Marcela de Souza Santos1, Dor Salomon1, Kim Orth1,2. 1. Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, Texas, United States of America. 2. Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas, United States of America.
Abstract
The production of antimicrobial reactive oxygen species by the nicotinamide dinucleotide phosphate (NADPH) oxidase complex is an important mechanism for control of invading pathogens. Herein, we show that the gastrointestinal pathogen Vibrio parahaemolyticus counteracts reactive oxygen species (ROS) production using the Type III Secretion System 2 (T3SS2) effector VopL. In the absence of VopL, intracellular V. parahaemolyticus undergoes ROS-dependent filamentation, with concurrent limited growth. During infection, VopL assembles actin into non-functional filaments resulting in a dysfunctional actin cytoskeleton that can no longer mediate the assembly of the NADPH oxidase at the cell membrane, thereby limiting ROS production. This is the first example of how a T3SS2 effector contributes to the intracellular survival of V. parahaemolyticus, supporting the establishment of a protective intracellular replicative niche.
The production of antimicrobial reactive oxygen species by the nicotinamide dinucleotide phosphate (NADPH) oxidase complex is an important mechanism for control of invading pathogens. Herein, we show that the gastrointestinal pathogen Vibrio parahaemolyticus counteracts reactive oxygen species (ROS) production using the Type III Secretion System 2 (T3SS2) effector VopL. In the absence of VopL, intracellular V. parahaemolyticus undergoes ROS-dependent filamentation, with concurrent limited growth. During infection, VopL assembles actin into non-functional filaments resulting in a dysfunctional actin cytoskeleton that can no longer mediate the assembly of the NADPH oxidase at the cell membrane, thereby limiting ROS production. This is the first example of how a T3SS2 effector contributes to the intracellular survival of V. parahaemolyticus, supporting the establishment of a protective intracellular replicative niche.
Vibrio parahaemolyticus is a Gram-negative bacterium that inhabits warm marine and estuarine environments throughout the world [1]. This bacterium is recognized as the world’s leading cause of acute gastroenteritis associated with the consumption of contaminated raw or undercooked seafood [2]. In immunocompetent individuals, the illness is self-limiting with symptoms including diarrhea with abdominal cramping, nausea, vomiting, and low-grade fever [1]. However, for individuals with underlying health conditions, the bacterium can breach the gut barrier and cause septicemia corresponding to high mortality rates [3]. V. parahaemolyticus has also been reported to cause infection of seawater-exposed wounds, which in rare cases escalates to necrotizing fasciitis and septicemia [4]. The bacterium was also identified as the etiologic agent of acute hepatopancreatic necrosis disease (AHPND), a shrimp illness that has recently emerged, causing a massive economic burden on the shrimp industry [5].Among several virulence factors, including thermostable hemolysins (TDH/TRH), polar and lateral flagella, and adhesins, V. parahaemolyticus encodes two Type III Secretion Systems (T3SS1 and T3SS2) [6]. These are needle-like apparatuses used by the bacterium to inject proteins, termed effectors, into the host cell [7]. The first T3SS, T3SS1, is present in all sequenced V. parahaemolyticus strains, including both environmental and clinical isolates, and is induced by culturing the bacteria in low Ca2+, as in serum-free Dulbecco’s modified Eagle’s medium (DMEM) tissue culture growth medium [8]. While this system does not contribute to the bacterium’s enterotoxicity [9], the T3SS1 effectors orchestrate a multifaceted and efficient death of the infected host cell [10]. V. parahaemolyticus more recently acquired the second T3SS, T3SS2, through a lateral gene transfer event and this system is primarily associated with clinical isolates [6]. The T3SS2 becomes activated in the presence of bile salts [11, 12] and is recognized as the principal virulence factor causing gastroenteritis [9].We recently reported that during infection, T3SS2 promotes V. parahaemolyticus invasion of non-phagocytic cells [13, 14]. We found that V. parahaemolyticus encodes VopC (VPA1321), a deamidase that constitutively activates the GTPases Rac and Cdc42 resulting in membrane ruffling and uptake of the bacterium into the cell [14, 15]. Once inside the host cell, the bacterium is initially contained within an endosome-like vacuole [13]. Upon acidification of the vacuole, but prior to endosome fusion with the lysosome, V. parahaemolyticus breaks out of its vacuole and escapes into the cytosol [13]. V. parahaemolyticus then uses the cell as a protected replicative niche (100–300 bacteria/cell) [13]. Although historically studied as an exclusive extracellular bacterium, these findings changed this long-standing view and established V. parahaemolyticus as a facultative intracellular bacterium. While the role of VopC to promote host cell invasion is well-defined [14], the contribution of other T3SS2 effectors to the maintenance of the intracellular lifecycle of V. parahaemolyticus remains poorly understood.VopL (VPA1370), a T3SS2 effector, encodes three consecutive WASP-homology 2 (WH2) domains intermixed with three proline-rich regions and a subsequent VopL C-terminal domain (VCD) (Fig 1A) [16-18]. WH2 domains are commonly found in nucleators of actin filaments; indeed, VopL’s in vitro nucleating activity is even more potent than that of the maximally-activated Arp2/3 complex [16]. Ectopic expression of VopL in epithelial cells causes a dramatic rearrangement of the actin cytoskeleton into filaments reminiscent of stress fibers [16]. Whether VopL nucleates actin from the barbed or pointed end remains a matter of disagreement [19, 20]. Importantly, there is consensus that VopL promotes the nucleation of non-functional filaments in host cells, as opposed bona fide to filaments that can be recycled. As a result, VopL arrests actin monomers and the shortage of actin compromises the endogenous assembly of actin networks [19, 20]. Despite the comprehensive characterization of VopL from a structural and a mechanistic standpoint over the last decade [16, 21], the contribution of this effector during a V. parahaemolyticus infection remained elusive.
Fig 1
Intracellular CAB2 undergoes filamentation with concurrent decreased survival in the absence of VopL.
(A) Schematic of VopL domains: WASP-homology 2 domains (WH2), proline-rich regions (P), and VopL C-terminal domain (VCD). (B) Intracellular growth of CAB2 strains in Caco-2 cells. Caco-2 cells were infected with indicated CAB2 strains for 2h followed by incubation with 100 μg/mL gentamicin for the specified times. Cell lysates were serially diluted and plated and CFU was enumerated for intracellular bacteria. Values are means ± SD of a representative experiment performed in triplicate. Asterisks indicate statistically significant difference in intracellular bacteria CFU counts between CAB2 + pEmpty and CAB2ΔvopL + pEmpty or between CAB2ΔvopL + pEmpty and CAB2ΔvopL + pVopL. ** p < 0.005. (C) Confocal micrographs of Caco-2 cells infected with indicated GFP-tagged CAB2 strains for 2h and incubated with 100 μg/mL gentamicin for 6h. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (D) Caco-2 cells invaded by CAB2 + pEmpty, CAB2ΔvopL + pEmpty, or CAB2ΔvopL + pVopL were enumerated for containment of filamentous bacteria. 90 cells per sample (each sample referring to infection by one of the 3 bacterial strains) were enumerated over 3 independent experiments. Values are means ± SD. Asterisks indicate statistically significant difference between CAB2- and CAB2ΔvopL-infection samples (* p = 0.0116) or between CAB2ΔvopL- and CAB2ΔvopL + pVopL-infection samples (* p = 0.0421).
Intracellular CAB2 undergoes filamentation with concurrent decreased survival in the absence of VopL.
(A) Schematic of VopL domains: WASP-homology 2 domains (WH2), proline-rich regions (P), and VopL C-terminal domain (VCD). (B) Intracellular growth of CAB2 strains in Caco-2 cells. Caco-2 cells were infected with indicated CAB2 strains for 2h followed by incubation with 100 μg/mL gentamicin for the specified times. Cell lysates were serially diluted and plated and CFU was enumerated for intracellular bacteria. Values are means ± SD of a representative experiment performed in triplicate. Asterisks indicate statistically significant difference in intracellular bacteria CFU counts between CAB2 + pEmpty and CAB2ΔvopL + pEmpty or between CAB2ΔvopL + pEmpty and CAB2ΔvopL + pVopL. ** p < 0.005. (C) Confocal micrographs of Caco-2 cells infected with indicated GFP-tagged CAB2 strains for 2h and incubated with 100 μg/mL gentamicin for 6h. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (D) Caco-2 cells invaded by CAB2 + pEmpty, CAB2ΔvopL + pEmpty, or CAB2ΔvopL + pVopL were enumerated for containment of filamentous bacteria. 90 cells per sample (each sample referring to infection by one of the 3 bacterial strains) were enumerated over 3 independent experiments. Values are means ± SD. Asterisks indicate statistically significant difference between CAB2- and CAB2ΔvopL-infection samples (* p = 0.0116) or between CAB2ΔvopL- and CAB2ΔvopL + pVopL-infection samples (* p = 0.0421).Herein, we show that VopL is required for the intracellular survival of V. parahaemolyticus. In the absence of VopL, intracellular bacteria filament, which indicates that the bacteria are under stress. We identified the stressor as an increase in exposure to reactive-oxygen species (ROS). We found that the presence of VopL prevented filamentation by suppressing the generation of ROS by the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase complex. To generate ROS, cytosolic and membranous subunits of the NADPH oxidase complex must come together at cell membranes [22]. VopL, by hijacking the actin cytoskeleton, impedes the translocation of NADPH cytosolic subunits to the cell membrane, thereby preventing the complete assembly of the enzymatic ROS complex. Thus, V. parahaemolyticus deploys the T3SS2 effector VopL to secure a safe replicative niche within the host cell.
Results
In the absence of VopL, V. parahaemolyticus undergoes filamentation with concurrent decreased intracellular survival
As discussed earlier, despite not contributing to V. parahaemolyticus’ enterotoxicity [9], the T3SS1 becomes activated upon bacterial suspension in DMEM, causing the rapid death (~3h post-infection) of tissue-cultured cells [10], thereby masking the activity of the T3SS2. To reveal the activity of T3SS2 we made use of the V. parahaemolyticusCAB2 strain, an isogenic strain derived from the clinical isolate RimD2210633 [14]. CAB2 contains a deletion for genes encoding two types of toxic factors. First, a deletion was made in exsA loci, resulting in the inactivation of the transcriptional activator for the T3SS1 [23]. Second, deletions were made for tdhAS, the two thermostable direct hemolysins (TDH) present in RimD2210633, eliminating their cytotoxic activity [24]. The resulting strain, CAB2, has been used in subsequent studies to assess the activity of T3SS2 and its effectors.Initially, we set out to investigate the contribution of VopL for the survival of CAB2 within Caco-2 cells, a colonic epithelial cell line. Bacterial survival can be assessed in two ways: first by determining the number of intracellular bacteria as a function of time post-invasion (Fig 1B) and second by visualization of intracellular CAB2 using confocal microscopy (Fig 1C and S1 Fig). Shortly after the invasion of Caco-2 cells (2h post-invasion), CAB2 and its VopL-mutant counterpart (CAB2ΔvopL) exhibited comparable cell invasion and intracellular growth (Fig 1B), displaying a patchy distribution inside their host cell (S1A Fig). This activity was reminiscent of V. parahaemolyticus’ vacuolar localization early after invasion [13]. At 4h post-invasion, CAB2 and CAB2ΔvopL counts doubled (Fig 1B), consistent with intracellular replication, which was indicated by a significant increase in bacterial load within Caco-2 cells (S1B Fig). At 6h post-invasion, CAB2 exhibited an additional growth increase, while CAB2ΔvopL survival was substantially compromised as bacterial counts dropped more than twofold (Fig 1B). Strikingly, confocal inspection of intracellular CAB2ΔvopL at 6h post-invasion revealed a dramatic change in bacterial morphology: CAB2 displayed characteristic V. parahaemolyticus’ rod-shape, while CAB2ΔvopL appeared significantly elongated (Fig 1C). Expression of VopL in CAB2ΔvopL from a plasmid (CAB2ΔvopL+pVopL) increased intracellular growth to levels comparable to that of wild type bacteria (Fig 1B) and also rescued normal bacterial morphology (Fig 1C and 1D).Elongation of CAB2ΔvopL was not a result of the cell body extension, but rather a deficiency in bacterial cell division. Closer inspection of CAB2ΔvopL revealed that the elongated cell body contained multiple nucleoids (S1C Fig), which is consistent with continuous bacterial replication but ceased septation. This morphological phenotype is referred to as bacterial filamentation and represents an important strategy used by bacteria to survive during stressful situations [25]. Several bacteria have been reported to undergo filamentation as a protective mechanism against phagocytosis, as in the case of Uropathogenic Escherichia coli [26], or against consumption of “inedible” filamentous bacteria by protists, as in the case of Flectobacillus spp. [27]. Filamentation can also be triggered in response to DNA-damaging stresses such as UV radiation, antibiotics, and reactive oxygen species (ROS) [25]. Given that CAB2ΔvopL deliberately invades Caco-2 cells (via VopC), samples are not exposed to UV radiation, and intracellular bacteria are not exposed to gentamicin, as this antibiotic is not taken up by Caco-2 cells, we hypothesized that host generation of ROS could be responsible for the filamentous CAB2ΔvopL.
Bacterial filamentation is ROS-dependent
To investigate whether ROS was causal for filamentation of intracellular CAB2ΔvopL, we assessed the generation of ROS inside Caco-2 cells by the nitroblue tetrazolium (NBT) assay [28, 29]. In the NBT assay, the water-soluble tetrazolium dye is reduced by superoxide into blue insoluble formazan deposits, which are readily detectable by microscopic imaging [28, 29]. Uninfected Caco-2 cells displayed little to no formazan precipitates (S2 Fig). Importantly, the accumulation of formazan was substantially greater in cells infected with CAB2ΔvopL than in cells infected with wild type CAB2 (S2 Fig), suggesting that VopL plays a role in suppressing the generation of ROS inside the host cell. The accumulation of formazan was observed in Caco-2 cells that contained intracellular bacteria as well as in cells that did not contain bacteria (S2 Fig). These findings support that the presence of extracellular bacteria is sufficient to trigger the host ROS response (possibly via pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharides and flagella). While only a fraction of the host cells were invaded, all cells should be infected, and therefore, receive VopL via T3SS2. Once delivered to infected cells, VopL turns off the ROS response.Next, we set out to investigate whether bacterial filamentation resulted from ROS production. While formazan deposits could be observed in the minority of Caco-2 cells invaded by rod-shaped, CAB2 bacteria (Fig 2A and 2B), this precipitate was present in about 90% of the cells containing filamentous, CAB2ΔvopL bacteria (Fig 2A and 2B). The tight correlation between filamentous bacteria and enriched deposits of formazan strongly implicates ROS as the stressor responsible for CAB2ΔvopL filamentation.
Fig 2
CAB2ΔvopL filamentation is ROS-dependent.
(A) Confocal micrographs of Caco-2 cells infected with CAB2 (green) or CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 3h. Samples were then incubated with 1 mg/mL NBT for additional 3h in the presence of gentamicin. DNA was stained with Hoechst (blue). Formazan precipitates were visualized in bright field (DiC). White arrows indicate formazan precipitates. Scale bars, 10 μm. (B) Quantification of cells containing rod-shaped (CAB2) or filamentous bacteria (CAB2ΔvopL) and positive for presence of formazan precipitates. 150 cells for each sample (CAB2 or CAB2ΔvopL infections) were analyzed over 3 independent experiments. Values are means ± SD. Asterisks indicate statistically significant difference between CAB2 and CAB2ΔvopL samples (** p = 0.0033). (C) Confocal micrographs of Caco-2 cells infected with CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 6h. Host cells were pre-treated with either dimethyl sulfoxide (DMSO) or 10 μM GKT136901 (GKT), which were kept throughout infection. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (D) Quantification of filamentous bacteria in the presence or absence of GKT. Caco-2 cells invaded by CAB2ΔvopL-GFP and treated with either DMSO or GKT were analyzed for presence of filamentous bacteria. 300 cells for each sample (DMSO or GKT), over 3 independent experiments, were analyzed for presence of filamentous bacteria. Values are means ± SD. Asterisks indicate statistically significant difference between DMSO and GKT samples (** p = 0.0038).
CAB2ΔvopL filamentation is ROS-dependent.
(A) Confocal micrographs of Caco-2 cells infected with CAB2 (green) or CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 3h. Samples were then incubated with 1 mg/mL NBT for additional 3h in the presence of gentamicin. DNA was stained with Hoechst (blue). Formazan precipitates were visualized in bright field (DiC). White arrows indicate formazan precipitates. Scale bars, 10 μm. (B) Quantification of cells containing rod-shaped (CAB2) or filamentous bacteria (CAB2ΔvopL) and positive for presence of formazan precipitates. 150 cells for each sample (CAB2 or CAB2ΔvopLinfections) were analyzed over 3 independent experiments. Values are means ± SD. Asterisks indicate statistically significant difference between CAB2 and CAB2ΔvopL samples (** p = 0.0033). (C) Confocal micrographs of Caco-2 cells infected with CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 6h. Host cells were pre-treated with either dimethyl sulfoxide (DMSO) or 10 μM GKT136901 (GKT), which were kept throughout infection. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (D) Quantification of filamentous bacteria in the presence or absence of GKT. Caco-2 cells invaded by CAB2ΔvopL-GFP and treated with either DMSO or GKT were analyzed for presence of filamentous bacteria. 300 cells for each sample (DMSO or GKT), over 3 independent experiments, were analyzed for presence of filamentous bacteria. Values are means ± SD. Asterisks indicate statistically significant difference between DMSO and GKT samples (** p = 0.0038).ROS can be produced by NADPH oxidases, specialized enzymes whose sole function is the generation of ROS [22]. There are seven members of the NADPH oxidase (NOX) family, NOX1–5 and two dual oxidases (DUOX1 and DUOX2), which collectively produce ROS in a wide range of tissues where ROS participate in a variety of cell processes such as mitogenesis, apoptosis, hormone synthesis, and oxygen sensing [22, 30]. NOX2 is a phagocyte-specific isoform, being highly expressed in neutrophils and macrophages where it plays an essential role in host defense against microbial pathogens [22]. NOX1 is the closest homolog of NOX2, with whom it shares 56% sequence identity [22]. NOX1 is most abundant in the colon epithelium and is also expressed in a variety of cell lines, including Caco-2 cells [30, 31]. At present, the physiological roles of colonic NOX1 are not fully understood. NOX1-derived ROS has been implicated in control of cell proliferation, mucosal repair after injury, and inflammatory response [30]. Importantly, evidence suggests a role for NOX1 as a host defense oxidase [32]. For instance, colon epithelial cells exhibited high NOX1-mediated ROS production in response to flagellin from Salmonella enteriditis [33].In order to assess whether NOX1-dependent generation of ROS played a role for CAB2ΔvopL filamentation, we suppressed ROS generation using GKT136901 (GKT), a direct and specific inhibitor of NOX1/4 (NOX4 is primarily expressed in the kidney [22]) [34]. GKT significantly attenuated the accumulation of formazan in Caco-2 cells infected with CAB2ΔvopL (S3 Fig), confirming its suitability as an inhibitor of the ROS response. Importantly, this inhibitor reduced the number of host cells containing filamentous CAB2ΔvopL by more than twofold (Fig 2C and 2D). As expected, GKT did not affected the intracellular growth of CAB2, given that this strain exhibits minimal filamentation (S4 Fig, Fig 1D). These findings strongly suggest that NOX1-generated ROS mediates bacterial filamentation.
VopL is required for normal bacterial growth in COSphox cells
Our results thus far show that NOX1-generated ROS is causal for bacterial filamentation and that filamentation only occurs in the absence of VopL. Therefore, we hypothesized that VopL suppresses generation of ROS. To quantify NADPH oxidase-dependent production of ROS, we analyzed host cell release of superoxide, the product of NADPH oxidase-mediated reduction of molecular oxygen and the precursor of other ROS [35]. Detection of ROS generated by endogenous NOX1 in the colon, as well as in Caco-2 cells, is challenging to measure [33]. Indeed, under our experimental conditions we could not quantify superoxide in a sensitive manner during infection of Caco-2 cells, nor could we detect it upon cell stimulation with the PKC activator phorbol 12-myristate 13-acetate (PMA) (S5 Fig).Thus, to further investigate the ability of VopL to control the generation of ROS by NADPH oxidases, we used a well characterized model cell system, the COSphox cell line, that has been used previously to biochemically analyze the production of ROS [36]. These cells stably express NOX2 (gp91phox) along with the other NOX2 complex subunits p22phox, p47phox, and p67phox [36]. Notably, the NOX1 enzymatic complex also includes p22phox, along with NOXO1 and NOXA1, homologs of p47phox and p67phox, respectively [31, 37]. Given the similarity in functioning of the NOX1 and NOX2 complexes, COSphox cells represent a suitable model of non-phagocytic cells with robust NOX-dependent production of ROS for the present study.Initially, we investigated CAB2 growth within COSphox cells, in the presence and absence of VopL. While CAB2 was able to efficiently replicate inside COSphox cells (Fig 3A) and displayed the bacterium’s normal rod-shape (Fig 3B and S6 Fig), CAB2ΔvopL grew at approximately half the rate of wild type bacteria (Fig 3A) and, importantly, demonstrated a very dramatic filamentous phenotype (Fig 3B and S6 Fig). Expression of VopL in CAB2ΔvopL from a plasmid (CAB2ΔvopL+pVopL) rescued intracellular growth to levels comparable to that of wild type bacteria (Fig 3A) and restored the rod-shaped bacterial morphology (Fig 3B and 3C). These findings are in agreement with the observations made using Caco-2 cells and support a role for VopL in bacterial intracellular survival.
Fig 3
VopL is required for CAB2 survival within COSphox cells.
(A) Intracellular growth of CAB2 strains in COSphox cells. COSphox cells were infected with indicated CAB2 strains for 2h followed by incubation with 100 μg/mL gentamicin for the specified times. Cell lysates were serially diluted and plated and CFU was enumerated for intracellular bacteria. Values are means ± SD of a representative experiment performed in triplicate. Asterisks indicate statistically significant difference in intracellular bacteria CFU counts between CAB2 + pEmpty and CAB2ΔvopL + pEmpty or between CAB2ΔvopL + pEmpty and CAB2ΔvopL + pVopL. * p < 0.05, ** p < 0.005, *** p < 0.0005. (B) Confocal micrographs of COSphox cells infected with indicated GFP-tagged CAB2 strains for 2h and incubated with 100 μg/mL gentamicin for 6h. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (C) COSphox cells invaded by CAB2 + pEmpty, CAB2ΔvopL + pEmpty, or CAB2ΔvopL + pVopL were enumerated for containment of filamentous bacteria. 90 cells per sample (each sample referring to infection by one of the 3 bacterial strains) were enumerated over 3 independent experiments. Values are means ± SD. Asterisks indicate statistically significant difference between CAB2- and CAB2ΔvopL-infection samples (*** p = 0.0002) or between CAB2ΔvopL- and CAB2ΔvopL + pVopL-infection samples (* p = 0.0122).
VopL is required for CAB2 survival within COSphox cells.
(A) Intracellular growth of CAB2 strains in COSphox cells. COSphox cells were infected with indicated CAB2 strains for 2h followed by incubation with 100 μg/mL gentamicin for the specified times. Cell lysates were serially diluted and plated and CFU was enumerated for intracellular bacteria. Values are means ± SD of a representative experiment performed in triplicate. Asterisks indicate statistically significant difference in intracellular bacteria CFU counts between CAB2 + pEmpty and CAB2ΔvopL + pEmpty or between CAB2ΔvopL + pEmpty and CAB2ΔvopL + pVopL. * p < 0.05, ** p < 0.005, *** p < 0.0005. (B) Confocal micrographs of COSphox cells infected with indicated GFP-tagged CAB2 strains for 2h and incubated with 100 μg/mL gentamicin for 6h. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (C) COSphox cells invaded by CAB2 + pEmpty, CAB2ΔvopL + pEmpty, or CAB2ΔvopL + pVopL were enumerated for containment of filamentous bacteria. 90 cells per sample (each sample referring to infection by one of the 3 bacterial strains) were enumerated over 3 independent experiments. Values are means ± SD. Asterisks indicate statistically significant difference between CAB2- and CAB2ΔvopL-infection samples (*** p = 0.0002) or between CAB2ΔvopL- and CAB2ΔvopL + pVopL-infection samples (* p = 0.0122).
Filamentation of ΔvopL
V. parahaemolyticus within COSphox cells is ROS-dependent
As with Caco-2 cells, we investigated whether filamentation of intracellular CAB2ΔvopL resulted from ROS generation by COSphox cells. First, we compared superoxide-mediated accumulation of formazan deposits in COSphox cells containing rod-shaped (CAB2) and filamentous (CAB2ΔvopL) bacteria. Formazan precipitates were greatly enriched in host cells containing filamentous bacteria (Fig 4A), being present in about 75% of these cells, a fourfold increase in comparison to cells containing rod-shaped bacteria (Fig 4B). Next, we assessed whether ROS generated in a NOX2-dependent manner was required for bacterial filamentation in COSphox cells. NOX2-dependent generation of ROS was inhibited by apocynin (APO), which blocks ROS generation by preventing the complete assembly of the NOX2 enzymatic complex [22]. APO treatment of COSphox cells abrogated infection-elicited generation of superoxide (S7 Fig) and significantly attenuated CAB2ΔvopL filamentation (Fig 4C), reducing the number of COSphox cells containing filamentous bacteria by 40% (Fig 4D). Therefore, in agreement with our findings obtained with Caco-2 cell infection, ROS is an agent involved bacterial filamentation.
Fig 4
VopL inhibits generation of superoxide.
(A) Confocal micrographs of COSphox cells infected with CAB2 (green) or CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 4h. Samples were then incubated with 1 mg/mL NBT for additional 1h in the presence of gentamicin. DNA was stained with Hoechst (blue). Formazan precipitates were visualized in bright field (DiC). Scale bars, 10 μm. (B) Quantification of cells containing rod-shaped (CAB2) or filamentous bacteria (CAB2ΔvopL) and positive for presence of formazan precipitates. 150 cells for each sample (CAB2 or CAB2ΔvopL infections) were analyzed over 3 independent experiments. Values are means ± SD. Asterisks indicate statistically significant difference between CAB2 and CAB2ΔvopL samples (** p = 0.0031). (C) Confocal micrographs of COSphox cells infected with CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 6h. At the beginning of the last hour of gentamicin incubation, either dimethyl sulfoxide (DMSO) or 250 μM APO was added to the samples. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (D) Quantification of filamentous bacteria in the presence or absence of APO. COSphox cells invaded by CAB2ΔvopL-GFP and treated with either DMSO or APO were analyzed for presence of filamentous bacteria. 300 cells for each sample (DMSO or APO), over 3 independent experiments, were analyzed for presence of filamentous bacteria. Values are means ± SD. Asterisks indicate statistically significant difference between DMSO and APO samples (** p = 0.0058). (E) COSphox cells were infected with indicated CAB2 strains for 2h after which cells were incubated with luminol substrate and luminescence was measured over 1h. Values are means ± SD from one representative experiment. Asterisks indicate statistically significant difference between CAB2- and CAB2ΔvopL-infection samples (** p = 0.0039) or between CAB2ΔvopL- and CAB2ΔvopL + pVopL-infection samples (* p = 0.0387) at minute 26 (peak of luminescence signal).
VopL inhibits generation of superoxide.
(A) Confocal micrographs of COSphox cells infected with CAB2 (green) or CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 4h. Samples were then incubated with 1 mg/mL NBT for additional 1h in the presence of gentamicin. DNA was stained with Hoechst (blue). Formazan precipitates were visualized in bright field (DiC). Scale bars, 10 μm. (B) Quantification of cells containing rod-shaped (CAB2) or filamentous bacteria (CAB2ΔvopL) and positive for presence of formazan precipitates. 150 cells for each sample (CAB2 or CAB2ΔvopLinfections) were analyzed over 3 independent experiments. Values are means ± SD. Asterisks indicate statistically significant difference between CAB2 and CAB2ΔvopL samples (** p = 0.0031). (C) Confocal micrographs of COSphox cells infected with CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 6h. At the beginning of the last hour of gentamicin incubation, either dimethyl sulfoxide (DMSO) or 250 μM APO was added to the samples. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (D) Quantification of filamentous bacteria in the presence or absence of APO. COSphox cells invaded by CAB2ΔvopL-GFP and treated with either DMSO or APO were analyzed for presence of filamentous bacteria. 300 cells for each sample (DMSO or APO), over 3 independent experiments, were analyzed for presence of filamentous bacteria. Values are means ± SD. Asterisks indicate statistically significant difference between DMSO and APO samples (** p = 0.0058). (E) COSphox cells were infected with indicated CAB2 strains for 2h after which cells were incubated with luminol substrate and luminescence was measured over 1h. Values are means ± SD from one representative experiment. Asterisks indicate statistically significant difference between CAB2- and CAB2ΔvopL-infection samples (** p = 0.0039) or between CAB2ΔvopL- and CAB2ΔvopL + pVopL-infection samples (* p = 0.0387) at minute 26 (peak of luminescence signal).
VopL suppresses generation of NOX2-derived superoxide
Our results thus far show that VopL impairs the generation of ROS inside Caco-2 and COSphox cells (given as a function of formazan accumulation in these cells). We next set out to quantify the production of ROS in the absence and presence of VopL. To quantify the production of ROS, we measured the extracellular release of superoxide by COSphox cells as a function of luminescence [35].As a control for NOX2-dependent generation of superoxide, we stimulated COSphox cells with PMA. PMA activates the NOX2 complex via PKC-mediated phosphorylation of the p47phox subunit [38]. Cell stimulation with PMA led to a sustained generation of superoxide (Fig 4E). Infection of COSphox cells with CAB2 induced the production of superoxide, which peaked at around 26 min post luminol addition and tapered off afterwards due to lack of continuous bacterial stimulus (bacteria washed away prior to luminol addition) (Fig 4E). Importantly, bacteria-stimulated generation of ROS is substantially enhanced in the absence of VopL, as the peak in luminescence signal (at 26 min) during CAB2ΔvopLinfectionis 1.7 times higher than the luminescence peak resulting from CAB2 infection (Fig 4E). Rescue of the CAB2ΔvopL strain with a VopL-expression plasmid lowered superoxide production to levels similar to that generated by the parental CAB2 strain (Fig 4E). These results confirm our hypothesis that VopL suppresses NOX-generated ROS.
VopL suppresses the movement of NOX cytosolic subunits to cell membranes
As mentioned earlier, NOX2 is a multi-subunit complex; the latent complex is disassembled in resting cells and must become assembled at cell membranes with potential to generate ROS [22]. When at rest, the NOX2 complex regulatory subunits p67phox and p47phox are present in the cytosol as a heterotrimeric complex along with p40phox [22]. Rac, another complex subunit, is also present in the cytosol in its inactive, GDP-bound, form. Upon cell stimulation, all activated cytosolic components translocate to both cell plasma and phagocytic membranes where they interact with membranous subunits gp91phox (NOX2) and p22phox and complete the assembly of a functional NOX complex [22]. Several pieces of evidence support a role for actin in NOX2 activity. For instance, addition of G-actin was shown to potentiate NOX activity in a cell-free system [39]. The p47phox and p67phox each contain a SH3 domain known to associate with the actin cytoskeleton [38]. In resting polymorphonuclear leukocytes (PMN), p67phox is detected exclusively in the detergent-insoluble, cytoskeletal fraction [38]. Additionally, inhibition of actin polymerization by cytochalasin has been shown to modulate the translocation of NOX2 subunits from the cytosol to the plasma membrane upon stimulation of PMNs [40, 41].Despite the close homology between the NOX1 and NOX2 complexes (the closest homologs within the NOX family), NOXO1, the homolog of p47phox in the NOX1 complex, lacks the autoinhibitory region (AIR) domain present in p47phox [31, 37]. As a result, NOXO1, as well as its partner NOXA1 (p67phox homolog), are constitutively associated with p22phox at the cell membrane [42]. Importantly, Rac1 is not constitutively localized to cell membranes. In fact, stimulated recruitment of Rac1 from the cytosol to cell membranes is crucial to the activation of NOXA1, and thereby, the NOX1 complex [43]. Additionally, Rac1 promotes further recruitment of NOXA1 to cell membranes [43].Given that VopL disrupts the normal assembly of the actin cytoskeleton, we hypothesized that this effector inhibited an actin-dependent step that is common to the activation of both NOX1 and NOX2 complexes. This step was hypothesized to be the recruitment of cytosolic subunits of NOX1 (Rac1) and NOX2 (p47phox, p67phox, Rac1) to cell membranes. Initially we investigated the NOX2 complex activation expressed in COSphox cells. To test our hypothesis, we transiently transfected COSphox cells with VopL and subsequently induced NOX2 activation using PMA. Cell stimulation with PMA caused p67phox to translocate from the cytosol to the plasma membrane and also caused an extensive rearrangement of the actin cytoskeleton with formation of membrane ruffles that co-localized with p67phox (compare S8A and S8B Fig). As previously reported [16], ectopic expression of wild type VopL (WT VopL) caused the formation of long actin strings reminiscent of stress fibers (Fig 5A and S8C Fig). In cells transfected with WT VopL, PMA-stimulated actin ruffles were not formed (Fig 5A) and, importantly, the translocation of p67phox from the cytosol to the cell membrane was impaired (Fig 5A). Quantification of enrichment of p67phox at the plasma membrane revealed a significantly smaller presence of this subunit at the membrane in the presence of VopL (Fig 5B).
Fig 5
VopL inhibits assembly of NOX2 complex.
COSphox cells were transiently transfected with either wild type VopL (WT VopL, panel A) or catalytically inactive VopL (WH2*3-VopL, panel C) and subsequently stimulated for ROS response with 0.4 μg/mL phorbol 12-myristate 13-acetate (PMA). Cells were immunostained for p67phox (pseudo-colored in yellow to enhance contrast) and VopL (green). DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. White, dotted boxes highlight regions within untransfected and transfected cells that were magnified. Scale bars, 40 μm (larger panels) and 10 μm (individuals cells). (B,D) PMA-stimulated translocation of p67phox from the cytosol to the plasma membrane, for untransfected cells and cells transfected with either WT VopL (B) or WH2*3-VopL (D), was quantified by analysis of line scans crossing the two cellular compartments. 90 cells for each population (untransfected or transfected with VopL) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between untransfected and WT VopL-transfected cells (** p = 0.0011).
VopL inhibits assembly of NOX2 complex.
COSphox cells were transiently transfected with either wild type VopL (WT VopL, panel A) or catalytically inactive VopL (WH2*3-VopL, panel C) and subsequently stimulated for ROS response with 0.4 μg/mL phorbol 12-myristate 13-acetate (PMA). Cells were immunostained for p67phox (pseudo-colored in yellow to enhance contrast) and VopL (green). DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. White, dotted boxes highlight regions within untransfected and transfected cells that were magnified. Scale bars, 40 μm (larger panels) and 10 μm (individuals cells). (B,D) PMA-stimulated translocation of p67phox from the cytosol to the plasma membrane, for untransfected cells and cells transfected with either WT VopL (B) or WH2*3-VopL (D), was quantified by analysis of line scans crossing the two cellular compartments. 90 cells for each population (untransfected or transfected with VopL) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between untransfected and WT VopL-transfected cells (** p = 0.0011).To confirm that the inhibitory effect of VopL on p67phox translocation is dependent on the effector’s ability to manipulate the actin cytoskeleton, we also transfected cells with WH2*3-VopL, which contains point mutations at amino acids required for the actin binding activity of the WH2 domains [16]. We previously established that WH2*3-VopL is devoid of actin assembly activity in vitro and does not induce actin stress fiber formation in transfected cells [16] (S8D Fig). Expression of WH2*3-VopL impaired neither PMA-stimulated membrane ruffling nor the cytosol-plasma membrane translocation of p67phox (Fig 5C), which was highly enriched at the plasma membrane (Fig 5D).During activation of the NOX2 complex, the stimulated recruitment of Rac to the membrane occurs independently from p47phox or p67phox [44]. Therefore, we also investigated whether VopL-mediated disruption of the actin cytoskeleton impaired translocation of Rac. To monitor Rac movement, COSphox cells were transiently transfected with EGFP-Rac1 with either WT or WH2*3-VopL. As was observed with p67phox, cells stimulated with PMA caused Rac1 to translocate from the cytosol to the plasma membrane (compare S9A and S9B Fig). At the plasma membrane, Rac1 co-localized with actin ruffles (S9B Fig). Importantly, expression of WT VopL completely inhibited PMA-stimulation recruitment of Rac1 to the plasma membrane (S9C and S9E Fig), while in cells expressing WH2*3-VopL, the cytosol-plasma membrane translocation of Rac1 was unaffected (S9D and S9E Fig).Next, we set out to determine if VopL could also inhibit stimulated recruitment of Rac1 to the plasma membrane in Caco-2 cells. Upon cell stimulation with PMA, Rac1 moved to the plasma membrane and co-localized with the actin ruffles (compare Fig 6A and 6B). When cells were co-transfected with Rac1 and wild-type VopL, but not mutant WH2*3-VopL, Rac1 remained in the cytosol (Fig 6C–6E). Therefore, VopL deploys a general mechanism to cripple the defenses of the host cell: it paralyzes the actin cytoskeleton, preventing assembly of both NOX1 and NOX2 complex, thereby inhibiting the generation of ROS during infection.
Fig 6
VopL inhibits Rac1 recruitment to NOX1 complex.
Caco-2 cells were transiently transfected with EGFP-Rac1 and treated only with vehicle (DMSO, A) or stimulated with 1 μg/mL phorbol 12-myristate 13-acetate (PMA, B). Additionally, PMA-stimulated cells were transiently transfected with either wild type VopL (WT VopL, panel C) or catalytically inactive VopL (WH2*3-VopL, panel D). Cells were immunostained for VopL (pseudo-colored in green to enhance contrast). EGFP-Rac1 was pseudo-colored in yellow to enhance contrast. DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. White arrows indicate membrane ruffles. Scale bars, 15 μm. (E) PMA-stimulated translocation of Rac1 from the cytosol to the plasma membrane, for cells transfected with either WT VopL or WH2*3-VopL, was quantified by analysis of line scans crossing the two cellular compartments. 75 cells for each population (Rac1 only or Rac1 + VopL WT/WH2*3) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between Rac1 and Rac1 + VopL WT transfected cells (** p = 0.0006) as well as between Rac1 and Rac1 + VopL WH2*3 transfected cells (*** p = 0.0001).
VopL inhibits Rac1 recruitment to NOX1 complex.
Caco-2 cells were transiently transfected with EGFP-Rac1 and treated only with vehicle (DMSO, A) or stimulated with 1 μg/mL phorbol 12-myristate 13-acetate (PMA, B). Additionally, PMA-stimulated cells were transiently transfected with either wild type VopL (WT VopL, panel C) or catalytically inactive VopL (WH2*3-VopL, panel D). Cells were immunostained for VopL (pseudo-colored in green to enhance contrast). EGFP-Rac1 was pseudo-colored in yellow to enhance contrast. DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. White arrows indicate membrane ruffles. Scale bars, 15 μm. (E) PMA-stimulated translocation of Rac1 from the cytosol to the plasma membrane, for cells transfected with either WT VopL or WH2*3-VopL, was quantified by analysis of line scans crossing the two cellular compartments. 75 cells for each population (Rac1 only or Rac1 + VopL WT/WH2*3) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between Rac1 and Rac1 + VopL WT transfected cells (** p = 0.0006) as well as between Rac1 and Rac1 + VopL WH2*3 transfected cells (*** p = 0.0001).
Jasplakinolide phenocopies VopL-mediated inhibition of NOX2 complex assembly
VopL rearranges the actin cytoskeleton into linear strings of non-functional filaments that resemble stress fibers (Fig 5A). By doing so, VopL retains p67phox and Rac1 in the cytosol, and consequently, impedes the activation of NOX2. Therefore, we assessed whether manipulation of the actin cytoskeleton in the form of stable stress fiber-like structures could account for the inhibition of NOX2 assembly.Jasplakinolide is a potent inducer of actin polymerization and a stabilizer of actin filaments [45]. Treatment of COSphox cells with jasplakinolide induced stress fiber formation (compare Fig 7A and 7B). As with VopL, jasplakinolide treatment decreased PMA-stimulated translocation of p67phox from the cytosol to the plasma membrane (compare Fig 7C and 7D). However, in contrast to VopL transfected cells treated with PMA, actin ruffles are observed at the edges of cells treated with jasplakinolide and PMA (Figs 5A and 7D, respectively). These findings further support our hypothesis that VopL manipulates the actin cytoskeleton to prevent NOX assembly and dampen ROS production.
Fig 7
Jasplakinolide arrests assembly of NOX2 complex.
COSphox cells were treated with either DMSO (A) or 100 nM jasplakinolide (B) and subsequently stimulated for ROS response with 0.4 μg/mL phorbol 12-myristate 13-acetate (PMA) (C,D). Cells were immunostained for p67phox (pseudo-colored in yellow to enhance contrast). DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. Scale bars, 20 μm. (E) PMA-stimulated translocation of p67phox from the cytosol to the plasma membrane, for cells transfected with jasplakinolide or left untreated, was quantified by analysis of line scans crossing the two cellular compartments. 90 cells for each population (DMSO treatment only, jasplakinolide-treated only, PMA-stimulated, or jasplakinolide+PMA treated) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between mock (DMSO) or PMA stimulated cells (* p = 0.0126), between jasplakinolide or PMA-treated cells (* p = 0.0136), and between PMA-stimulated or jasplakinolide+PMA treated cells (* p = 0.0127).
Jasplakinolide arrests assembly of NOX2 complex.
COSphox cells were treated with either DMSO (A) or 100 nM jasplakinolide (B) and subsequently stimulated for ROS response with 0.4 μg/mL phorbol 12-myristate 13-acetate (PMA) (C,D). Cells were immunostained for p67phox (pseudo-colored in yellow to enhance contrast). DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. Scale bars, 20 μm. (E) PMA-stimulated translocation of p67phox from the cytosol to the plasma membrane, for cells transfected with jasplakinolide or left untreated, was quantified by analysis of line scans crossing the two cellular compartments. 90 cells for each population (DMSO treatment only, jasplakinolide-treated only, PMA-stimulated, or jasplakinolide+PMA treated) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between mock (DMSO) or PMA stimulated cells (* p = 0.0126), between jasplakinolide or PMA-treated cells (* p = 0.0136), and between PMA-stimulated or jasplakinolide+PMA treated cells (* p = 0.0127).
Discussion
The T3SS2 effector VopL and its V. cholerae homologue VopF were discovered about a decade ago and their structure and biochemical activities are now well-characterized [16–19, 46–48]. The coincidental discoveries that VopL/F produces non-functional filaments [19, 20] and our findings that V. parahaemolyticus is a facultative intracellular pathogen [13] laid the groundwork for the elucidation of the biological role of VopL during infection. Here, we showed that NOX-derived generation of ROS plays an important role in controlling intracellular proliferation of V. parahaemolyticus. Specifically, ROS-dependent stress of the bacterium resulted in impairment of cell division and consequent filamentation of the bacteria. VopL is essential in preventing this deleterious event: by directly targeting the actin cytoskeleton and catalyzing the assembly of non-canonical actin filaments, VopL arrests the actin-dependent movement of cytosolic NOX subunits to cell membranes. As a result, VopL prevents the activation of the NOX complex and consequent production of ROS. Thus, this is the first report of how VopL aids V. parahaemolyticus infection: it secures a relatively “stress-free” environment within the host cell, enabling the bacterium to establish a successful replicative niche.Previous studies indicated that VopL does not play a significant role in bacterial colonization and fluid accumulation in the small intestine of rabbit models of V. parahaemolyticus infection [49, 50]. Our present findings support that VopL could have an understated contribution to enterotoxicity, not obvious in the pathogenesis markers evaluated so far, prompting future investigations of a role for VopL in a diarrheogenic model.Distinct methods are used by other intracellular pathogens to inhibit ROS-mediated killing. Some pathogens scavenge ROS using extracellular polysaccharides, as in the case of Burkholderia cenocepacia and Pseudomonas aeruginosa [51, 52]. Several other pathogens act on signaling machinery upstream of ROS and prevent activation of the NOX complex. [53-56]. Salmonella entericaTyphimurium excludes the NOX2 membranous subunits from the vacuole it inhabits in a T3SS-dependent manner [57]. Importantly, the virulence factors and mechanisms used by the vast majority of these pathogens remain unknown. The present work not only identified the virulence factor used by V. parahaemolyticus to suppress host ROS generation, but also revealed an unprecedented mechanism used by a microbial pathogen to do so (Fig 8).
Fig 8
VopL inhibits NOX-derived production of ROS.
V. parahaemolyticus deploys its T3SS2 effector VopL to disrupt the actin cytoskeleton. As a result, NOX cytosolic regulatory subunits do not translocate to cell membranes. In the absence of VopL, NOX-mediated generation of ROS induces bacterial stress, leading to bacterial filamentation.
VopL inhibits NOX-derived production of ROS.
V. parahaemolyticus deploys its T3SS2 effector VopL to disrupt the actin cytoskeleton. As a result, NOX cytosolic regulatory subunits do not translocate to cell membranes. In the absence of VopL, NOX-mediated generation of ROS induces bacterial stress, leading to bacterial filamentation.The pharmacological inhibition of NOX1 and NOX2 complexes, shown to fully suppress ROS generation in the case of apocynin, did not result in complete reduction of bacterial filamentation. These findings raise the possibility that additional factors may contribute to the arrest of bacterial division. Intracellular growth of certain Salmonella strains resulted in filamentous bacteria due to a defect in the bacterial histidine biosynthetic pathway [58]. Because V. parahaemolyticus only undergoes filamentation in the absence of VopL, under our experimental conditions, it is likely that host factors, rather than bacterial ones, elicit this morphological phenotype. Rosenberger and Finlay [59] reported an upregulation of MEK1 kinase during S. entericaTyphimuriuminfection of RAW 264.7 macrophages. MEK upregulation was causal for Salmonella filamentation, as occurrence of filamentous bacteria partially decreased in the presence of MEK inhibitors [59]. MEK and NOX activities operated in parallel to mediate Salmonella filamentation [59]. It is known that the actin cytoskeleton functions as a scaffold that mechanically modulates the activation of signaling pathways [60]. For instance, pharmacological inhibition of the actin polymerization reportedly inhibited ERK and AKT activation [61]. Interestingly, V. parahaemolyticus expresses VopA, a homolog of Yersinia spp. YopJ Ser/Thr acetyltransferase that has been shown to inhibit MAPK signaling pathways during infection [62-64]. Therefore, in addition to NOX assembly and MAPK signaling pathways, other pathways will be the subject of future investigation as further mediators of filamentation of the VopL-mutant.As discussed earlier, the T3SS2 is V. parahaemolyticus’ key virulence mechanism of enterotoxicity [9]. Importantly, T3SS2 is orthologous to the T3SS identified in several non-O1, non-O129 clinical V. cholerae strains [65]. These strains lack cholera toxin and toxin-coregulated pilus but cause acute diarrheal diseases in a T3SS-dependent manner [46]. The non-O1, non-O129 AM-19226 strain encodes VopL’s homolog VopF (32% sequence identity and 72% sequence similarity) [46]. VopF induces actin-rich protrusion formation as opposed to actin stress fibers [46]. By disrupting the actin cytoskeleton, VopF causes depolarization of the epithelium and vopF-mutant strains present deficient epithelial colonization in vivo [47]. Therefore, despite the fact that VopL and VopF share close structural homology and use the same strategy to disrupt the actin cytoskeleton, these two effectors equip their bacteria with two distinct pathogenic mechanisms. Notably, the non-O1, non-O139 strain 1587 encodes VopN, which shares similarity with both VopF and VopL [47]. VopN also nucleates actin filaments, and, like VopL, localizes to actin stress fibers [47]. While the physiological role of VopN remains elusive, we recently reported that the VopN-encoding strain 1587 invades epithelial cells in a T3SS-dependent manner [14].Over many years of evolution, V. parahaemolyticus’ T3SS2 has maintained a repertoire of around a dozen effectors. One of these, VopC, has been shown to mediate cell invasion, and we now show a role for VopL in relieving free-radical stress for this intracellular pathogen. The activities of some of the other T3SS2 effectors have been studied and now the role that they play in this evolutionarily conserved invasive T3SS are ripe for future investigation.
Materials and methods
Bacterial strains and culture conditions
The V. parahaemolyticusCAB2 strain was derived from POR1 (clinical isolate RIMD2210633 lacking TDH toxins), the latter being a generous gift from Drs. Tetsuya Iida and Takeshi Honda [66]. The CAB2 strain was made by deleting the gene encoding the transcriptional factor ExsA, which regulates the activation of the T3SS1 [14]. CAB2 was grown in Luria-Bertani (LB) medium, supplemented with NaCl to a final concentration of 3% (w/v), at 30 °C. When necessary, the medium was supplemented with 50 μg/mL spectinomycin (to select for growth of CAB2-GFP strains [9]) or 250 μg/mL kanamycin.
Deletion of vopL from CAB2 strain
For in-frame deletion of vopL (vpa1370 in RimD2210633, GeneBank sequence accession number NC_004605), the nucleotide sequences 1kb upstream and downstream of the gene were cloned into pDM4, a Cmr Ori6RK suicide plasmid [14]. Primers used were 5’ GATCGTCGACATCAAATTGAATGCACTATGATC 3’ and 5’ GATCACTAGTAAAGAAGACCCCTTTATTGATTC 3’ for amplification of 1kb upstream region, and 5’ GATCACTAGTCTAGCGAGCACATAAAAAGC 3’ and 5’ GATCAGATCTTCCGGGGTGGTAAATGCTT3’ for 1kb downstream region. 1kb sequences were then inserted between SalI and SpeI sites (upstream region) or SpeI and BglII (downstream region) sites of the plasmid multiple cloning site. The resulting construct was inserted into CAB2 via conjugation by S17-1 (λpir) Escherichia coli. Transconjugants were selected for on minimal marine medium (MMM) agar containing 25 μg/mL chloramphenicol. Subsequent bacterial growth on MMM agar containing 15% (w/v) allowed for counter selection and curing of sacB-containing pDM4. Deletion was confirmed by PCR and sequencing analysis.
Reconstitution of CAB2ΔvopL
For reconstitution of CAB2ΔvopL, the sequence coding for vopL + FLAG tag was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTC TTA CTTATCGTCGTCATCCTTGTAATC CGATAATTTTGCAGATAGTGC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin) between PstI and EcoRI sites. The 1kb nucleotide sequence upstream of vopC (vpa1321 in RimD2210633, accession numberNC_004605.1) was used as a promoter and cloned between XhoI and PstI sites using the primers 5’ GATC CTCGAG TATTCTTAATAAGTCAGGAGG 3’ and 5’GATC CTCGAG TATTCTTAATAAGTCAGGAGG3’. The resulting construct was inserted into CAB2ΔvopL via triparental conjugation using E. coli DH5α (pRK2073). Transconjugants were selected for on MMM agar containing 250 μg/mL kanamycin. Reconstitution was confirmed by PCR. Empty pBAD plasmid (without vopL gene insertion) was introduced to CAB2 and CAB2ΔvopL strains for consistency in bacterial strain manipulation.
Mammalian cell culture
Caco-2 cells (ATCC, Manassas, VA) were maintained in Minimal Essential Medium with Earl’s Balanced Salts (MEM/EBSS, Hyclone, Logan, UT), supplemented with 20% (v/v) fetal bovine serum (Sigma-Aldrich, St. Louis, MO), 1% (v/v) penicillin-streptomycin (Thermo Fisher Scientific, Waltham, MA), and kept at 5% CO2 and 37°C. COSphox cells were grown in low-glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Thermo Fisher Scientific) supplemented with 10% (v/v) fetal bovine serum, 1% (v/v) penicillin-streptomycin, 1% (v/v) sodium pyruvate (Thermo Fisher Scientific), 0.8 mg/mL G418 (Thermo Fisher Scientific), 200 μg/mL hygromycin (Thermo Fisher Scientific), and 1 μg/mL puromycin (Thermo Fisher Scientific), at 37°C with 5% CO2 [35].
Infection of tissue culture cells
Caco-2 and COSphox cells were seeded onto 24-well plates at a density of 2.5x105 (Caco-2) or 1.5x105 cells/well (COSphox) and grown for 18–20 h. Overnight-grown bacterial cultures were normalized to an optical density at 600 nm (OD600) of 0.3 and then grown in MLB supplemented with 0.05% (w/v) bile salts for 90 min at 37°C. Growth in the presence of bile salts allowed for induction of T3SS2 [11, 12]. Mammalian host cells were subsequently infected with CAB2 strains at a multiplicity of infection (MOI) of 10 using culture medium devoid of antibiotics (infection medium). To synchronize infection, cell plates were centrifuged at 200x g for 5 minutes. Infection was carried out for 2 h at 37°C, after which cells were washed with unsupplemented MEM/EBSS or DMEM and subsequently treated with infection medium containing 100 μg/mL gentamicin for 1–6 h. At the end of each time point, host cells were washed with 1x PBS for removal of extracellular dead bacteria and lysed with 0.5% (v/v) TX-100. Cell lysates were serially diluted and plated on MMM agar for counting of colony forming units (CFU) as a measurement of intracellular bacterial survival/replication. To analyze bacterial filamentation, host cells were counted as containing filamentous bacteria when the cell predominantly contained bacteria longer than wild-type (CAB2) size bacteria. Filamentous bacteria needed to be at least twice the size the size of wild-type CAB2 to be considered filamentous.Where indicated, samples were pre-treated with 10 μM GKT136901 (GKT, Aobious, Gloucester, MA) or added with 250 μM apocynin (APO, Sigma-Aldrich) at the remaining last 1 hour of infection or last hour of gentamicin incubation (6th hour).
Microscopic NBT assay
Caco-2/COSphox cells were left uninfected or infected as described above. Within 3 (Caco-2) or 4 (COSphox) hours of gentamicin incubation, cell media was replaced with fresh media containing 1 mg/mL nitroblue tetrazolium (NBT, Sigma-Aldrich) and gentamicin for additional 3 (Caco-2) or 1 (COSphox) hour. GKT or DMSO were added where indicated. Samples were then process for confocal analysis as described below.
Quantification of superoxide production
Caco-2 or COSphox cells were seeded onto 6-well plates at 5x105 cells/well and infected with CAB2 strains for 2 h as described above. Cells were trypsinized (0.25% trypsin/EDTA), centrifuged at 200x g for 5 min, and resuspended in Hank’s Balanced Salt Solution (HBSS, ThermoFisher) supplemented with Ca2+ and Mg2+. Superoxide production was measured as a function of emission of luminescence using the Diogenes kit (National Diagnostics Lab, Atlanta, GA) and according to the manufacturer’s protocol [35]. Luminescence was monitored over 60 minutes using a FluoStar Optima plate reader.
Transient transfection of mammalian cells
Caco-2 and COSphox cells were transiently transfected with 0.3 μg of either wild type (WT) VopL-Flag-psFFV or catalytically inactive VopL-WH2x3*-Flag-psFFV constructs [16], 0.5 μg of pcDNA3-EGFP-Rac1 [67] (plasmid # 12980, Addgene, Cambridge, MA) + 1.2 μg of empty psFFV using Fugene HD (Promega) for COSphox cells or Lipofectamine LTX with PLUS reagent (ThermoFisher) for Caco-2 cells for 20–24 h. Subsequently, COSphox/Caco-2 cells were treated with 0.4/1.0 μg/mL phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich) for 10/30 min at 37°C.
Confocal microscopy imaging
For imaging, Caco-2 and COSphox cells were seeded respectively at 2.5x105 and 1-2x105cells/well onto 6-well plates containing UV-sterilized, poly-L-lysine-coated (Sigma), glass coverslips. Following the infection and transfection protocols described above, samples were fixed with 3.2% (v/v) ρ-formaldehyde (Thermo Fisher Scientific) for 10 minutes at room temperature. Transfected COSphox cells were permeabilized with 0.5% (w/v) saponin (Sigma) for 10 minutes at room temperature and then blocked with 1% (w/v) bovine serum albumin (BSA, Sigma-Aldrich) in the presence of 0.1% saponin for 30 minutes at room temperature. In order to detect cells transfected with VopL, samples were subsequently incubated with anti-Flag antibody (1:100 dilution in 0.5% BSA, 0.1% saponin [Cell Signaling, #2368, Danvers, MA]) for 1 hour at room temperature, followed by incubation with anti-rabbit Alexa Fluor 488/A555 conjugated secondary antibody (1:500 dilution in 0.5% BSA, 0.1% saponin [Thermo Fisher Scientific, A-21441]) for another 1h, room temperature. For detection of p67phox, samples were incubated with anti-p67phox at 1:50 dilution (Santa Cruz, sc-7662, Dallas, TX), followed by incubation with anti-goatAlexa Fluor 555 conjugated secondary antibody (1:500 dilution [Thermo Fisher Scientific, A-21432]).F-actin was stained with 2 units/mL of either rhodamine- orAlexa Fluor 680-phalloidin (Thermo Fisher Scientific) and DNA was stained with 1 μg/mL Hoechst A33342 (Invitrogen, Carlsbad, CA). Coverslips were placed sample-side down on glass slides containing Prolong Gold anti-fade mounting media (Thermo Fisher Scientific) and imaged on Zeiss LSM710 and LSM800 confocal microscopes. Images were converted using ImageJ (NIH).
Statistical analysis
All data are given as mean ± standard deviation from at least 3 independent experiments unless stated otherwise. Each experiment was conducted in triplicate. Statistical analyses were performed by using unpaired, two-tailed Student’s t test with Welch’s correction. A p value of < 0.05 was considered significant.
V. parahaemolyticus undergoes filamentation in the absence of VopL.
(A,B) Confocal micrographs of Caco-2 cells infected with indicated GFP-tagged CAB2 strains for 2h and incubated with 100 μg/mL gentamicin for (A) 2h or (B) 4h. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (C) Confocal micrograph highlights filamentous bacteria containing multiple nucleoids. Dotted white boxes indicate magnified bacteria. White arrows indicate bacterial nucleoids.(TIF)Click here for additional data file.
VopL inhibits ROS response in Caco-2 cells.
Confocal micrographs of Caco-2 cells left uninfected or infected with either CAB2-GFP (green) or CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 3h. Samples were then incubated with 1 mg/mL NBT for additional 3h in the presence of gentamicin. DNA was stained with Hoechst (blue). Formazan precipitates were visualized in bright field (DiC). Scale bars, 100 μm.(TIF)Click here for additional data file.
GTK suppresses intracellular generation of ROS.
Confocal micrographs of Caco-2 cells left uninfected or infected with CAB2ΔvopL-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 3h. Samples were then incubated with 1 mg/mL NBT for additional 3h in the presence of gentamicin. Host cells were pre-treated with either dimethyl sulfoxide (DMSO) or 10 μM GKT136901 (GKT), which were kept throughout infection. DNA was stained with Hoechst (blue). Formazan precipitates were visualized in bright field (DiC). Scale bars, 100 μm.(TIF)Click here for additional data file.
GKT does not affect intracellular growth of CAB2.
(A) Confocal micrographs of Caco-2 cells infected with CAB2-GFP (green) for 2h followed by incubation with 100 μg/mL gentamicin for 6h. Host cells were pre-treated with either dimethyl sulfoxide (DMSO) or 10 μM GKT136901 (GKT), which were kept throughout infection. DNA was stained with Hoechst (blue). Scale bars, 10 μm. (B) Quantification of filamentous bacteria in the presence or absence of GKT. Caco-2 cells invaded by CAB2-GFP and treated with either DMSO or GKT were analyzed for presence of filamentous bacteria. 300 cells for each sample (DMSO or GKT), over 3 independent experiments, were analyzed for presence of filamentous bacteria. Values are means ± SD. Difference in number of Caco-2 cells containing filamentous bacteria between DMSO- and GKT-treated samples was not statistically significant.(TIF)Click here for additional data file.
Low production of superoxide from Caco-2 cells.
Caco-2 and COSphox cells were left untreated or treated with 0.4 μg/mL phorbol 12-myristate 13-acetate (PMA) and superoxide production was measured as a function of luminescence intensity. Values are means ± SD from one representative experiment.(TIF)Click here for additional data file.
Filamentous growth of CAB2ΔvopL within COSphox cells.
Confocal micrographs of Caco-2 cells infected with indicated GFP-tagged CAB2 strains for 2h and incubated with 100 μg/mL gentamicin for 3-5h. DNA was stained with Hoechst (blue). Scale bars, 10 μm.(TIF)Click here for additional data file.
Apocynin suppresses bacterial-induced generation of superoxide.
COSphox cells were infected with indicated CAB2ΔvopL for 2h. 1h prior to the end of the infection, 250 μM apocynin (APO) was added and superoxide production was measured as a function of luminescence intensity. As a positive control of suppression of superoxide, 50 units of superoxide dismutase were added at the end of infection. Values are means ± SD from one representative experiment.(TIF)Click here for additional data file.
VopL disrupts the actin cytoskeleton.
COSphox cells were stimulated for ROS production with 0.4 μg/mL phorbol 12-myristate 13-acetate (PMA, panel B). Cells treated with only vehicle (dimethyl sulfoxide, DMSO) were left unstransfected (A) or transiently transfected with either wild type VopL (WT VopL, panel C) or catalytically inactive VopL (VopL-WH2x3*, panel D). Cells were immunostained for p67phox (pseudo-colored in yellow to enhance contrast) and VopL (green). DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. Scale bars, 40 μm.(TIF)Click here for additional data file.
VopL inhibits stimulated recruitment of Rac1 to the plasma membrane.
COSphox cells were transiently transfected with EGFP-Rac1 and treated only with vehicle (DMSO, A) or stimulated with 0.4 μg/mL phorbol 12-myristate 13-acetate (PMA, B). Additionally, PMA-stimulated cells were transiently transfected with either wild type VopL (WT VopL, panel C) or catalytically inactive VopL (WH2*3-VopL, panel D). Cells were immunostained for VopL (pseudo-colored in green to enhance contrast). EGFP-Rac1 was pseudo-colored in yellow to enhance contrast. DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. Scale bars, 40 μm. (E) PMA-stimulated translocation of Rac1 from the cytosol to the plasma membrane in cells transfected only with Rac1 or transfected with both Rac1 and VopL WT/WH2*3 was monitored. Quantification was performed by analysis of line scans crossing the two cellular compartments. 90 cells for each population (Rac1 only or Rac1 + VopL WT/WH2*3) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between Rac1 and Rac1 + VopL WT transfected cells (** p = 0.0074) as well as between Rac1 and Rac1 + VopL WH2*3 transfected cells (*** p = 0.0005).(TIF)Click here for additional data file.
Authors: Jennifer E Trosky; Sohini Mukherjee; Dara L Burdette; Margaret Roberts; Linda McCarter; Richard M Siegel; Kim Orth Journal: J Biol Chem Date: 2004-09-30 Impact factor: 5.157
Authors: Amy D B Liverman; Hui-Chun Cheng; Jennifer E Trosky; Daisy W Leung; Melanie L Yarbrough; Dara L Burdette; Michael K Rosen; Kim Orth Journal: Proc Natl Acad Sci U S A Date: 2007-10-17 Impact factor: 11.205
Authors: Joe Dan Dunn; Cristina Bosmani; Caroline Barisch; Lyudmil Raykov; Louise H Lefrançois; Elena Cardenal-Muñoz; Ana Teresa López-Jiménez; Thierry Soldati Journal: Front Immunol Date: 2018-01-04 Impact factor: 7.561
Authors: Hyungjun Yang; Marcela de Souza Santos; Julia Lee; Hong T Law; Suneeta Chimalapati; Elena F Verdu; Kim Orth; Bruce A Vallance Journal: mBio Date: 2019-12-17 Impact factor: 7.867
Authors: Todd J Treangen; Krista L Ternus; Gene D Godbold; Anthony D Kappell; Danielle S LeSassier Journal: Infect Immun Date: 2021-11-15 Impact factor: 3.609
Authors: Suneeta Chimalapati; Marcela de Souza Santos; Alexander E Lafrance; Ann Ray; Wan-Ru Lee; Giomar Rivera-Cancel; Gonçalo Vale; Krzysztof Pawlowski; Matthew A Mitsche; Jeffrey G McDonald; Jen Liou; Kim Orth Journal: Elife Date: 2020-08-18 Impact factor: 8.140