Identification of benthic diatoms isolated from the eastern tidal flats of the Yellow Sea: Comparison between morphological and molecular approaches.

Benthic diatoms isolated from tidal flats in the west coast of Korea were identified through both traditional morphological method and molecular phylogenetic method for methodological comparison. For the molecular phylogenetic analyses, we sequenced the 18S rRNA and the ribulose bisphosphate carboxylase large subunit coding gene, rbcL. Further, the comparative analysis allowed for the assessment of the suitability as a genetic marker for identification of closely related benthic diatom species and as potential barcode gene. Based on the traditional morphological identification system, the 61 isolated strains were classified into 52 previously known taxa from 13 genera. However, 17 strains could not be classified as known species by morphological analyses, suggesting a hidden diversity of benthic diatoms. The Blast search on NCBI's Genebank indicated that the reference sequences for most of the species were absent for the benthic diatoms. Of the two genetic markers, the rbcL genes were more divergent than the 18S rRNA genes. Furthermore, a long branch attraction artefact was found in the 18S rRNA phylogeny. These results suggest that the rbcL gene is a more appropriate genetic marker for identification and classification of benthic diatoms. Considering their high diversity and simple shapes, and thus the difficulty associated with morphological classification of benthic diatoms, a molecular approach could provide a relatively easy and reliable classification system. However, this study suggests that more effort should be made to construct a reliable database containing polyphasic taxonomic data for diatom classification.

Introduction

Diatoms are the most dominant taxa among the various microalgae and are known to account for ca. 40% of the total primary production in the ocean [1, 2]. Diatoms also play an important role in the biogeochemical cycles of carbon and silica [3]. In tidal flats, especially, benthic diatoms are the most dominant and diverse group and are key organisms that contribute to the preservation of the ecological functions of tidal flats such as primary production, nutrient cycling, and sediment stabilization [4-7]. Thus, the ecology and diversity of diatoms in tidal flats has received attention for a long time [8-11]. Although the study of diatom diversity has a relatively long history, overcoming the limitations of morphological classifications remains to be problematic. The small size and simple forms of benthic diatoms have made it difficult to study their diversity [12-14]. Furthermore, since the classification system is based on morphological characteristics of the type specimen, it is difficult to determine whether species having a similar form that appear in a variety of environments are the same species or different ones.

Since molecular techniques were applied to diatom research for the first time in the 1980s [15], molecular phylogenetic studies have been widely performed to identify and classify diatoms to overcome morphological limitations [Protist. 2007 ">16-19]. DNA barcoding is a method for α-taxonomy using molecular analyses based on differences in DNA sequences according to species. Therefore, unique DNA sequences can be referred to as tags or barcodes for each taxon [20]. Using DNA barcoding techniques, even morphologically similar strains can be identified at the species level. These molecular phylogenetic analyses have also enabled the rapid, convenient, and accurate classification of diatoms and have thus contributed considerably to studies on the diversity of diatoms.

Specific marker genes are used for molecular phylogenetic analyses. Different DNA regions within the nuclear rRNA gene, as well as mitochondrial and chloroplast genes, have been used for the phylogenetic analysis of diatoms [21]. Among them, nuclear 18S rRNA has been the most widely used [20, 22, 23]. The ribulose-1,5-bisphosphate carboxylase large subunit (rbcL) gene in chloroplasts has also been used for the phylogenetic study of diatoms [16, 24–26]. In addition, the cytochrome c oxidase subunit I (coxI), internal transcribed spacer (ITS), and ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) have been used for the phylogenetic study of diatoms [16, 21, 27, 28]. However, these genetic makers have fewer records in public databases compared with the 18S rRNA gene.

In this study, morphological and molecular taxonomic characteristics of benthic diatoms isolated from tidal flats were investigated to evaluate the applicability of molecular phylogenetic approaches using 18S rRNA and rbcL genes. In addition, we present morphological as well as genetic information on the benthic diatoms. Although this research does not reveal the complete diversity of diatoms in tidal flats, it will be helpful in further studies on the diversity of benthic diatoms in various environments throughout the world.

Materials and methods

Collection, isolation and development of new strains

Benthic diatoms were collected mainly from tidal flats of Geunso Bay in Taean (36° 44' 12.06" N 126° 10' 47.52" E), Eulwang-ri (37° 26' 43.67" N 126° 22' 18.07" E), and saline Sihwa (37° 18' 46.73" N 126° 36' 32.64" E) along the west coast of Korea (Fig 1). The numbers of strains obtained in each region were 53 in Geunso Bay and four in Sihwa, and four in Eulwang-ri. Most samples were obtained in the Geunso Bay where regular monthly surveys had been conducted from 2009. Geunso Bay is a semi-enclosed bay with an area of 87 km2, and the water depth at high tide is 2–4 m depending on the area. There is no inflow river, and facies are predominantly sandy silt. The Oi tidal flat, where Sihwa station is located, has an area of 0.025 km2, and the facies are predominantly silty sand. Eulwang-ri is a sandy facies and there is a beach near the sampling station.

Fig 1

Map of the study sampling locations.

(TA: Taean, SH: Sihwa, EW: Eulwang-ri).

To obtain sediment samples containing diatoms, the surface of the tidal flat was scratched to a depth of ca. 2 mm and the sediment collected in a conical tube. Samples were transported to the laboratory under refrigerated conditions and then incubated at ± 2°C of the in situ temperature. Diatom strains were isolated within 1 day of sampling. A single-diatom cell was isolated under an inverted microscope (Eclipse Ti-U; Nikon, Tokyo, Japan) using a glass Pasteur pipette and placed into a 24-well plate containing f/2 medium with silicate (Sigma-Aldrich, St. Louis, MO, USA). After confirmation of monoclonal growth, each culture was transferred to a new tissue culture flask (Falcon, Cockeysville, MD, USA) containing 35 ml of fresh medium for one week. Several cultures suspected to be a mixture were further isolated by a dilution method [29]. All strains were incubated at 15°C under a 12:12 h light-dark cycle. Illumination was provided by a fluorescent lamp with an irradiance of ca. 100 μmol photons m-2s-1. The strains were transferred to fresh medium every 2 or 3 weeks. Research activities at the sampling areas of this study did not require specific permission because the areas are not restricted or ecosystem protected. Endangered and protected species do not live in the study area and thus were not included in the survey.

Morphological observations

Monoclonal cultures of benthic diatom strains were identified to the genus or species level by morphological features based on observations under light and scanning electron microscopy. For the light microscopy examination, diatom cultures were treated with acid to prepare cleaned frustules [30], and then permanent slides were made using Mountmedia (Wako Pure Chemical Industries, Osaka, Japan). The slides were examined using light microscopy under a ×100 oil immersion objective lens (Eclipse 80i; Nikon). For scanning electron microscopy examination, diatom cells fixed with Lugol’s solution were filtered onto a polycarbonate filter (diameter of 25 mm; pore size of 1 or 2 μm) and then washed with distilled water. The filter papers were dehydrated in a graded ethanol series (10%, 25%, 50%, 75%, 90%, and 100%) and dried using tetramethylsilane (Sigma-Aldrich, St. Louis, MO, USA). Finally, the samples were mounted onto stubs and sputter-coated with platinum. Observations were performed with a Hitachi S–4300 scanning electron microscope (Hitachi, Tokyo, Japan). The previous studies were referred to for instructions on morphological comparisons [31-41]. Strains that did not match those in the published literature were treated as unidentified species.

DNA extraction, PCR and sequencing

For DNA extraction, the cultured strain (100 μl) was harvested by centrifugation at 14,000 × g for 1 min and the cell pellet was resuspended in 1 ml of sterilized STE (sodium chloride-Tris-EDTA, pH 7.8) buffer solution. Two cycles of freezing (–80°C) and thawing (95°C) were followed by vigorous vortexing with sterilized silica/zirconium beads to break the cells. To remove cell debris, the lysate was centrifuged at 8,000 × g for 1 min. The supernatant was dispensed into a clean tube and used as template DNA for PCR.

PCR amplification was performed using two primer sets: Diatom9F (5′–TGTGGGAGAGGGGAAATCAAG–3′) [42] and EukB-R (5′–TGATCCTTCTGCAGGTTCACCAC–3′) [15] for 18S rDNA, and DPrbcL1 (5′–AAGGAGAAATHAATGTCT–3′) and DPrbcL7 (5′–AARCAACCTTGTGTAAGTCTC–3′) for the rbcL gene [43]. These primers produced PCR products of approximately 1,600 bp and 1,550 bp, respectively. PCR was performed in a total volume of 30 μl, containing 1.0 μl of template DNA, 3 μl of 10 × Ex Taq buffer, 2.4 μl of dNTPs (10 mM), 0.5 μl of each primer (10 μM), and 0.2 μl of TaKaRa Ex Taq polymerase (5 U μl−1; Takara, Otsu, Japan). PCR was conducted using the following conditions: PCR of 18S rRNA was conducted with initial denaturation at 94°C for 5 min, 34 cycles of main amplification (94°C for 45 sec, 55°C for 55 sec, 72°C for 2 min), and final extension at 72°C for 10 min. PCR of rbcL was conducted with initial denaturation at 94°C for 3 min, 35 cycles of main amplification (94°C for 1 min, 55°C for 1 min, 72°C for 1.5 min), and final extension at 72°C for 10 min. PCR products were purified using the Accuprep PCR Purification Kit (Bioneer, Daejeon, South Korea) and sent for commercial sequencing at Macrogen (Seoul, South Korea). The electrophenogram outputs for each product were edited and assembled using the ChromasPro v.1.45 program (www.technelysium.com.au/chromas.html) and Vector NTI Advance 11 (Invitrogen Corp., Carlsbad, CA, USA). The sequences obtained in this study were deposited in GenBank and the accession numbers of the sequences are shown in Table 1.

Table 1

Strains of the benthic diatoms isolated in this study, information on their collection, and accession numbers of 18S rRNA and rbcL gene sequences.

Species names were determined by morphological analyses.

Species name by morphological characteristics	Straindesignation	Collection information(Location / Date)	Accession number
			18S	rbcL
Bacillaria paxillifer (O.F. Müller) T. Marsson	EW234	Eulwang-ri, Incheon, Korea / 20 Apr 2012	KY320376	KY320315
Unidentified Bacillaria sp.1	SH349	Sihwa, Siheung, Korea / 8 Mar 2013	KY320377	KY320316
Cylindrotheca closterium (Ehrenberg) Reimann & J.C. Lewin	TA256	Geunso Bay, Taean, Korea / 11 Apr 2011	KY320373	KY320312
Cylindrotheca gracilis (Brébisson ex Kützing) Grunow	TA46	Geunso Bay, Taean, Korea / 21 Jan 2011	KY320374	KY320313
Unidentified Cylindrotheca sp.1	TA198	Geunso Bay, Taean, Korea / 23 Mar 2011	KY320375	KY320314
Nitzschia aequorea Hustedt	Dilu38	Geunso Bay, Taean, Korea / 22 Mar 2012	KY320391	KY320330
Nitzschia bergii A. Cleve	TA139	Geunso Bay, Taean, Korea / 23 Mar 2011	KY320379	KY320318
Nitzschia dissipata (Kützing) Rabenhorst	TA44TA192	Geunso Bay, Taean, Korea / 21 Jan 2011Geunso Bay, Taean, Korea / 23 Mar 2011	KY320393KY320394	KY320332KY320333
Nitzschia dubia W. Smith	TA37	Geunso Bay, Taean, Korea / 21 Jan 2011	KY320381	KY320321
Nitzschia dubiiformis Hustedt	SH366	Sihwa, Siheung, Korea / 8 Mar 2013	KY320382	KY320320
Nitzschia liebetruthii Rabenhorst	TA353	Geunso Bay, Taean, Korea / 23 Feb 2012	KY320378	KY320331
Nitzschia ligowskii Witkowski, Lange-Bertalot, Kociolek & Brzezinska	TA426	Geunso Bay, Taean, Korea / 5 Dec 2013	KY320392	KY320317
Nitzschia paleaeformis Hustedt	TA394	Geunso Bay, Taean, Korea / 22 Mar 2012	KY320383	KY320322
Nitzschia cf. paleacea	TA406	Geunso Bay, Taean, Korea / 22 Jan 2014	KY320380	KY320319
Nitzschia pellucida Grunow	EW229	Eulwang-ri, Incheon, Korea / 20 Apr 2012	KY320389	KY320328
Nitzschia pusilla Grunow	TA-45TA420	Geunso Bay, Taean, Korea / 17 Apr 2014Geunso Bay, Taean, Korea / 5 Dec 2013	KY320384KY320390	KY320323KY320329
Nitzschia sigma (Kützing) W. Smith	TA341TA377	Geunso Bay, Taean, Korea / 23 Feb 2012Geunso Bay, Taean, Korea / 22 Mar 2012	KY320395KY320385	KY320337KY320324
Nitzschia sigmaformis Hustedt	TA311	Geunso Bay, Taean, Korea / 27 Jan 2012	KY320386	KY320325
Unidentified Nitzschia sp.1	Dilu16	Geunso Bay, Taean, Korea / 22 Mar 2012	KY320387	KY320326
Unidentified Nitzschia sp.2	TA61	Geunso Bay, Taean, Korea / 21 Jan 2011	KY320388	KY320327
Unidentified Nitzschia sp.4	TA409	Geunso Bay, Taean, Korea / 22 Jan 2014	KY320396	KY320338
Tryblionella apiculata Gregory	TA-85	Geunso Bay, Taean, Korea / 17 Apr 2014	KY320397	KY320334
Berkeleya fennica Juhlin-Dannfelt	TA424	Geunso Bay, Taean, Korea / 5 Dec 2013	KY320346	KY320285
Berkeleya rutilans (Trentepohl ex Roth) Grunow	TA440	Geunso Bay, Taean, Korea / 5 Dec 2013	KY320345	KY320284
Parlibellus delognei (Van Heurck) E.J. Cox	TA387	Geunso Bay, Taean, Korea / 22 Mar 2012	KY320352	KY320291
Haslea nipkowii (Meister) M. Poulin & G. Massé	SH381	Sihwa, Siheung, Korea / 8 Mar 2013	KY320351	KY320290
Haslea pseudostrearia Massé, Rincé & E.J. Cox	TA280	Geunso Bay, Taean, Korea / 11 Apr 2011	KY320350	KY320289
Navicula agatkae Witkowski	TA291	Geunso Bay, Taean, Korea / 11 Apr 2011	KY320353	KY320292
Navicula flagellifera Hustedt	TA105	Geunso Bay, Taean, Korea / 10 Feb 2011	KY320357	KY320296
Navicula gregaria Donkin	TA289	Geunso Bay, Taean, Korea / 11 Apr 2011	KY320358	KY320297
Navicula incertata Lange-Bertalot	TA414	Geunso Bay, Taean, Korea / 5 Dec 2013	KY320359	KY320298
Navicula perminuta Grunow	TA413 TA441	Geunso Bay, Taean, Korea / 5 Dec 2013Geunso Bay, Taean, Korea / 5 Dec 2013	KY320360KY320361	KY320299KY320300
Navicula ramosissima (C. Agardh) Cleve	TA316 TA439	Geunso Bay, Taean, Korea / 27 Jan 2012Geunso Bay, Taean, Korea / 5 Dec 2013	KY320362KY320363	KY320301KY320302
Navicula salinarum Grunow	TA402	Geunso Bay, Taean, Korea / 22 Jan 2014	KY320364	KY320303
Navicula salinarum var. minima R. Kolbe	TA416	Geunso Bay, Taean, Korea / 22 Jan 2014	KY320365	KY320304
Navicula cf. salinarum	TA407	Geunso Bay, Taean, Korea / 22 Jan 2014	KY320354	KY320293
Navicula salinicola Hustedt	TA204	Geunso Bay, Taean, Korea / 23 Mar 2011	KY320366	KY320305
Navicula trivialis Lange-Bertalot	TA83	Geunso Bay, Taean, Korea / 21 Jan 2011	KY320372	KY320311
Unidentified Navicula sp. 1	TA298	Geunso Bay, Taean, Korea / 11 Apr 2011	KY320367	KY320306
Unidentified Navicula sp. 2	TA64	Geunso Bay, Taean, Korea / 21 Jan 2011	KY320368	KY320307
Unidentified Navicula sp. 3	EW220	Eulwang-ri, Incheon, Korea / 20 Apr 2012	KY320370	KY320309
Unidentified Navicula sp. 4	TA323	Geunso Bay, Taean, Korea / 27 Jan 2012	KY320369	KY320308
Unidentified Navicula sp. 5	TU3	Geunso Bay, Taean, Korea / 5 Dec 2013	KY320371	KY320310
Unidentified Navicula sp. 6	TA308TA446	Geunso Bay, Taean, Korea / 27 Jan 2012Geunso Bay, Taean, Korea / 5 Dec 2013	KY320355KY320356	KY320294KY320295
Unidentified Seminavis sp.	TA305	Geunso Bay, Taean, Korea / 27 Jan 2012	KY320398	KY320335
Gyrosigma limosum Sterrenburg & Underwood	TA152TA400	Geunso Bay, Taean, Korea / 23 Mar 2011Geunso Bay, Taean, Korea / 22 Jan 2014	KY320347KY320348	KY320347KY320348
Unidentified Pleurosigma sp.	TA34	Geunso Bay, Taean, Korea / 21 Jan 2011	KY320349	KY320288
Entomoneis paludosa	TA208TA263	Geunso Bay, Taean, Korea / 23 Mar 2011Geunso Bay, Taean, Korea / 11 Apr 2011	KY320339KY320340	KY320278KY320279
Unidentified Entomoneis sp. 1	TA410	Geunso Bay, Taean, Korea / 22 Jan 2014	KY320341	KY320280
Unidentified Entomoneis sp. 2	TA350SH373	Geunso Bay, Taean, Korea / 23 Feb 2012Sihwa, Siheung, Korea / 8 Mar 2013	KY320343KY320342	KY320282KY320281
Unidentified Entomoneis sp. 3	EW239	Eulwang-ri, Incheon, Korea / 20 Apr 2012	KY320344	KY320283
Petrodictyon gemma (Ehrenberg) D.G. Mann	TA201	Geunso Bay, Taean, Korea / 23 Mar 2011	KY320399	KY320336

Sequence alignment and phylogenetic analyses

For phylogenetic analysis, 18S rRNA and rbcL sequences from diatoms were retrieved in GenBank (www.ncbi.nlm.nih.gov). After excluding uncultured and environmental clone sequences, 1,853 sequences of the 18S rRNA gene and 1,473 sequences of the rbcL gene were aligned with the sequences obtained in present study using the ARB program [44] and corrected manually. Two Ochrophyta species (Nannochloropsis salina D.J. Hibberd and Ochromonas danica E.G. Pringsheim) were used as an outgroup. Neighbor–joining (NJ) and maximum–parsimony (MP) trees were constructed using MEGA 5.2 [45]. Maximum–likelihood (ML) trees were constructed using Randomized Axelerated Maximum Likelihood (RAxML) v.8.2.1 [46]. We used the “–f a” option for rapid bootstrap analysis and the best likelihood tree search using “–# 100” with default settings, namely, “–m GTRGAMMA” for the substitution model with rate heterogeneity, “–i” for the automatically optimized SPR rearrangement for heuristic search, and “–c” for 25 distinct rate categories. The robustness of each clade was assessed by further bootstrap analyses (1,000 replications) under the NJ and MP criteria using MEGA v.5.2 [45].

Results

The 61 diatom isolates were identified by morphometric characteristics using light and scanning electron microscopy and their detailed information is shown in Table 2. All strains were raphid diatoms and classified into 3 orders, 6 families, 13 genera, and 52 taxa (36 known and 16 unknown taxa; Fig 2). Forty-two strains could be morphologically identified to the species level (Table 2). Most isolates belonged to Bacillariaceae (25 isolates under 4 genera, 22 taxa) or Naviculaceae (23 isolates under 3 genera, 20 taxa), and the rest belonged to 4 classes, namely, Berkeleyaceae (3 isolates under 2 genera, 3 taxa), Entomoneidaceae (6 isolates under Entomoneis, 4 taxa), Pleurosigmataceae (3 isolates under 2 genera, 2 taxa), and Surirellaceae (1 isolate under 1 taxon). Navicula (17 taxa) and Nitzschia (16 taxa) were abundant in new isolates, followed by Entomoneis (4 taxa), Cylindrotheca (3 taxa), Bacillaria (2 taxa), Berkeleya (2 taxa), and Halsea (2 taxa). Based on the morphological observations, 42 strains (69%) were identified as 35 known taxa; however, 19 strains (31%) remained as 16 unidentified taxa, namely, 6 Navicula, 3 Nitzschia, 3 Entomoneis, and 1 each for Bacillaria, Cylindrotheca, Pleurosigma and Seminavis. The recognized identities and observed morphometric characteristics of the strains are summarized in Table 2; light micrographs of diatoms of the various taxa are shown in Figs 3–6.

Table 2

Morphometric data and classification based on the morphology of diatom strains isolated in this study.

Species name and sequence identity of the closest relative found in GenBank using BLASTn.

Species name	Strainno.	Morphometrics							Ref.	BLASTn
		L1(μm)	W2(μm)	Striae in 10 μm			L6/10 μm	F7/10 μm		18S rDNA		rbcL gene
				T3	L4	O5				Species name	Ident(%).	Species name	Ident.(%)
Bacillariales Hendey
Bacillariaceae Ehrenberg
Bacillaria paxillifer (O.F. Müller) T. Marsson	EW234	55.7	6.5	23			20	7	[37]	Bacillaria paxillifer	99.9	Bacillaria paxillifer	94.3
Unidentified Bacillaria sp.1	SH349	115.7	10.0	20			24	10		Bacillaria cf. paxillifer	98.5	Nitzschia lorenziana Grunow	94.3
Cylindrotheca closterium (Ehrenberg) Reimann & J.C. Lewin	TA256	159.4	3.8					15	[34]	Cylindrotheca closterium	99.6	Cylindrotheca sp.	95.6
Cylindrotheca gracilis (Brébisson ex Kützing) Grunow	TA46	156.3	4.0					20	[37]	Cylindrotheca closterium	98.7	Cylindrotheca closterium	95.1
Unidentified Cylindrotheca sp.1	TA198	45.6	2.8					20		Cylindrotheca fusiformis Reimann & J.C. Lewin	98.7	Cylindrotheca sp.	95.0
Nitzschia aequorea Hustedt	Dilu38	7.4	3.3	55				22	[34]	Nitzschia communis Rabenhorst	99.6	Nitzschia capitellata Hustedt	95.1
Nitzschia bergii A. Cleve	TA139	25.7	5.3	40			22	16	[37]	Nitzschia bizertensis B. Smida, N. Lundholm, A.S. Hlaili & H.H. Mabrouk	99.6	Nitzschia palea (Kützing) W. Smith	95.3
Nitzschia dissipata (Kützing) Rabenhorst	TA44TA192	37.841.4	5.86.1	48				6	[34]	Nitzschia epithemoides Grunow	97.697.0	Nitzschia sigmoidea (Nitzsch) W. Smith	95.696.5
Nitzschia dubia W. Smith	TA37	55.2	12.0	23				10	[37]	Nitzschia dubiformis Hustedt	99.8	Psammodictyon constrictum (Gregory) D.G. Mann	94.6
Nitzschia dubiiformis Hustedt	SH366	48.3	5.0	38				16	[37]	Nitzschia dubiformis	98.7	Nitzschia dubiiformis	93.4
Nitzschia liebetruthii Rabenhorst	TA353	21.1	2.7	21				11	[37]	Nitzschia ovalis H.J. Arnott	96.7	Bacillaria paxillifer	94.5
Nitzschia ligowskii Witkowski, Lange-Bertalot, Kociolek & Brzezinska	TA426	22.0	7.6	26				11	[38]	Nitzschia apiculata (Gregory) Grunow	98.9	Tryblionella apiculata	95.3
Nitzschia paleaeformis Hustedt	TA394	50.0	4.5	36				9	[34]	Nitzschia sp.	98.8	Tryblionella apiculata	94.1
Nitzschia cf. paleacea	TA406	19.1	5.0	48				8	[34]	Bacillaria cf. paxillifer	98.9	Tryblionella apiculata	94.1
Nitzschia pellucida Grunow	EW229	73.7	7.5	33				14	[37]	Nitzschia dubiformis	99.2	Psammodictyon constrictum	92.9
Nitzschia pusilla Grunow	TA-45TA420	20.045.5	4.44.9	5153				1820	[34]	Nitzschia thermalis (Ehrenberg) Auerswald	99.399.3	Nitzschia capitellata	95.395.6
Nitzschia sigma (Kützing) W. Smith	TA341TA377	277.1303.3	8.28.4	2830				6	[37]	Nitzschia bizertensis	96.096.1	Nitzschia capitellata	94.894.9
Nitzschia sigmaformis Hustedt	TA311	84.8	5.2	27				10	[37]	Nitzschia palea	97.5	Nitzschia filiformis (W. Smith) Hustedt	91.2
Unidentified Nitzschia sp.1	Dilu16	11.3	3.7	52				18		Nitzschia thermalis	99.2	Nitzschia capitellata	95.2
Unidentified Nitzschia sp.2	TA61	9.8	3.0	56				20		Nitzschia thermalis	99.5	Nitzschia capitellata	95.0
Unidentified Nitzschia sp.4	TA409	26.9	7.8	40				12		Nitzschia dubiiformis	99.7	Psammodictyon constrictum	94.3
Tryblionella apiculata Gregory	TA-85	30.8	6.7	16					[34]	Nitzschia apiculata	99.6	Tryblionella apiculata	96.5
Naviculales Bessey
Berkeleyaceae D.G.Mann
Berkeleya fennica Juhlin-Dannfelt	TA424	11.7	3.9	369					[37]	Berkeleya rutilans	99.4	Berkeleya rutilans	94.7
Berkeleya rutilans (Trentepohl ex Roth) Grunow	TA440	15.9	4.1	289					[37]	Berkeleya rutilans	99.8	Berkeleya rutilans	99.5
Parlibellus delognei (Van Heurck) E.J. Cox	TA387	36.7	12.7	19					[32]	Prestauroneis integra (W. Smith) K. Bruder	98.92	Craticula cuspidata (Kützing) D.G. Mann	94.2
Naviculaceae Kützing
Haslea nipkowii (Meister) M. Poulin & G. Massé	SH381	130.5	17.8	26	28				[41]	Haslea nipkowii	99.7	Haslea sp.	95.9
Haslea pseudostrearia Massé, Rincé & E.J. Cox	TA280	48.4	6.0	41	35				[39]	Haslea pseudostrearia	100.0	Haslea pseudostrearia	96.7
Navicula agatkae Witkowski	TA291	18.7	4.7	18			15		[37]	Navicula gregaria	99.5	Navicula sp. S0020	96.0
Navicula flagellifera Hustedt	TA105	33.6	6.4	14			40		[37]	Navicula sp.	99.9	Navicula sp. S0020	99.2
Navicula gregaria Donkin	TA289	25.5	5.2	18			29		[33]	Navicula gregaria	99.9	Seminavis cf. robusta	95.4
Navicula incertata Lange-Bertalot	TA414	19.2	3.5	16			48		[33]	Navicula tripunctata (O.F. Müller) Bory de Saint-Vincent	99.6	Navicula sp. S0020	95.6
Navicula perminuta Grunow	TA413 TA441	4.35.6	2.02.0	26			40		[37]	Navicula perminuta	100.0	Seminavis cf. robusta	94.093.9
Navicula ramosissima (C. Agardh) Cleve	TA316 TA439	25.130.8	5.76.9	1215			3840		[37]	Navicula arenaria	99.899.5	Navicula ramosissima	97.797.3
Navicula salinarum Grunow	TA402	37.0	11.7	15			33		[37]	Navicula phyllepta Kützing	99.5	Navicula cryptocephala Kützing	96.0
Navicula salinarum var. minima R. Kolbe	TA416	20.3	6.9	18			42		[37]	Navicula phyllepta	99.6	Navicula cryptocephala	95.4
Navicula cf. salinarum	TA407	36.3	13.8	14			31			Navicula phyllepta	99.5	Navicula cryptocephala	95.6
Navicula salinicola Hustedt	TA204	12.3	3.5	20			40		[37]	Navicula lanceolate (C. Agardh) Kützing	99.5	Navicula sp. S0020	95.8
Navicula trivialis Lange-Bertalot	TA83	49.0	12.5	14			30		[33]	Navicula phyllepta	99.5	Navicula cryptocephala	95.2
Unidentified Navicula sp. 1	TA298	24.0	6.3	12						Navicula ramosissima	99.6	Navicula sp. S0020	95.5
Unidentified Navicula sp. 2	TA64	36.8	10.4	9						Navicula veneta Kützing	98.6	Navicula sp. S0020	95.7
Unidentified Navicula sp. 3	EW220	29.5	7.1	12			20			Navicula lanceolata	99.6	Navicula sp. S0020	95.6
Unidentified Navicula sp. 4	TA323	11.6	5.0	18			36			Navicula sp.	99.6	Navicula ramosissima	96.9
Unidentified Navicula sp. 5	TU3	10.6	5.0	16			39			Navicula sp.	99.9	Navicula sp. S0020	99.6
Unidentified Navicula sp. 6	TA308TA446	11.8	5.6	20			4546			Navicula arenaria Donkin	99.799.5	Navicula sp. S0020	95.795.6
Unidentified Seminavis sp.	TA305	15.9	6.4	18			45			Navicula phyllepta	98.9	Seminavis cf. robusta	95.6
Pleurosigmataceae Mereschowsky
Gyrosigma limosum Sterrenburg & Underwood	TA152TA400	61.696.2	10.711.2	2224	2628				[35]	Gyrosigma acuminatum (Kützing) Rabenhorst	99.7	Gyrosigma acuminatum	96.9
Unidentified Pleurosigma sp.	TA34	91.4	20.0		24	20				Pleurosigma intermedium W. Smith	98.7	Gyrosigma acuminatum	93.9
Surirellales D.G.Mann
Entomoneidaceae Reimer in Patrick & Reimer
Entomoneis paludosa	TA208TA263	41.468.4	35.98	2223					[31]	Entomoneis cf. alata	86.586.5	Surirella sp.Haslea crucigera (W. Smith) Simonsen	96.996.7
Unidentified Entomoneis sp. 1	TA410	30.2	15.78	2510						Entomoneis ornate (Bailey) Reimer	95.6	Haslea crucigera	96.7
Unidentified Entomoneis sp. 2	TA350SH373	50.362.8	29.9835.28	15101610						Enomoneis cf. alataEntomoneis sp.	98.798.8	Haslea crucigera	97.797.7
Unidentified Entomoneis sp. 3	EW239	53.2	41.08	1610						Amphiprora alata (Ehrenberg) Kützing	94.6	Amphiprora alata	96.5
Surirellaceae Kützing
Petrodictyon gemma (Ehrenberg) D.G. Mann	TA201	55.8	25.8						[24]	Cylindrotheca closterium	83.8	Surirella sp.	96.9

1 L, length;

2 W, width;

3 T, transverse;

4 L, longitudinal;

5 O, oblique;

6 L, lineolae;

7 F, fibulae;

8 In girdle view;

9 In the middle of frustule;

10 Striae composed of doubly-punctate striae

Fig 2

Pie chart showing morphological affiliations of the strains isolated in this study.

Fig 3

Light micrograph of diatoms isolated in this study belonging to Cylindrotheca, Nitzschia, and Tryblionella.

(a) Nitzschia paleacea TA406. (b) N. paleaeformis TA394. (c) N. dubiiformis SH366. (d) N. dissipata TA44. (e) N. dubia TA37. (f) N. pellucida EW229. (g) Bacillaria sp.1 SH349. (h) N. sigmaformis TA311. (i) Nitzschia sigma TA341 (400x). (j) Nitzschia sp.1 Dillu16. (k) Nitzschia sp.2 TA61. (l) N. liebetruthii TA353. (m) Nitzschia sp.4 TA409. (n) Tryblionella apiculate TA-85. (o) Cylindrotheca closterium TA256. (p) C. gracilis TA46 (400x). (q) Cylindrotheca sp.1 TA198. (r) Bacillaria paxillifer EW234. (s) Nitzschia bergii TA139. (t) N. ligowskii TA426. (u) N. pusilla TA420. (v) N. aequorea Dillu38. Scale bar = 10 μm. Note that scale bars of 9 and 16 are inside of the picture.

Fig 6

Light micrograph of diatoms isolated in this study belonging to Entomoneis and Petodictyon.

(a, b) Entomoneis paludosa TA208. (c) Entomoneis sp.2 SH373. (d, e) Entomoneis sp.3 EW239. (f, g) Entomoneis sp.1 TA410. (h) Petrodictyon gemma TA201. Scale bar = 10 μm.

Light micrograph of diatoms isolated in this study belonging to Berkeleya, Gyrosigma, Haslea, Parlibellus, and Pleurosigma.

(a) Gyrosigma limosum TA152. (b) Pleurosigma sp.1 TA34. (c) Haslea pseudostrearia TA280. (d) H. nipkowii SH381. (e) Parlibellus delognei TA387. (f) Berkeleya rutilans TA440. (g) B. fennica TA424. Scale bar = 10 μm.

Light micrograph of diatoms isolated in this study belonging to Navicula and Seminavis.

(a) Navicula gregaria TA289. (b) N. agatkae TA291. (c) Navicula incertata TA414. (d) Navicula sp.1 TA298. (e) Navicula sp.5 TU3. (f) Navicula sp.3 EW220. (g) N. ramosissima TA316. (h) N. flagellifera TA105. (i) Navicula sp.2 TA64. (j) N. salinicola TA204. (k) N. perminuta TA441. (l) N. trivialis TA83. (m) N. salinarum TA402. (n) N. cf. salinarum TA407. (o) N. salinarum var. minima TA416. (p) Navicula sp.4 TA323. (q) Navicula sp.6 TA446. (r) Seminavis sp.1 TA305. Scale bar = 10 μm.

Molecular-based identification

Both 18S rRNA and rbcL genes from 61 culture strains were sequenced successfully. The BLASTn results of each 18S rRNA and rbcL sequence are given in Table 2 according to the best matched species and sequence identity. For many strains, the closest relative based on the BLAST search differed from identification based on morphology. The morphological and genetic classification results were consistent for only nine strains with >98.7% identity to their closest relatives based on their 18S rRNA gene sequences (Table 2). Similarly, morphological and genetic identification using the rbcL sequences were consistent only in six strains with relatively high sequence identities, ranging from 94.3% to 99.5% (Table 2).

From the phylogenetic trees, phylogenetic relationships among the isolates can be determined (Figs 7–9). In total, 110 sequences of the 18S rRNA gene and 93 sequences of the rbcL gene were used for the phylogenetic analysis. In the phylogenetic trees of the rbcL gene, most of strains were separated in accordance with their taxonomic positions. In contrast, some strains were not consistent with the morphological classification in the 18S rDNA phylogenies. Petrodictyon gemma TA201, belonging to Surirellaceae, clustered with Entomoneis ornata strain 14A, belonging to Entomoneidaceae, with a long branch in the ML tree of 18S rDNA (Fig 7). Additionally, two Entomoneis paludosa strains, TA208 and TA263, showed another long branch (Fig 7). Unlike the ML tree, however, P. gemma and the two E. paludosa strains clustered together with a long branch in the NJ and MP phylogenies. Thus, in the 18S rDNA tree, the phylogenetic positions of these species were unstable. In the Naviculales, despite the fact that the morphological features were similar to those of naviculoids, the tube-dwelling diatoms Berkeleya and Parlibellus did not cluster in the naviculoid group, but rather in asymmetrical biraphid diatoms with a low bootstrap value in the 18S rDNA phylogenies (Fig 7). In addition, several different species were not clearly differentiated in the 18S rDNA phylogenies, such as Berkeleya rutilans TA440 and Berkeleya fennica TA424, which had a very low sequence distance (Fig 7, Table 2). A similar low resolution was also found among Navicula salinarum TA402, Navicula trivialis TA83, and N. cf. trivialis TA407 (Fig 8).

Fig 7

Phylogenetic trees obtained using 18S rRNA (a) and Bootstrap values obtained by neighbor–joining, maximum–likelihood, and maximum–parsimony methods are shown on the nodes. Expanded tree of Navicula sensu stricto and Nitzschia sensu stricto are shown in Figs 8 and 9, respectively.

Fig 9

Phylogenetic tree of Bootstrap value obtained by neighbor–joining, maximum–likelihood, and maximum–parsimony methods are shown on the nodes.

Fig 8

Phylogenetic tree of Bootstrap value obtained by neighbor–joining, maximum–likelihood, and maximum–parsimony methods are shown on the nodes.

Using the sequences obtained in this study, we analyzed divergence levels of the 18S rRNA and rbcL genes (Table 3). Although the divergence levels of 18S rRNA genes were higher than those of rbcL genes in the genus Entomoneis due to long branches, the genetic distance of the rbcL gene within the genus was, on average, double that of the 18S rRNA gene. Furthermore, the genetic distance of rbcL was three times higher than that of 18S rRNA in two dominant benthic genera, Navicula and Nitzschia.

Table 3

Nucleotide sequence distances of the 18s rRNA and rbcL genes within a genus according to Jukes and Cantor [47] model.

Order	Genus	No. of strains	Genetic distance
			18S rDNA	rbcL
Naviculales	Navicula	21	0.015	0.050
	Haslea	2	0.037	0.047
	Berkeleya	2	0.003	0.049
	Gyrosigma	2	0.003	0.021
Bacillariales	Bacillaria	2	0.022	0.056
	Nitzschia	20	0.036	0.078
	Cylindrotheca	3	0.010	0.065
Surirellales	Entomoneis	6	0.074	0.048
Average			0.060	0.089

Discussion

In this study, we attempted to identify and classify benthic diatoms by the polyphasic approach using both morphological characteristics and molecular markers and suggested that molecular approach using rbcL gene could become a better alternative to traditional morphological classification approach. Despite a long history of taxonomic studies on benthic diatoms, overcoming the difficulties associated with identification and classification of diatoms is a major challenge because of their small size and morphological similarities. In the process of identifying the strains obtained in this study, many strains were not morphologically identified at the species level due to these difficulties. Although more strains might be identifiable by a thorough literature review and some may be confirmed to be a new species, it is evident that morphometric classification is a laborious and time-consuming procedure. Some previous studies avoided identification at the species level or dealt only with the community dynamics of benthic diatoms [12, 13]. Therefore, the community structure of diatoms and their distribution in tidal flats have not been clearly elucidated [48]. To reveal easily and quickly the hidden diversity of benthic diatoms, largely attributed to their very small and similar morphologies, the development of molecular barcoding techniques is urgently needed. To enable this, it is necessary to construct a reliable genetic database.

The quality of a database has a direct and absolute influence on the applicability and efficiency of DNA barcoding techniques [49]. Currently, genetic information on most species could not be found in GenBank, indicating that the database is still insufficient, and that molecular taxonomic studies on benthic diatoms are limited. At the time of writing, the numbers of 18S rDNA and rbcL gene sequences deposited in GenBank are 4,775 and 3,099, and the number of species are reduced to 811 and 709, respectively. Despite the fact that extant diatoms are estimated to include 30,000–100,000 species [50], there is no genetic information on the majority of such species. Owing to the limited data available in GenBank, the closest relatives of most 18S rDNA sequences did not match the classifications by morphological identification (Table 2). These inconsistencies were more apparent in the case of the rbcL gene.

In this study, six groups of diatoms, namely, Bacillariaceae, Naviculaceae, Pleurosigmataceae, Berkeleyaceae, Entomoneidaceae, and Surirellaceae, were clearly distinguished and formed monophyletic groups in the phylogenetic trees of rbcL gene. In the 18S rDNA analyses, despite a morphological difference, some diatom sequences showed high similarity (more than 99%) to those of other species. These relatively high sequence similarities might have been due to either misidentification of records deposited in GenBank or low resolution of the 18S rDNA gene [18, 19]. However, a relatively low sequence distance within a genus shows that 18S rDNA is not an appropriate genetic marker to differentiate diatom species clearly, as is seen in the case of lower resolution among species and polyphyletic characteristics of several species (Table 2). For example, Navicula salinarum TA402, N. cf. salinarum TA407, and N. trivialis TA83 are similar but morphologically different species. N. trivialis TA83 has subrostrate apices and a central area that is bound by mostly shortened striae, whereas N. salinarum TA402 has rostrate apices and a central area that is formed by alternating long and short striae [31, 33]. However, the 18S rDNA sequences of these species are almost identical, and therefore cannot be clearly distinguished from each other (Fig 8). Similarly, Berkeleya fennica, which can be distinguished by its smaller and denser striae (over 30/10 μm) from B. rutilans [40], were not clearly differentiated from B. rutilans in the 18S rDNA phylogenetic tree. In addition, the Surirelloid diatom Petrodictyon gemma was clustered with Entomoneis by a long branch in the 18S rDNA phylogeny. This long branch attraction artefact was also found in the 18S rDNA phylogenies of Haslea nipkowii and Neidium affine [51], indicating that unusually rapid evolutionary events have occurred in the 18S rRNA genes of some benthic diatoms [52]. In this respect, it is apparent that the 18S rRNA gene of some benthic diatoms has undergone unusually rapid evolutionary changes. Thus, although 18S rRNA has been widely used in phylogenetic studies on diatoms and has the largest database compared with other genetic markers [20, 22, 23], it is unsuitable as a marker for the study of diatom biodiversity because of its low resolution [20].

Conversely, the rbcL gene varies markedly compared with 18S rDNA [16]. Consistently in this study, the rbcL gene showed higher divergence levels than those of the 18S rRNA gene, with a few exceptions in Entomoneis and Haslea, which were supposed to have undergone rapid evolutionary changes in 18S rDNA (Figs 7 and 8). Furthermore, long branch artefacts were not found among the rbcL phylogeny. In addition, the rbcL gene, a plastid–encoded gene, is advantageous in its use as a genetic marker because of its high PCR success rate (i.e., ease of amplification), simplicity of alignment, and low susceptibility to interference by heterotrophic contaminants [53]. However, the deficiencies in databases must still be addressed. Hamsher et al. [54] reported that the range of divergence in the rbcL gene sequence among species in the genus Sellaphora was 0.14–0.73%. Also, Kermarrec et al. [55] suggested 99% and 98% rbcL gene sequence identities as the thresholds for species- and genus-level classifications, respectively. However, most strains obtained in this study shared a sequence identity of 97% or less with sequences in the GenBank database. These results indicate that much of the necessary information remains unknown. However, it is still clear that the rbcL gene would be more appropriate than 18S rDNA for the molecular taxonomy and phylogenetic analyses of benthic diatoms.

Despite the ecological importance of benthic diatom community, their identification and classification systems still need to be improved. In this study, we showed that a large proportion of diatoms could not be identified by morphological characteristics and that genetic information should be expanded for molecular phylogenetic analyses. Furthermore, rbcL gene is suggested as a superior genetic marker to 18S rRNA gene to identify and phylogenetically classify benthic diatoms. The huge number of diatom species estimated in various environments suggests a need for more efforts to construct a reliable database containing polyphasic taxonomic data.