected with S. Typhimurium and orally supplemented with Lactobacillus plantarum Z01 (LPZ01) (SP: S. Typhimurium + probiotic); (4) a group only orally supplemented with LPZ01 (P: probiotic).

The experimental design. Newly hatched <span class="Species">chicks were divided into four treatment groups (n = 6 cages/treatment; 6 <span class="Species">chicks in each cage), (1) an uninfected negative control group (NC: negative control); (2) a positive control group infected with S. Typhimurium (S: S. Typhimurium); (3) a group infected with S. Typhimurium and orally supplemented with Lactobacillus plantarum Z01 (LPZ01) (SP: S. Typhimurium + probiotic); (4) a group only orally supplemented with LPZ01 (P: probiotic). Six birds per treatment were euthanized by cervical dislocation on days 1, 3, and 5 after the <span class="Species">S. Typhimurium challenge. From each bird, one of the ceca (with contents) was placed in a 2 mL tube containing 1 mL of sterile <span class="Chemical">PBS, weighted, and grinded with Scientz-48 Tissue Grind (Scientz Biotechnology Co. Ltd., Ningbo, China) for Salmonella enumeration as previously described (12). Another cecum was collected from each bird, placed in the RNA later RNA Stabilization Reagent (QIAGEN, Shanghai, China) and stored at −80°C until RNA extraction. All experimental protocols used in this experiment were approved by the Northwest A&F University Institutional Animal Care and Use Committee (protocol number NWAFAC1025).

Detection of Cecal Salmonella

Homogenized cecal samples (with contents) were serially diluted in sterile <span class="Chemical">PBS right after sample collection. From each dilution, 0.1 mL was then plated in triplicate on <span class="Chemical">Brilliant Green Sulfa Agar (BD Diagnostics, Sparks, MD, USA) containing 25 µg of novobiocin/mL. Plates were incubated for at least 24 h at 37°C. The average values of number of Salmonella CFU were used for the statistical analysis. Salmonella counts between the S and SP groups were compared using the Student’s t-test using the SPSS for Windows version 17.0 (Chicago, IL, USA). The P < 0.05 was considered statistically significant.

Small RNA Library Construction and Solexa Sequencing

Thirty six miRNA libraries from four treatments at three time points with three repeats in each treatment were constructed. Small RNAs were extracted with the mirVana™ miRNA Isolation Kit (Cat#. AM1561, Ambion, Austin, TX, USA) according to the <span class="Species">manufacturer’s instruction. RNA integrity and concentration were confirmed using an Agilent 2100 Bioanalyzer (Agilent technologies Santa Clara, USA). Low molecular weight RNAs were separated by 15% <span class="Chemical">polyacrylamide gel electrophoresis (PAGE) and RNA molecules in the range of 18–35 nt were enriched and ligated with proprietary adapters to the 5′ and 3′ terminal. A reverse transcription reaction followed by PCR was performed to obtain sufficient products for Illumina deep sequencing with HiSeq 2500 (Illumina) by the Illumina Genome Analyzer in Shanghai Biotechnology Corporation (Shanghai, China).

Bioinformatics Analysis of Deep Sequencing Data

The raw sequences were preprocessed by the FASTXToolkit (fastx_toolkit-0.0.13.2) to filter out the low-quality reads, as well as sequences with 3′ primers, with 5′ primer, with polyA tails, or with insert tags. Further annotation analyses were performed using the commercial software CLC Genomic Workbench 5.5. Briefly, the resulting clean reads were aligned against various databases, including ncRNA, piRNA, and Rfam, allowing a maximum mismatch of 2 nt to remove non-coding RNA, such as rRNA, tRNA, snRNA, and snoRNA. The remaining reads were analyzed by BLAST searches against <span class="Species">chicken miRNA mature sequences and precursor structures that have been annotated in the miRBase (version 21.0) to identify conserved miRNAs. Only those small RNAs perfectly matching known <span class="Species">chicken miRNAs or precursors in the miRBase were considered as conserved mature miRNAs. Sequences that cannot match the sequences in the above database were analyzed by the miRCat program in the sRNA Toolkitsoft page (13) against the chicken genome. The genomic hit distribution patterns and secondary structure of genomic regions corresponding to sRNA hits were observed and mature miRNAs and their precursor structures were predicted. The precursors with stem-loop hairpins were predicted when their minimum free energy and Randfold P-value were lower than −20 kcal/mol and 0.1, respectively (14). After all annotation steps, the sequences were used for size distribution and saturation analyses.

Analyses of Differentially Expressed miRNA

To compare differentially expressed miRNAs among multiple samples, the sequences less than five total reads counts were removed first in the all libraries and the miRNA abundance of the remaining reads was normalized as RPKM (reads per kilobase per million reads) and the edgeR package (15) was used to identify statistically differential expression miRNAs. Differentially expressed miRNAs were defined as P-value <0.05 and |logFC| > 1. The heatmap of these differentially expressed miRNAs was constructed using the HemI software (16).

Prediction of Differentially Expressed miRNA Targets and Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Analyses

Based on the sequences of the miRNAs, the target genes of differentially expressed miRNAs were predicted using the online database miRDB (17) and TargetScan. The common target genes predicted by both software programs were selected for GO functional annotation and KEGG pathway analyses, unless otherwise stated. The KOBAS (kobas3.0-20170316) (18) software was used for GO and KEGG pathway analyses. The Fisher’s exact test was used and a P-value less than 0.05 was used as the cutoff criterion for the GO and KEGG pathway analyses. The KEGG pathway plot was produced by the ggplot2 package (19).

Validation of Differentially Expressed miRNAs and Cytokine Expression in Cecal Samples

Five randomly selected differentially expressed miRNAs were validated by the stem-loop RT-PCR (20) and relative expression of cytokine genes in the cecal tissue was determined by RT-PCR. Total RNA was extracted from every cecal sample using the RNAiso Plus (Takara, Dalian, China) according to the <span class="Species">manufacturer’s instruction. The RNA quantity was checked using a NanoDrop 2000 spectrophotometer (Thermo Scientific, MA, USA) and RNA was then converted to cDNA with the miRNAs RT special primer mixture or oligo (dT) primers, using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). The cDNA was used as a PCR template for real-time qPCR quantification of miRNA or cytokine mRNA expression. The <span class="Species">chicken 5s rRNA gene and GAPDH gene were used as endogenous controls of miRNAs and cytokines genes, respectively. The qPCR was performed using a Bio-Rad CFX 96™ Real-Time Detection System (Bio-Rad Laboratories, USA) and SYBR Green PCR Master Mix (Takara) in a final volume of 20 µL. The primers for miRNAs and cytokine genes were designed and listed in Table 1. All reactions were carried out in triplicate. The thermal cycle profile included an initial activation step at 95°C for 30 s, followed by 40 cycles of 95°C for 10 s (denaturation), 55–60°C (depending on the primer as described in Table 1) for 20 s (annealing) and 72°C for 10 s (extension). The data were the means of three separate experiments and were analyzed using the 2−ΔΔCT method (21).
Table 1

Primers used for qPCR analyses.

TargetPrimerSequence (5′–3′)Annealing Temp (°C)Products (bp)Reference
IL-6FaRbATCCCTCCTCGCCAATCTGGCACTGAAACTCCTGGTCT58142(12)
Interferon-γFRATCATACTGAGCCAGATTGTTTCCGCCATCAGGAAGGTTGT56124(12)
Lipopolysaccharide-induced tumor necrosis factor alpha factorFRTACCCTGTCCCACAACCTGTGAACTGGGCGGTCATAGA58152(12)
GAPDHFRTGGAGAAACCAGCCAAGTATGCATCAAAGGTGGAGGAAT55145(12)
Gga-miR-215-5pRTcFGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTCTGTGCCGCATGACCTATGAATTG6060This study
Gga-miR-3525RTFGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCACAGAGCCCGCAGCCATTCTGCGAT6061This study
Gga-miR-193a-5pRTFGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCATCTCGCCCGTGGGTCTTTGCGGGC6061This study
Gga-miR-122-5pRTFGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAAACGCCCGTGGAGTGTGACAATGGT6062This study
Gga-miR-375RTFGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAACGCGCCCGTTTGTTCGTTCGGCTC6061This study
Universal PrimerdRGTGCAGGGTCCGAGGT60This study
5s rRNAFRGGAGGTCTCCCATCCAAGTAACGCCCGATCTCGTCT6097This study

.

.

Primers used for qPCR analyses. . .

Results

Effect of LPZ01 on the Cecal Number of Salmonella

No <span class="Species">S. Typhimurium colony was recovered from the ceca of the uninfected groups. In comparison with the S group, <span class="Chemical">LPZ01 significantly reduced (P < 0.05) the S. Typhimurium counts by 97.92, 83.37, and 42.37% at day 1, day 3, and day 5 after the Salmonella challenge, respectively (Table 2).
Table 2

The effects of Lactobacillus plantarum Z01 on the Salmonella counts from the cecal content of chicks after 1, 3, and 5 days postinoculation with Salmonella Typhimurium.

Cecal content colony-forming unit (×105)/g1 day postinfection3 days postinfection5 days postinfection
S252 ± 12.65a44.01 ± 3.28a17.82 ± 4.31a
SP5.24 ± 0.59b7.32 ± 1.06b10.27 ± 1.16b

.

The effects of <span class="Species">Lactobacillus plantarum <span class="CellLine">Z01 on the Salmonella counts from the cecal content of chicks after 1, 3, and 5 days postinoculation with Salmonella Typhimurium. .

Analyses of Sequencing Data

More than 10,000,000 clean raw reads were generated from each of 36 samples. After trimming of adaptors and eliminating the low-quality reads, more than 9,000,000 effective reads were obtained for each sample. The effective read ratio of the samples was more than 90% and most of them were more than 95% (Table 3). The majority of reads for small RNAs were 20–24 nt in length and the highest numbers of reads appeared at the length of 22 nt (Figure S1 in Supplementary Material).
Table 3

The effective reads in each cecal sample.

Sample namesRaw readsEffective readsEffective ratio (%)
NC-1-d1116740941136231897.33
NC-2-d1119279551156200696.93
NC-3-d1140883141368771097.16
S-1-d1140111201361112197.15
S-2-d1141943891359498095.78
S-3-d1135814551321594497.31
SP-1-d1152058291484762397.64
SP-2-d1127173981179333992.73
SP-3-d1113485141096219096.60
P-1-d1118243301136356696.10
P-2-d1143467471397085797.38
P-3-d1112121111081580596.47
NC-1-d3127553931228599596.32
NC-2-d3109076171053792296.61
NC-3-d3106637811028433496.44
S-1-d3110438811043958394.53
S-2-d3111402411060326695.18
S-3-d3128337021254773897.77
SP-1-d3118321941158372297.90
SP-2-d310003511929211492.89
SP-3-d310365290988185995.34
P-1-d3108987611039238395.35
P-2-d3121396051171430496.50
P-3-d3110864041043021794.08
NC-1-d5124223201144862692.16
NC-2-d510513113952158790.57
NC-3-d510797484997545292.39
S-1-d5112516041050022693.32
S-2-d5120215041167825997.14
S-3-d5111269631087939597.78
SP-1-d5107091761039921797.11
SP-2-d5115051731048467691.13
SP-3-d5151512401417711593.57
P-1-d5116390011137642897.74
P-2-d5147204141408974595.72
P-3-d5137651871308263295.04
The effective reads in each cecal sample. In mature known <span class="Species">chicken miRNAs of the 36 libraries, 20 highly expressed miRNAs accounted for 89.16% of the total reads of identified known miRNAs (Table 4). The top five highly expressed miRNAs were gga-<span class="Gene">miR-215-5p, gga-miR-10b-5p, gga-miR-21-5p, gga-miR-26-5p, and gga-miR-22-3p, accounting for 40.54, 7.76, 6.78, 6.43, and 6.35% of total known miRNA reads, respectively.
Table 4

Top 20 expressed microRNAs (miRNAs) in chicken ceca in all treatment groups.

miRNA nameTotal number of readsRatioa
All samples (%)NC group (%)S group (%)SP group (%)P group (%)
miR-215-5p6891743440.5443.5742.4733.6842.12
miR-10b-5p131862197.767.567.249.676.76
miR-21-5p115193236.785.756.438.096.80
miR-26a-5p109314456.436.366.436.916.08
miR-22-3p108033196.355.806.107.026.47
miR-10a-5p47430392.792.652.633.232.67
miR-148a-3p40799482.402.262.362.722.28
miR-19439995562.352.552.521.942.39
miR-92-3p32544381.911.921.881.941.91
miR-30d32063181.891.81.782.021.94
miR-181a-5p31065861.831.791.851.981.71
miR-429-3p24976981.471.381.391.541.55
let-7f-5p23102121.361.331.311.491.31
miR-30a-5p16513250.970.930.971.050.94
miR-133a-3p15866200.930.900.941.020.89
miR-199-3p14305840.840.810.820.950.80
miR-30c-5p14197960.840.840.770.840.88
miR-200a-3p12299850.720.690.680.770.75
miR-126-5p11900780.700.670.690.770.67
miR-27b-3p10754890.630.520.610.750.64
Total for the above15213941289.1690.0889.8788.3889.57

.

Top 20 expressed microRNAs (miRNAs) in <span class="Species">chicken ceca in all treatment groups. . One hundred 19 novel miRNAs were identified from the candidate miRNAs that met both the expression and biogenesis criteria. The length of novel miRNAs ranged from 18 to 23 nt and the sequences of the mature miRNA and miRNA precursors of these novel ones were identified and shown in Table S1 in Supplementary Material.

Validation of Differentially Expressed miRNAs

To determine the effects of <span class="Species">S. Typhimurium and <span class="Chemical">LPZ01 on miRNA expression in chicken ceca, expression of miRNAs in groups PC, S, and SP was compared with the NC group at three sampling time points. A total of 14 differentially expressed miRNAs were detected (gga-miR-2954, gga-miR-215-3p, gga-miR-1798-5p, gga-miR-194, gga-miR-217-3p, gga-miR-1769-3p, gga-miR-1788-3p, gga-miR-1559-3p, gga-miR-3531-3p, gga-miR-215-5p, gga-miR-3525, gga-miR-193a-5p, gga-miR-122-5p, and gga-miR-375). The heatmap analysis showed the relative changes of these miRNAs relative to the NC group (Figure 2).
Figure 2

The heatmap of 14 differentially expressed microRNA (miRNAs) (P < 0.05, |logFC| > 1) in the chicken ceca, with or without Salmonella Typhimurium infection as determined by edgeR analysis of normalized sequence reads corresponding to known chicken miRNAs, logFC was computed as log2 between the treatment groups and the NC group. The heatmap for each miRNA was calculated based on its minimal and maximal recorded expressions. Sd1-NCd1: the difference between the S group and the NC group 1 day after S. Typhimurium infection; SPd1-NCd1: the difference between the SP group and the NC group 1 day after S. Typhimurium infection; Pd1-NCd1: the difference between the P group and the NC group 1 day after S. Typhimurium infection; Sd3-NCd3: the difference between the S group and the NC group 3 days after S. Typhimurium infection; SPd3-NCd3: the difference between the SP group and the NC group 3 days after S. Typhimurium infection; Pd3-NCd3: the difference between the P group and the NC group 3 days after S. Typhimurium infection; Sd5-NCd5: the difference between the S group and the NC group 5 days after S. Typhimurium infection; SPd5-NCd5: the difference between the SP group and the NC group 5 days after S. Typhimurium infection; Pd5-NCd5: the difference between the P group and the NC group 5 days after S. Typhimurium infection.

The heatmap of 14 differentially expressed microRNA (miRNAs) (P < 0.05, |logFC| > 1) in the <span class="Species">chicken ceca, with or without <span class="Disease">Salmonella Typhimurium infection as determined by edgeR analysis of normalized sequence reads corresponding to known chicken miRNAs, logFC was computed as log2 between the treatment groups and the NC group. The heatmap for each miRNA was calculated based on its minimal and maximal recorded expressions. Sd1-NCd1: the difference between the S group and the NC group 1 day after S. Typhimurium infection; SPd1-NCd1: the difference between the SP group and the NC group 1 day after S. Typhimurium infection; Pd1-NCd1: the difference between the P group and the NC group 1 day after S. Typhimurium infection; Sd3-NCd3: the difference between the S group and the NC group 3 days after S. Typhimurium infection; SPd3-NCd3: the difference between the SP group and the NC group 3 days after S. Typhimurium infection; Pd3-NCd3: the difference between the P group and the NC group 3 days after S. Typhimurium infection; Sd5-NCd5: the difference between the S group and the NC group 5 days after S. Typhimurium infection; SPd5-NCd5: the difference between the SP group and the NC group 5 days after S. Typhimurium infection; Pd5-NCd5: the difference between the P group and the NC group 5 days after S. Typhimurium infection. To confirm and quantify the differential expression, five miRNAs (gga-<span class="Gene">miR-215-5p, <span class="Gene">gga-miR-3525, gga-miR-193a-5p, gga-miR-122-5p, and gga-miR-375) were randomly selected and validated by RT-PCR with six replicates of cecal samples in each group (Figure 3). The results indicated that the miRNA expression patterns were similar to those determined by the next-generation sequencing (NGS) (Figure S2 in Supplementary Material). One day after the S. Typhimurium infection, gga-miR-3525 increased (3.651, 6.508, 1.859 fold change in the S, SP, and P groups, respectively), while gga-miR-122-5p decreased in the S, SP, and P groups (0.667, 0.796, and 0.401 fold change, respectively) compared with the NC group. Gga-miR-193a-5p decreased in the S and SP groups (0.438- and 0.432-fold change, respectively) and was not significantly changed in the P group, while gga-miR-215-5p and gga-miR-375 were not significantly changed among different treatment groups. Three days post the challenge, expression of gga-miR-215-5p and gga-miR-3525 decreased significantly, while gga-miR-193a-5p increased in the S, SP, and P groups as compared with the NC group. The expression of gga-miR-122-5p increased 1.957-fold in the SP group and decreased 0.792-fold in the P group. Gga-miR-375 decreased in the S and SP group (0.231- and 0.115-fold change) and increased in the P group (1.324 fold change). At 5 days post S. Typhimurium challenge, expression of gga-miR-193a-5p and gga-miR-375 were not significantly changed in all treatment groups. Besides, gga-miR-215-5p increased in the P group (2.003 fold change) and gga-miR-3525 increased in the S group (8.604-fold change) compared with NC group. Gga-miR-122-5p decreased 0.782- and 0.501-fold change in the SP and P groups, respectively. Both the probiotic and S. Typhimurium changed the expression of miRNAs in the ceca of broilers.
Figure 3

Expression of five randomly selected microRNA in ceca by qPCR. Different letters above bars indicate significant differences among treatments within each sampling day (P < 0.05). Samples were collected from one bird per cage (n = 6/treatment) at day 1 (A), day 3 (B), and day 5 (C) after oral gavage with PBS or S. Typhimurium. NC: an uninfected control group; S: a positive control group infected with S. Typhimurium; SP: a group infected with S. Typhimurium and orally supplemented with Lactobacillus plantarum Z01 (LPZ01); P: a group only orally supplemented with LPZ01.

Expression of five randomly selected microRNA in ceca by qPCR. Different letters above bars indicate significant differences among treatments within each sampling day (P < 0.05). Samples were collected from one bird per cage (n = 6/treatment) at day 1 (A), day 3 (B), and day 5 (C) after oral gavage with <span class="Chemical">PBS or <span class="Species">S. Typhimurium. NC: an uninfected control group; S: a positive control group infected with S. Typhimurium; SP: a group infected with S. Typhimurium and orally supplemented with Lactobacillus plantarum Z01 (LPZ01); P: a group only orally supplemented with LPZ01. In comparison with the S group, the <span class="Chemical">SP group significantly increased <span class="Gene">gga-miR-3525 (1.783-fold change) expression on day 1 after the infection and gga-miR-193a-5p and gga-miR-122-5p expression on day 3 after the infection (1.719- and 1.860-fold changes, respectively). On the other hand, the SP group significantly reduced expression of gga-miR-3525 and gga-miR-122-5p on day 5 post the infection (15.227- and 5.509-fold changes, respectively). These results could reflect reduced numbers of S. Typhimurium and consequent less inflammation in ceca by the probiotics.

Enriched KEGG Pathways and GO Functional Categories of Predicted Gene Targets of Differentially Expressed miRNAs

Target genes of 14 differentially expressed miRNAs (gga-<span class="Gene">miR-122-5p, gga-miR-193a-5p, gga-miR-194, gga-<span class="Gene">miR-215-5p, gga-miR-217-3p, gga-miR-375, gga-miR-1559-3p, gga-miR-1769-3p, gga-miR-1788-3p, gga-miR-1798-5p, gga-miR-2954, gga-miR-3525, and gga-miR-3531-3p) were predicted by using the miRDB and TargetScan programs. Three hundred forty-nine target genes of the 14 miRNAs were obtained by both miRDB and TargetScan programs (Table S2 in Supplementary Material). The enriched GO terms were listed in Table S3 in Supplementary Material, while enriched KEGG pathways were presented in Figure 4. Among the enriched pathways, more target genes were involved in the insulin signaling pathway, the MAPK signaling pathway and the Wnt-signaling pathway than in other pathways (Figure 4).
Figure 4

The enriched kyoto encyclopedia of genes and genomes (KEGG) pathways of target genes for 14 differentially expressed microRNAs. The x-axis indicates the gene ratio and the y-axis indicates the name of the KEGG pathway. The size of the dot indicates the number of target genes, and the color of the dot indicates different p value (Fisher’s Exact Test). The gene ratio indicates the ratio between the number of target genes associated with a KEGG pathway and the total number of genes in the pathway.

The enriched kyoto encyclopedia of genes and genomes (KEGG) pathways of target genes for 14 differentially expressed microRNAs. The x-axis indicates the gene ratio and the y-axis indicates the name of the KEGG pathway. The size of the dot indicates the number of target genes, and the color of the dot indicates different p value (Fisher’s Exact Test). The gene ratio indicates the ratio between the number of target genes associated with a KEGG pathway and the total number of genes in the pathway.

Expression of Cytokine Genes

The relative mRNA expression of interleukin (IL)-6, interferon (IFN)-γ, and lipopolysaccharide-induced <span class="Disease">tumor necrosis factor alpha factor (<span class="Gene">LITAF) over the course of the infection was evaluated using the qPCR method. One day post the S. Typhimurium challenge, the relative expression of IL-6 and IFN-γ was downregulated in the both S and SP groups and upregulated in the P group in comparison with the NC group, whereas no significant differences were observed in the expression of LITAF among treatment groups (Figure 5A). Three days after the infection, expression of IL-6 was significantly increased in the S and SP groups in comparison with the NC and P groups. At the same time point, the relative expression of LITAF and IFN-γ were significantly increased in the S group compared to those in other three groups (Figure 5B). Five days post the challenge, expression of IL-6, IFN-γ, and LITAF in the S group was higher than the other groups (Figure 5C).
Figure 5

Relative expression of cytokines in ceca by qPCR. Expression of interleukin 6 (IL-6), interferon (IFN-γ), and lipopolysaccharide-induced tumor necrosis factor alpha factor (LITAF) at day 1 (A), day 3 (B), and day 5 (C) post the S. Typhimurium challenge was presented as the mean ± SD (n = 6). Different letters above bars indicate significant differences among treatments within each sampling day (P < 0.05). NC: an uninfected control group; S: a positive control group infected with S. Typhimurium; SP: a group infected with S. Typhimurium and orally supplemented with Lactobacillus plantarum Z01 (LPZ01); P: a group only orally supplemented with LPZ01.

Relative expression of cytokines in ceca by qPCR. Expression of interleukin 6 (IL-6), interferon (IFN-γ), and lipopolysaccharide-induced <span class="Disease">tumor necrosis factor alpha factor (<span class="Gene">LITAF) at day 1 (A), day 3 (B), and day 5 (C) post the S. Typhimurium challenge was presented as the mean ± SD (n = 6). Different letters above bars indicate significant differences among treatments within each sampling day (P < 0.05). NC: an uninfected control group; S: a positive control group infected with S. Typhimurium; SP: a group infected with S. Typhimurium and orally supplemented with Lactobacillus plantarum Z01 (LPZ01); P: a group only orally supplemented with LPZ01. In comparison with the S group, the <span class="Chemical">SP group reduced expression of IFN-γ and <span class="Gene">LITAF on day 3 post the challenge and IFN-γ on day 5 post challenge. The results of these three pro-inflammation cytokines suggest that the LPZ01 contributed to decrease the inflammation of S. Typhimurium in the chicks.

Relationship between miRNA Changes and Cytokine Changes

miR-1769-3p, miR-3531-3p, miR-1559-3p, miR-1798-5p, miR-1788-3p, miR-2954, and miR-3525 have not been found in the <span class="Species">human and <span class="Species">mouse genomes. On the other hand, miR-215-3p, miR-194, miR-217-3p, miR-215-3p, miR-193a-5p, miR-122-5p, and miR-375 are more conservative miRNAs in vertebrate animal species. Using the inflammation related target genes of differentially expressed miRNAs predicted by the TargetScan only, a potential relationship between miRNA changes and cytokine changes was presented in Figure 6. No immune related target genes were found for gga-miR-2954. Using vanin 1 (VNN1), LITAF, IFN-γ, and IL-6 as the main immune target genes, the remaining miRNAs were involved directly or indirectly in regulation of cytokine production, thus affecting the host immune responses to the bacteria infection. In particular, miR-3525 and miR-193a-5p were found to indirectly target IL-6 and IFN-γ.
Figure 6

Overview of the known relationship between the differentially expressed microRNAs (miRNAs) and their targeted immune related genes. VNN1, TRAF3, TNF-α, IL6ST, IL-6, IFN-γ, TRAF2, TNFRSF21, TNFRSF25, NF-κB, C1QTNF2, MTPN, and LITAF are abbreviations of Vanin 1, tumor necrosis factor receptor associated factor 3, tumor necrosis factor-alpha, interleukin 6 signal transducer, interleukin 6, interferon gamma, tumor necrosis factor receptor associated factor 2, tumor necrosis factor receptor superfamily member 21, tumor necrosis factor receptor superfamily member 25, nuclear factor kappa B, C1q and tumor necrosis factor related protein 2, myotrophin, and lipopolysaccharide-induced tumor necrosis factor genes, respectively.

Overview of the known relationship between the differentially expressed microRNAs (miRNAs) and their targeted immune related genes. <span class="Gene">VNN1, TRAF3, TNF-α, <span class="Gene">IL6ST, IL-6, IFN-γ, TRAF2, TNFRSF21, TNFRSF25, NF-κB, C1QTNF2, MTPN, and LITAF are abbreviations of Vanin 1, tumor necrosis factor receptor associated factor 3, tumor necrosis factor-alpha, interleukin 6 signal transducer, interleukin 6, interferon gamma, tumor necrosis factor receptor associated factor 2, tumor necrosis factor receptor superfamily member 21, tumor necrosis factor receptor superfamily member 25, nuclear factor kappa B, C1q and tumor necrosis factor related protein 2, myotrophin, and lipopolysaccharide-induced tumor necrosis factor genes, respectively.

Discussion

Despite the recognized importance of miRNAs in host immune response to intestine <span class="Disease">inflammation in <span class="Species">humans and mice, their comparative roles in regulating the immune response of birds are still not very clear. Expression surveys of chicken miRNAs have been reported for embryos (22), somites (23), lung, and trachea involved in immune responses induced by avian influenza virus infection (24) and spleen against Marke’s disease virus infection (25). This study was the first to interrogate miRNA expression changes in response to the Salmonella infection and the probiotic treatment in chickens. The <span class="Species">Salmonella challenge was carried out at the third day of age. During the first 3 days of life, <span class="Species">chicken ceca were probably protected from incoming antigens by increased expression of gallinacin 1, 2, 4, and 6 (26). On day 4, peak expression of IL-8 and IL-17 has been observed that indicated minor and transient inflammation followed by normalization of the gut immune system and suppression of gallinacin expression (26). The NGS was used in this study to investigate the miRNA changes. The NGS approach is more suitable for small RNA discovery, which not only provides sequences of low abundance species but also provides quantitative data as the frequency of sequencing reads reflects the abundance of miRNAs in the population (27). In addition, many sequencing software tools have been developed to support miRNA data analysis from NGS data. In our study, we used the miRCat software to identify novel miRNAs. The identified 119 novel miRNAs still need to be validated by experiments (Table S1 in Supplementary Material). This experiment was carried out with S. Typhimurium. Other serotypes of Salmonella may induce different host responses and need to be further investigated. Administration of probiotics to newly hatched <span class="Species">chicks in this study protected <span class="Species">chicks from Salmonella infection, as indicated by reduced bacterial counts in the SP group in comparison with that in the S group. The protective effects of probiotics could come from production of organic acids such as lactic acid and antimicrobial substances such as hydrogen peroxide, bacteriocins, and adhesion inhibitors as well as diminished access to the epithelial cells by the pathogenic bacteria used for the challenge (28). S. Typhimurium elicit the inflammation by its ability to penetrate the intestinal epithelium and to survive within macrophages (29). As a result, they alter host cell physiology, including production of pro-inflammatory cytokines. In the present study, S. Typhimurium challenge led to cecal inflammation. In comparison with the S group, expression of IFN-γ was decreased at 3 and 5 days post the infection, while expression of LITAF was decreased on d5 in the SP group (Figure 5). These results indicated that LPZ01 reduced S. Typhimurium-induced inflammation starting at 3 days after the challenge, since inflammation is characterized by the initial release of pro-inflammatory cytokines (INF-γ) (30) and tumor necrosis factor (TNF)-α (31) and they contribute to antimicrobial responses in the intestinal mucosa (30) and a breakdown in mucosal tolerance (31). TNF-α has yet not be identified in avian species and LITAF also known as TNF-α in chicken, which was upregulated following in vitro stimulation of macrophages for 4 h with S. Typhimurium endotoxin (32). Target genes of 14 differentially expressed miRNAs in this study were predicted by the miRDB and TargetScan (Table S2 in Supplementary Material), since there is no specific program available for prediction of target genes of <span class="Species">chicken miRNAs. Only those predicted by the both miRDB and TargetScan as target genes were selected for GO and KEGG analyses. The KEGG pathway analysis showed significant enrichments in the MAPK signaling and Wnt-signaling pathways, which were ranked among the most enriched pathways in the 24 KEGG pathways (Figure 4). Aballay et al. (33) found that <span class="Species">Caenorhabditis elegans innate immune response triggered by Salmonella enterica was mediated by the MAPK Signaling Pathway. According to Ausubel (34), the innate immune response has ancient origins and conserved MAPK signaling cascades have common features of innate immunity in vertebrates and invertebrate animals. Similarly, GO analysis for this study also showed that the target genes were enriched significantly in negatively regulation of MAPK cascade, positive regulation of stress-activated MAPK cascade, negative regulation of stress-activated MAPK cascade, negative regulation of MAPK cascade, regulation of stress-activated MAPK cascade, stress-activated MAPK cascade, regulation of MAPK cascade, MAPK cascade (Table S3 in Supplementary Material). Therefore, our results support the notion that the MAPK signaling pathway is required for the host immune response triggered by Salmonella infection. The Wnt signaling pathway is another one of the most enriched KEGG pathways in this study. Target genes of the 14 differentially expressed miRNAs were enriched in regulation of T cell activation, T cell aggregation, T cell activation, lymphocyte aggregation, negative regulation of T cell proliferation, regulation of activated T cell proliferation, activated T cell proliferation, alpha-beta T cell activation involved in immune response, T cell activation involved in immune response GO terms. In addition, the GO analysis also shows that target genes were significantly enriched for regulation of <span class="Chemical">cAMP-dependent protein kinase activity, stress-activated MAPK cascade, immune system development, and regulation of immune system process (Table S3 in Supplementary Material). These results suggest significant roles of miRNAs in supporting the cecum in its growth and defense capabilities. The miRNA regulates target genes in the MAPK and Wnt signaling pathways, which in turn stimulates immune responses to the <span class="Species">S. Typhimurium invasion. Five miRNAs was selected and validated by RT-PCR (Figure 3). Their immune related target genes were predicted by the TargetScan only, since very few immune related target genes for the miRNAs were shared by both miRDB and TargetScan programs. In addition, published literature was searched for additional targeted genes. Gga-<span class="Gene">miR-215-5p was the most abundant miRNAs accounting for 40.54% of total reads of identified conserved miRNAs in 36 libraries. The abundance of <span class="Gene">miR-215-5p has previously been observed for the human intestinal-type epithelium by Bansal et al. (35). C1QTNF2 is a target gene of gga-miR-215-5p, which participates in the activation of MAPK activity. <span class="Gene">Gga-miR-3525 was a unique miRNA to <span class="Species">chickens and has been reported in the lung and tracheae of avian influenza virus infection chickens (24) and targets interleukin 6 signal transducer (IL6ST). IL6ST is a signal transducer of IL-6 (36), which is a multifunctional cytokine and involved in many immune related pathways, such as Salmonella infection and intestinal immune network for IgA production. In addition, IL-6 indirectly regulates the IFN-γ in the pathway of Salmonella infection. The gga-miR-193a-5p targets <span class="Disease">tumor necrosis factor receptor superfamily member (TNFRSF) 21, which can regulate nuclear factor kappa B (NF-κB), a regulator of TNF-α. TNF-α is a member of a group of cytokines that stimulate the acute phase reaction in <span class="Species">mammals. Although TNF-α has not been found nor described in the chicken genome, LITAF, which is the regulator for TNF-α expression in mammal (37), has been shown to play an important role in the intestinal inflammatory response in chickens (38). In addition, IL6ST and VNN1 are two target genes of has-miR-193a-5p. The polymorphisms of VNN1 gene is associated with susceptibility to inflammatory bowel diseases (39) and participates in the regulation of gut inflammation (40). The gga-<span class="Gene">miR-122-5p targets the <span class="Gene">VNN1 in chickens (41). VNN1-knockout mice show decreased NSAID- and Schistosoma-induced intestinal inflammation and better controlled inflammatory reaction of intestine and intestinal injury (42). In addition to VNN1, human has-miR-122-5p targets IL6ST, interleukin 17 receptor (IL-17R), IL21R, tumor necrosis factor superfamily member 10 (TNFSF10), and tumor necrosis factor receptor superfamily member 1B (TNFRSF1B) genes to modulate the host reaction to bacteria and these target genes enriched in immune-related pathways, such as TNF signaling pathway, MAPK pathway. miR-375 is a key regulator of epithelial properties that are necessary for securing epithelium-immune system cross talk (43) and much less expression in the colons of patients with active ulcerative colitis (44). Myotrophin (MTPN), a previously validated target of miR-375 (45), which promotes dimerization of NF-κB subunits (46) and regulates NF-κB transcription factor activity. LITAF is another target gene of human has-miR-375. The remaining 9 of 14 differentially expressed miRNAs excluding the above 5 miRNAs were also searched for their immune related target genes, using the same strategy. This exercise was performed in order to reveal the potential relationship between the differentially expressed miRNAs and cytokine changes. There was no immune related target gene for gga-miR-2954. As shown in the Figure 6, the remaining 13 differentially expressed miRNAs targeted cytokines <span class="Gene">LITAF, IFN-γ, and IL-6 directly or indirectly in response to the exogenous bacteria, both pathogenic <span class="Species">S. Typhimurium and beneficial probiotics. In particular, miR-3525 and miR-193a-5p were found to indirectly target IL-6 and IFN-γ. The SP group significantly increased gga-miR-3525 expression on day 1 after the infection and gga-miR-193a-5p expression on day 3 after the infection (Figure 3), in comparison with the S group. This corresponded to the observed reduction of IFN-γ expression on day 3 and day 5 post the challenge by the SP group in comparison with the S group (Figure 5). Our results strongly suggested the linkage between expression of the miRNAs and cytokine production. Consequently, the host immunomodulation responses contributed to counteract the bacterial infection. Of course, how these miRNAs are actively involved in cytokine changes in the host needs further studies for confirmation. In particular, how different miRNAs work together deserves detailed studies. To our knowledge, our study is the first comprehensive analysis of the miRNA expression patterns in ceca of broiler <span class="Species">chickens. The target genes of the differentially expressed miRNAs were enriched in the MAPK signaling, Wnt-signaling, and insulin signaling pathways. The potential roles of miRNAs in regulation of cytokines and <span class="Disease">bacterial infection were explored. A total of 119 novel miRNAs were discovered in 36 libraries will most likely provide new insights into the contribution of the intestinal microbiota to understand the functions of host transcriptional landscape during infection by intracellular bacteria.

Additional Information

All the raw sequencing data used in this work have been deposited in the NIH short read archive under accession number PRJNA309476.

Ethics Statement

All experimental protocols used in this experiment were approved by the Northwest A&F University Institutional Animal Care and Use Committee (protocol number NWAFAC1025).

Author Contributions

QLC and XZ contributed to the initial design of this experiment and prepared the <span class="Species">manuscript of this publication. QLC, LXZ, and SYM performed the experiment. QLC, CT, and LLZ analyzed the data.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  42 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Epithelial microRNAs regulate gut mucosal immunity via epithelium-T cell crosstalk.

Authors:  Moshe Biton; Avi Levin; Michal Slyper; Irit Alkalay; Elad Horwitz; Hagar Mor; Sharon Kredo-Russo; Tali Avnit-Sagi; Gady Cojocaru; Farid Zreik; Zvi Bentwich; Matthew N Poy; David Artis; Michael D Walker; Eran Hornstein; Eli Pikarsky; Yinon Ben-Neriah
Journal:  Nat Immunol       Date:  2011-01-30       Impact factor: 25.606

3.  A pancreatic islet-specific microRNA regulates insulin secretion.

Authors:  Matthew N Poy; Lena Eliasson; Jan Krutzfeldt; Satoru Kuwajima; Xiaosong Ma; Patrick E Macdonald; Sébastien Pfeffer; Thomas Tuschl; Nikolaus Rajewsky; Patrik Rorsman; Markus Stoffel
Journal:  Nature       Date:  2004-11-11       Impact factor: 49.962

4.  Myotrophin/V-1, a protein up-regulated in the failing human heart and in postnatal cerebellum, converts NFkappa B p50-p65 heterodimers to p50-p50 and p65-p65 homodimers.

Authors:  Pascal Knuefermann; Peter Chen; Arunima Misra; Shu-Ping Shi; Maha Abdellatif; Natarajan Sivasubramanian
Journal:  J Biol Chem       Date:  2002-04-23       Impact factor: 5.157

5.  Gut inflammation provides a respiratory electron acceptor for Salmonella.

Authors:  Sebastian E Winter; Parameth Thiennimitr; Maria G Winter; Brian P Butler; Douglas L Huseby; Robert W Crawford; Joseph M Russell; Charles L Bevins; L Garry Adams; Renée M Tsolis; John R Roth; Andreas J Bäumler
Journal:  Nature       Date:  2010-09-23       Impact factor: 49.962

6.  Vanin-1(-/-) mice show decreased NSAID- and Schistosoma-induced intestinal inflammation associated with higher glutathione stores.

Authors:  Florent Martin; Marie-France Penet; Fabrice Malergue; Hubert Lepidi; Alain Dessein; Franck Galland; Max de Reggi; Philippe Naquet; Bouchra Gharib
Journal:  J Clin Invest       Date:  2004-02       Impact factor: 14.808

7.  The murine caecal microRNA signature depends on the presence of the endogenous microbiota.

Authors:  Natasha Singh; Elize A Shirdel; Levi Waldron; Regan-Heng Zhang; Igor Jurisica; Elena M Comelli
Journal:  Int J Biol Sci       Date:  2011-12-19       Impact factor: 6.580

8.  Real-time quantification of microRNAs by stem-loop RT-PCR.

Authors:  Caifu Chen; Dana A Ridzon; Adam J Broomer; Zhaohui Zhou; Danny H Lee; Julie T Nguyen; Maura Barbisin; Nan Lan Xu; Vikram R Mahuvakar; Mark R Andersen; Kai Qin Lao; Kenneth J Livak; Karl J Guegler
Journal:  Nucleic Acids Res       Date:  2005-11-27       Impact factor: 16.971

9.  edgeR: a Bioconductor package for differential expression analysis of digital gene expression data.

Authors:  Mark D Robinson; Davis J McCarthy; Gordon K Smyth
Journal:  Bioinformatics       Date:  2009-11-11       Impact factor: 6.937

10.  Using In Vitro Immunomodulatory Properties of Lactic Acid Bacteria for Selection of Probiotics against Salmonella Infection in Broiler Chicks.

Authors:  Junchang Feng; Lihong Wang; Luoxiong Zhou; Xin Yang; Xin Zhao
Journal:  PLoS One       Date:  2016-01-22       Impact factor: 3.240

View more
  10 in total

Review 1.  Effects of therapeutic probiotics on modulation of microRNAs.

Authors:  Amirhossein Davoodvandi; Havva Marzban; Pouya Goleij; Amirhossein Sahebkar; Korosh Morshedi; Samaneh Rezaei; Maryam Mahjoubin-Tehran; Hossein Tarrahimofrad; Michael R Hamblin; Hamed Mirzaei
Journal:  Cell Commun Signal       Date:  2021-01-11       Impact factor: 5.712

Review 2.  Probiotics and MicroRNA: Their Roles in the Host-Microbe Interactions.

Authors:  Ying Zhao; Yan Zeng; Dong Zeng; Hesong Wang; Mengjia Zhou; Ning Sun; Jinge Xin; Abdul Khalique; Danish Sharafat Rajput; Kangcheng Pan; Gang Shu; Bo Jing; Xueqin Ni
Journal:  Front Microbiol       Date:  2021-01-14       Impact factor: 5.640

3.  Effects of novel probiotic strains of Bacillus pumilus and Bacillus subtilis on production, gut health, and immunity of broiler chickens raised under suboptimal conditions.

Authors:  Muhammad Bilal; Wei Si; Florence Barbe; Eric Chevaux; Olimpia Sienkiewicz; Xin Zhao
Journal:  Poult Sci       Date:  2020-11-30       Impact factor: 3.352

4.  Epigenetic changes in poultry due to reprogramming of the gut microbiota.

Authors:  Aleksandra Dunislawska; Anna Slawinska; Maria Siwek; Marek Bednarczyk
Journal:  Anim Front       Date:  2021-12-17

5.  Probiotic Lacticaseibacillus rhamnosus GG Increased Longevity and Resistance Against Foodborne Pathogens in Caenorhabditis elegans by Regulating MicroRNA miR-34.

Authors:  Bohyun Yun; Sangdon Ryu; Minkyoung Kang; Juyeon Lee; Jiseon Yoo; Younghoon Kim; Sangnam Oh
Journal:  Front Cell Infect Microbiol       Date:  2022-01-19       Impact factor: 5.293

6.  Analysis of miRNA Expression in the Ileum of Broiler Chickens During Bacillus licheniformis H2 Supplementation Against Subclinical Necrotic Enteritis.

Authors:  Ying Zhao; Dong Zeng; Hesong Wang; Ning Sun; Jinge Xin; Hanbo Yang; Lei Lei; Abdul Khalique; Danish Sharafat Rajput; Kangcheng Pan; Gang Shu; Bo Jing; Xueqin Ni
Journal:  Probiotics Antimicrob Proteins       Date:  2020-09-25       Impact factor: 4.609

7.  miRNA Profiling in the Chicken Liver under the Influence of Early Microbiota Stimulation with Probiotic, Prebiotic, and Synbiotic.

Authors:  Michalina Sikorska; Maria Siwek; Anna Slawinska; Aleksandra Dunislawska
Journal:  Genes (Basel)       Date:  2021-05-01       Impact factor: 4.096

8.  Gga-miR-3525 Targets PDLIM3 through the MAPK Signaling Pathway to Regulate the Proliferation and Differentiation of Skeletal Muscle Satellite Cells.

Authors:  Huadong Yin; Jing Zhao; Haorong He; Yuqi Chen; Yan Wang; Diyan Li; Qing Zhu
Journal:  Int J Mol Sci       Date:  2020-08-04       Impact factor: 5.923

9.  Male-Biased gga-miR-2954 Regulates Myoblast Proliferation and Differentiation of Chicken Embryos by Targeting YY1.

Authors:  Xiuxue Dong; Yu Cheng; Lingyun Qiao; Xin Wang; Cuiping Zeng; Yanping Feng
Journal:  Genes (Basel)       Date:  2021-08-27       Impact factor: 4.096

10.  The Outer Membrane Vesicles of Salmonella enterica Serovar Typhimurium Activate Chicken Immune Cells through Lipopolysaccharides and Membrane Proteins.

Authors:  Hongxiao Cui; Yajun Sun; Hua Lin; Yan Zhao; Xin Zhao
Journal:  Pathogens       Date:  2022-03-11
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.