| Literature DB >> 28659893 |
Hesong Wang1, Xueqin Ni1, Xiaodan Qing1, Dong Zeng1, Min Luo1, Lei Liu1, Guangyao Li2, Kangcheng Pan1, Bo Jing1.
Abstract
Numerous studies have focused on the beneficial effects of probiotics in animals. Even so, additional information should be obtained about the mechanisms by which a useful probiotic strain successfully exerts such beneficial effects. In this study, we evaluated the effect of the dietary supplementation of both live and disrupted Lactobacillus johnsonii (LJ) strain BS15 in broilers at different ages. Specifically, growth performance, lipid metabolism, gut microbiota, intestinal development, and digestive ability of the broilers were assessed. A total of 180 1-day-old Cobb 500 chicks were randomly distributed into three groups. These chicks were fed diets supplemented with 1 × 106 colony-forming units (cfu) LJ per gram of feed (LJ group); 1 × 106 cfu disrupted LJ per gram of feed (D-LJ group); and de Man, Rogosa, and Sharpe liquid medium (control group), respectively, throughout a 42-day experimental period. The results demonstrated that LJ supplementation of feed had a positive effect on the average daily gain and starter feed conversion ratio. In addition, LJ supplementation of feed decreased serum triglyceride and low-density lipid cholesterol levels, as well as abdominal fat deposition. LJ also reduced the mRNA levels of lipoprotein lipase in adipose tissue and stearoyl-CoA desaturase-1 in the liver. LJ diminished the mRNA quantities of the sterol regulatory element binding protein-1c and fatty acid synthase, as well as increased the level of serum high-density lipid cholesterol. LJ increased the mRNA quantities of peroxisome proliferator-activated receptor α, acyl-CoA oxidase in the liver, and carnitine palmitoyltransferase-1. LJ also improved the intestinal development and digestive ability mainly by increasing the villus height/crypt depth ratio in the ileum. The probiotic increased the levels of epidermal growth factor and insulin-like growth factor-1, as well as the activities of trypsin and lipase in the jejunum and ileum. LJ exerted beneficial effects on the intestinal flora. Specifically, LJ markedly enhanced the population of Bacteroidetes and Lactobacillus spp. Moreover, the probiotic reduced the population of Enterobacteriaceae and the Firmicutes/Bacteroidetes ratio. Slight changes caused by disrupted LJ were detected. These findings indicated that live LJ supplementation may promote growth performance and lower fat deposition in broilers.Entities:
Keywords: Lactobacillus; broiler; gut microbiota; lipid metabolism; probiotic
Year: 2017 PMID: 28659893 PMCID: PMC5466961 DOI: 10.3389/fmicb.2017.01073
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Composition of basal diets for broiler chickens.
| Ingredient1 | Starter diet (%) 1–21 days | Finisher diet (%) 22–42 days |
|---|---|---|
| Ground yellow corn | 56.00 | 59.50 |
| Soybean meal | 37.00 | 32.90 |
| Soybean oil | 3.66 | 4.70 |
| Ground limestone | 0.57 | 0.50 |
| Dicalcium phosphate | 1.80 | 1.60 |
| Salt | 0.30 | 0.30 |
| Choline chloride | 0.10 | 0.10 |
| DL-Met | 0.24 | 0.12 |
| Micronutrients2 | 0.33 | 0.33 |
| ME (MJ kg-1) | 12.40 | 12.80 |
| CP | 21.20 | 19.70 |
| Lys | 1.19 | 1.08 |
| Met | 0.50 | 0.40 |
| Met + Cys | 0.86 | 0.74 |
| Ca | 0.85 | 0.77 |
| Non-phytate P | 0.44 | 0.40 |
Gene-specific primers of lipid metabolism-related enzymes.
| Gene name1 | Primer sequence (5→3) | Tm (°C)/size (bp) | Accession |
|---|---|---|---|
| SREBP-1c | F:GAGGAAGGCCATCGAGTACA | 60.3/220 | AY029224 |
| FAS | F:CTATCGACACAGCCTGCTCCT | 62.0/107 | J03860 |
| SCD1 | F:ACCATACATTCCCCTACGACT | 56.0/144 | NM204890 |
| ACC | F:AATGGCAGCTTTGGAGGTGT | 60.9/136 | NM205505 |
| PPARα | F:TGGACGAATGCCAAGGTC | 60.3/813 | AF163809 |
| CPT-1 | F:CAATGAGGTACTCCCTGAAA | 57.5/337 | AY675193 |
| ACOX | F:ATGTCACGTTCACCCCATCC | 54.0/133 | NM001006205 |
| PPARγ | F:CCAGCGACATCGACCAGTT | 57.5/145 | AF163811 |
| ATGL | F:TCCTTCACCTTCAGCGTCCA | 54.0/113 | EU852334 |
| LPL | F:CAGTGCAACTTCAACCATACCA | 60.0/150 | NM205282 |
| GADPH | F:GGTGAAAGTCGGAGTCAACGG | 58.4/108 | NM204305 |
Primer information on the microflora for qPCR.
| Target species | Primer sequence (5→3) | Tm (°C)/size (bp) |
|---|---|---|
| Total bacteria | F: CGGYCCAGACTCCTACGGG | 60.0/130 |
| Firmicutes | F: GGAGYATGTGGTTTAATTCGAAGCA | 64.5/126 |
| Bacteroidetes | F: GGARCATGTGGTTTAATTCGATGAT | 60.0/126 |
| F: AGCAGTAGGGAATCTTCCA | 64.5/341 | |
| Enterobacteriaceae | F: CATTGACGTTACCCGCAGAAGAAGC | 62.5/195 |
Effects of L. johnsonii BS15 on chicken growth performance1.
| Parameter2 | Control | LJ | D-LJ |
|---|---|---|---|
| ADFI, g/day | 52.26 ± 2.51 | 53.75 ± 2.05 | 52.79 ± 2.05 |
| ADG, g/day | 33.53 ± 1.37b | 36.68 ± 1.49a | 34.01 ± 1.50b |
| FCR | 1.56 ± 0.07 | 1.47 ± 0.10 | 1.55 ± 0.06 |
| ADFI, g/day | 159.80 ± 4.51b | 168.21 ± 3.17a | 158.56 ± 4.84b |
| ADG, g/day | 78.73 ± 2.04b | 84.11 ± 3.21a | 78.80 ± 1.24b |
| FCR | 1.99 ± 0.04 | 2.00 ± 0.08 | 2.01 ± 0.05 |
| ADFI, g/day | 104.53 ± 2.00b | 110.98 ± 2.08a | 105.68 ± 3.20b |
| ADG, g/day | 56.13 ± 0.97b | 60.40 ± 2.09a | 56.40 ± 1.00b |
| FCR | 1.86 ± 0.03 | 1.84 ± 0.08 | 1.87 ± 0.04 |
Effects of L. johnsonii BS15 on serum hormone levels1.
| Parameter2 | Control | LJ | D-LJ |
|---|---|---|---|
| INS, μIU/mL | 3.29 ± 0.10 | 3.20 ± 0.23 | 3.09 ± 0.25 |
| GH, ng/mL | 1.08 ± 0.09 | 1.08 ± 0.09 | 1.05 ± 0.05 |
| LEP, ng/mL | 0.53 ± 0.03 | 0.55 ± 0.04 | 0.54 ± 0.02 |
| FT3, ng/mL | 5.52 ± 0.51 | 5.59 ± 0.36 | 5.66 ± 0.38 |
| FT4, ng/mL | 10.07 ± 1.41 | 10.21 ± 0.71 | 10.60 ± 0.99 |
| INS, μIU/mL | 3.13 ± 0.14 | 3.32 ± 0.23 | 3.29 ± 0.22 |
| GH, ng/mL | 1.11 ± 0.10 | 1.12 ± 0.10 | 1.10 ± 0.08 |
| LEP, ng/mL | 0.36 ± 0.03 | 0.34 ± 0.04 | 0.35 ± 0.04 |
| FT3, ng/mL | 3.63 ± 0.27 | 3.40 ± 0.20 | 3.55 ± 0.05 |
| FT4, ng/mL | 13.79 ± 1.13 | 13.55 ± 1.22 | 13.75 ± 0.48 |
Effects of L. johnsonii BS15 on serum biochemical parameters1.
| Parameter2 | Control | LJ | D-LJ |
|---|---|---|---|
| AST, IU/L | 137.62 ± 6.66 | 132.58 ± 10.21 | 138.40 ± 9.15 |
| ALT, IU/L | 11.33 ± 1.74 | 12.15 ± 1.24 | 12.09 ± 1.35 |
| TG, mmol/L | 0.29 ± 0.03 | 0.31 ± 0.04 | 0.30 ± 0.06 |
| TC, mmol/L | 2.65 ± 0.17 | 2.63 ± 0.12 | 2.60 ± 0.24 |
| HDL-C, mmol/L | 0.49 ± 0.09 | 0.46 ± 0.08 | 0.49 ± 0.06 |
| LDL-C, mmol/L | 2.34 ± 0.21 | 2.38 ± 0.16 | 2.36 ± 0.21 |
| AST, IU/L | 126.79 ± 11.36 | 133.23 ± 6.46 | 134.70 ± 6.33 |
| ALT, IU/L | 12.46 ± 1.42 | 12.85 ± 1.49 | 11.87 ± 0.95 |
| TG, mmol/L | 0.41 ± 0.05a | 0.31 ± 0.03b | 0.35 ± 0.04a |
| TC, mmol/L | 2.55 ± 0.21 | 2.57 ± 0.28 | 2.63 ± 0.23 |
| HDL-C, mmol/L | 0.48 ± 0.06b | 0.59 ± 0.04a | 0.52 ± 0.09b |
| LDL-C, mmol/L | 1.93 ± 0.08a | 1.71 ± 0.07b | 1.86 ± 0.13a |